scholarly journals PCR amplification and sequence analyses of reverse transcriptase-like genes in Crinipellis perniciosa isolates

2007 ◽  
Vol 32 (5) ◽  
pp. 373-380 ◽  
Author(s):  
Jorge F. Pereira ◽  
Mariana D.C. Ignacchiti ◽  
Elza F. Araújo ◽  
Sérgio H. Brommonschenkel ◽  
Júlio C.M. Cascardo ◽  
...  
Keyword(s):  
Reverse Transcriptase ◽  
Pathogenic Fungus ◽  
Pcr Amplification ◽  
Restriction Enzymes ◽  
Sequence Comparisons ◽  
Copy Numbers ◽  
A Genome ◽  
Close Relationship ◽  
Pcr Products ◽  
Broom Disease

Reverse transcriptase (RT) sequence analysis is an important technique used to detect the presence of transposable elements in a genome. Putative RT sequences were analyzed in the genome of the pathogenic fungus C. perniciosa, the causal agent of witches' broom disease of cocoa. A 394 bp fragment was amplified from genomic DNA of different isolates of C. perniciosa belonging to C-, L-, and S-biotypes and collected from various geographical areas. The cleavage of PCR products with restriction enzymes and the sequencing of various RT fragments indicated the presence of several sequences showing transition events (G:C to A:T). Southern blot analysis revealed high copy numbers of RT signals, forming different patterns among C-, S-, and L-biotype isolates. Sequence comparisons of the predicted RT peptide indicate a close relationship with the RT protein from thegypsy family of LTR-retrotransposons. The possible role of these retrotransposons in generating genetic variability in the homothallic C. perniciosa is discussed.

RT-PCR analysis of Na+/H+ exchanger mRNAs in rat medullary thick ascending limb

1995 ◽  
Vol 268 (6) ◽  
pp. F1224-F1228 ◽  
Author(s):  
P. Borensztein ◽  
M. Froissart ◽  
K. Laghmani ◽  
M. Bichara ◽  
M. Paillard
Keyword(s):  
Rat Kidney ◽  
Pcr Amplification ◽  
Restriction Enzymes ◽  
Pcr Analysis ◽  
Thick Ascending Limb ◽  
Rt Pcr ◽  
Medullary Thick Ascending Limb ◽  
Pcr Products ◽  
Polymerase Chain ◽  
Nhe Isoforms

The thick ascending limb (TAL) of rat kidney absorbs bicarbonate secondary to proton secretion, but displays both basolateral and luminal Na+/H+ exchange (NHE) activity. Several NHE genes, including NHE-1, NHE-2, NHE-3, and NHE-4, are expressed in the kidney. To identify the NHE isoforms expressed in the rat medullary TAL (MTAL), we used the reverse transcription-polymerase chain reaction (RT-PCR) to detect the mRNAs for NHE in microdissected MTAL. RT-PCR amplification from total RNA was performed between two specific primers for each NHE isoform. In rat kidney homogenate, the four NHE isoform mRNAs were detected, and the identity of the PCR products was demonstrated by the sizes of the fragments, digestion with restriction enzymes, and Southern blot analysis. In microdissected rat MTAL, NHE-3 was strongly expressed and NHE-1 mRNA was also detected, whereas NHE-2 and NHE-4 mRNAs were not detected. Therefore, NHE-3 could be the apical Na+/H+ exchanger, and NHE-1 could be the basolateral isoform in the MTAL.

scholarly journals Taxa of Leafhoppers Carrying Phytoplasmas at Sites of Ash Yellows Occurrence in New York State

Plant Disease ◽  
2000 ◽  
Vol 84 (2) ◽  
pp. 134-138 ◽  
Author(s):  
G. T. Hill ◽  
W. A. Sinclair
Keyword(s):  
New York ◽  
New York State ◽  
Pcr Amplification ◽  
Restriction Enzymes ◽  
Disease Group ◽  
York State ◽  
Aster Yellows ◽  
Pcr Products ◽  
Polymerase Chain ◽  
Abundant Genus

Leafhopper (Homoptera: Cicadellidae) populations were sampled and leafhopper carriers of ash yellows (AshY) phytoplasmas were identified as first steps toward vector identification. Nearly 5,000 leafhoppers were collected in malaise traps at two sites of high AshY incidence in New York state in 1996 and 1997. These insects comprised 33 taxa, including representatives of 13 genera known to contain phytoplasma vectors. The most abundant genus was Scaphoideus, with numbers about six times greater than any other genus. A total of 1,632 insects were assayed individually for phytoplasmas by polymerase chain reaction (PCR) amplification of phytoplasmal 16S rDNA and restriction fragment length polymorphism analyses of PCR products using restriction enzymes TaqI and RsaI separately. Phytoplasmas were detected in 35 insects, all but one in the subfamily Deltocephalinae. AshY phytoplasmas were detected in 19 of 812 individuals of Scaphoideus spp. and 1 of 87 of Colladonus clitellarius. Phytoplasmas of the Prunus X-disease group were detected in 1 Scaphoideus sp., 4 individuals of C. clitellarius, and 4 of 83 Scaphytopius acutus individuals. Phytoplasmas of the aster yellows group were detected in 1 of 68 individuals of Gyponana spp. and 5 of S. acutus. AshY phytoplasma carriers merit testing for possible vector ability.

scholarly journals Widespread Occurrence of Tomato Geminiviruses in Brazil, Associated with the New Biotype of the Whitefly Vector

Plant Disease ◽  
1998 ◽  
Vol 82 (7) ◽  
pp. 830-830 ◽  
Author(s):  
S. G. Ribeiro ◽  
A. C. de Ávila ◽  
I. C. Bezerra ◽  
J. J. Fernandes ◽  
J. C. Faria ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Federal District ◽  
The State ◽  
Streak Virus ◽  
Sequence Comparisons ◽  
Tomato Plants ◽  
Reading Frame ◽  
Economic Significance ◽  
Close Relationship ◽  
Pcr Products

Although tomato golden mosaic virus (TGMV) was reported in Brazil more than 20 years ago (3), tomato-infecting geminiviruses have not been of economic significance in the country until recently. However, a sharp increase in the incidence of geminivirus-like symptoms in tomatoes has been reported in several areas of Brazil since 1994. This has coincided with the appearance of the B biotype of Bemisia tabaci, which, as opposed to the A biotype, readily colonizes solanaceous plants (2). We have isolated geminiviruses from symptomatic tomato plants in the Federal District, in two different areas of the state of Minas Gerais, and in the state of Pernambuco. Tomato plants in these areas showed a variety of symptoms, including yellow mosaic, severe leaf distortion, down-cupping, and epinasty. Whitefly infestation was high in all fields sampled, and in some fields, particularly in Pernambuco, incidence of virus-like symptoms was close to 100%, and no tomatoes of commercial value were harvested (1). Using primer pairs PAL1v1978/PAR1c496 and PCRc1/PBL1v2040 (4), DNA-A and -B fragments were polymerase chain reaction (PCR)-amplified from total DNA extracted from diseased plants, cloned, and sequenced. Sequence comparisons of the PCR fragments indicated the existence of at least six different geminiviruses. The nucleotide sequence homologies for DNA-A fragments ranged from 67 to 80% for the 5′ end of the cp gene, and from 44 to 80% for the 5′ end of the rep gene. Data base comparisons indicated the viruses are most closely related to TGMV, bean golden mosaic virus from Brazil (BGMV-Br), and tomato yellow vein streak virus (ToYVSV), although homologies were less than 80% for the fragments compared. A similar lack of a close relationship with each other and other geminiviruses was obtained with two DNA-B component PCR products compared, corresponding to the 5′ end of the BC1 open reading frame. Infectious, full-length genomic clones from the tomato viruses are being generated for biological and molecular characterization. References: (1) I. C. Bezerra et al. Fitopatol. Bras. 22:331, 1997. (2) F. H. França et al., Ann. Soc. Entomol. Bras. 25:369, 1996. (3) J. C. Matyis et al. Summa Phytopathol. 1:267, 1975. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals First Report of Potato mop-top virus on Potato in Poland

Plant Disease ◽  
2010 ◽  
Vol 94 (7) ◽  
pp. 920-920 ◽  
Author(s):  
M. Budziszewska ◽  
P. Wieczorek ◽  
K. Nowaczyk ◽  
N. Borodynko ◽  
H. Pospieszny ◽  
...  
Keyword(s):  
Pcr Amplification ◽  
Potato Production ◽  
Amino Acid Identity ◽  
Sequence Comparisons ◽  
First Report ◽  
Pcr Products ◽  
Potato Mop Top Virus ◽  
Negative Controls ◽  
North And South America ◽  
Das Elisa

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5′GGTTTGTTTACCACCCTTGG3′ (3) and PMTV2 5′AAAAGCCTGAGCGGTTAATTG3′ (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Łódź County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production. References: (1) S. Chang et al. Plant Mol Biol Rep. 11:113, 1993. (2) A. Germundsson et al. J. Gen. Virol. 83:1201, 2002. (3) S. Latvala-Kilby et al. Phytopathology 99:519, 2009.

scholarly journals Isolation and characterization of Listeria monocytogenes from environmental and clinical sources by culture and PCR-RFLP methods

2019 ◽  
Author(s):  
Hossein Meghdadi ◽  
Azar Dokht Khosravi ◽  
Ahmad Farajzadeh Sheikh ◽  
Ameneh Alami ◽  
Nerssy Nassirabady
Keyword(s):  
Listeria Monocytogenes ◽  
Pcr Amplification ◽  
Rflp Analysis ◽  
Restriction Enzymes ◽  
Clinical Samples ◽  
Biochemical Tests ◽  
Clinical Complications ◽  
Isolation And Characterization ◽  
Rflp Profile ◽  
Pcr Products

Background and Objectives: Due to the widespread distribution of Listeria monocytogenes in environmental and animal sources and serious clinical complications in human, this study was aimed to isolate L. monocytogenes from water and clin- ical specimens by culture and PCR methods and to investigate the presence of hlyA and inlA virulence genes. Materials and Methods: Water and clinical samples of vaginal and fecal were screened for the presence of L. monocyto- genes by phenotypic and standard biochemical tests. PCR amplification was performed on extracted DNA using primers based on the hlyA and inlA genes. A 733-bp fragment of inlA gene was used for investigation of polymorphism using RFLP analysis. Results: In total, 45 phenotypically and molecularly confirmed L. monocytogenes strains were isolated from different sourc- es including 30 (16.7%) from water, 9 (11.3%) from vaginal swabs and 6 (7.5%) from fecal samples. RFLP analysis of PCR products using AluI and Tsp509I restriction enzymes, generated two profiles with 8 to 10 bands ranging in size from 15 to 210 bp. The majority of water and clinical isolates were classified in profile 2. Conclusion: We demonstrated 45 L. monocytogenes isolates from tested water and clinical samples by phenotypic and mo- lecular tests. The majority of the isolates were classified in the same RFLP profile, showing the water as a potential source of clinical complications in patients in the region of study.

scholarly journals First Report of Witches'-Broom Disease of Sesame (Sesamum indicum) in Oman

Plant Disease ◽  
2005 ◽  
Vol 89 (5) ◽  
pp. 530-530 ◽  
Author(s):  
M. A. Al-Sakeiti ◽  
A. M. Al-Subhi ◽  
N. A. Al-Saady ◽  
M. L. Deadman
Keyword(s):  
Nested Pcr ◽  
Restriction Enzymes ◽  
Negative Control ◽  
Direct Pcr ◽  
First Report ◽  
Pcr Products ◽  
Broom Disease ◽  
Short Shoots ◽  
Template Dna ◽  
Positive Controls

Sesame is the major oil seed crop in Oman. During 2004, disease symptoms were observed at Nizwa, 175 km south of Muscat. Symptoms included phyllody and excessive development of short shoots and internodes resulting in little leaves. Total genomic DNA was extracted from healthy and symptomatic plants with a modified cetyltrimethylammoniumbromide (CTAB) buffer method (2). DNA samples were assayed by polymerase chain reaction (PCR), with the 16S rDNA amplified using primers P1 and P7. Direct PCR products were used as template DNA for nested PCR with primers R16F2n and R16R2. Direct PCR products were analyzed by restriction fragment length polymorphism (RFLP) with four restriction enzymes, Tru9I, HaeIII, HhaI, and RsaI. DNAs from alfalfa and lime plants infected by witches'-broom phytoplasmas were used as positive controls and DNA from healthy plants and water were negative controls. The results showed the presence of a 1.8-kb product amplified with the direct PCR and a 1.2-kb product of the nested PCR from infected sesame and the positive controls. No PCR product was observed in the negative control. The PCR assay confirmed the presence of phytoplasma causing witches'-broom disease in sesame. The RFLP results showed the sesame phytoplasma to be most similar to the alfalfa phytoplasma, a member of 16SrII group (1). To our knowledge, this is the first report of a phytoplasma of the 16Sr II group causing witches'-broom disease on sesame in the Sultanate of Oman. References: (1) A. J. Khan et al. Phytopathology 92:1038, 2002. (2) M. A. Saghai-Maroof et al. Proc. Natl. Acad. Sci. USA, 81:8014, 1984.

Ty1-copia-like retrotransposons of tomato (Lycopersicon esculentum Mill.)

Genome ◽  
2000 ◽  
Vol 43 (5) ◽  
pp. 887-894 ◽  
Author(s):  
Sean A Rogers ◽  
K Peter Pauls
Keyword(s):  
Lycopersicon Esculentum ◽  
Reverse Transcriptase ◽  
Sequence Similarity ◽  
Pcr Amplification ◽  
Lycopersicon Esculentum Mill ◽  
Copy Numbers ◽  
Degenerate Oligonucleotide ◽  
Cloning Strategy ◽  
Copia Retrotransposon ◽  
The Individual

We have used a PCR and cloning strategy to identify Ty1-copia-like retrotransposons in tomato, Lycopersicon esculentum Mill. Using degenerate oligonucleotide primers corresponding to conserved domains of the Ty1-copia retrotransposon reverse transcriptase (RT), fragments of about 260 bp were obtained by PCR amplification. Sequences of 20 cloned amplification fragments showed similarity to retrotransposon sequences. The copy number for total tomato Ty1-copia-like RT population was estimated to be approximately 2500 and may account for about 1.5% of the tomato genome. Copy numbers for four of the individual RT clones ranged from 20 to 1400 copies. A comparison of the conceptual translations of the RT sequences identified four clusters as well as three sequences which were ungrouped. When compared to RT sequences reported from several other sources, the tomato RT population was found to be widely dispersed with the majority of the RT sequences from Lycopersicon species delineated by the four tomato cluster groups. The gag region of a tomato retrotransposon was cloned from PCRs with primers based on the Tnt1 retrotransposon of tobacco. The tomato clone (pTom1.1) had 81% sequence similarity to the Tnt1 gag region. Several pTom1.1 sequences are present in other solanaceous species as indicated by Southern hybridization.Key words: gag region, retroelements, retrotransposon, reverse transcriptase, tomato.

In Situ, Real-Time Catabolic Gene Expression: Extraction and Characterization of Naphthalene Dioxygenase mRNA Transcripts from Groundwater

1999 ◽  
Vol 65 (1) ◽  
pp. 80-87 ◽  
Author(s):  
Mark S. Wilson ◽  
Corien Bakermans ◽  
Eugene L. Madsen
Keyword(s):  
Coal Tar ◽  
Sodium Dodecyl ◽  
Pcr Amplification ◽  
Pcr Primers ◽  
Contaminated Site ◽  
Sequence Comparisons ◽  
Degrading Bacteria ◽  
Genes Encoding ◽  
Pcr Products

ABSTRACT We developed procedures for isolating and characterizing in situ-transcribed mRNA from groundwater microorganisms catabolizing naphthalene at a coal tar waste-contaminated site. Groundwater was pumped through 0.22-μm-pore-size filters, which were then frozen in dry ice-ethanol. RNA was extracted from the frozen filters by boiling sodium dodecyl sulfate lysis and acidic phenol-chloroform extraction. Transcript characterization was performed with a series of PCR primers designed to amplify nahAc homologs. Several primer pairs were found to amplify nahAc homologs representing the entire diversity of the naphthalene-degrading genes. The environmental RNA extract was reverse transcribed, and the resultant mixture of cDNAs was amplified by PCR. A digoxigenin-labeled probe mixture was produced by PCR amplification of groundwater cDNA. This probe mixture hybridized under stringent conditions with the corresponding PCR products from naphthalene-degrading bacteria carrying a variety of nahAchomologs, indicating that diverse dioxygenase transcripts had been retrieved from groundwater. Diluted and undiluted cDNA preparations were independently amplified, and 28 of the resulting PCR products were cloned and sequenced. Sequence comparisons revealed two major groups related to the dioxygenase genes ndoB anddntAc, previously cloned from Pseudomonas putida NCIB 9816-4 and Burkholderia sp. strain DNT, respectively. A distinctive subgroup of sequences was found only in experiments performed with the undiluted cDNA preparation. To our knowledge, these results are the first to directly document in situ transcription of genes encoding naphthalene catabolism at a contaminated site by indigenous microorganisms. The retrieved sequences represent greater diversity than has been detected at the study site by culture-based approaches.

Molecular characterization of the Glu-Ay gene from Triticum urartu for its potential use in quality wheat breeding

2011 ◽  
Vol 9 (2) ◽  
pp. 334-337 ◽  
Author(s):  
M. V. Gutiérrez ◽  
C. Guzmán ◽  
L. M. Martín ◽  
J. B. Alvarez
Keyword(s):  
Storage Proteins ◽  
Pcr Amplification ◽  
Wheat Breeding ◽  
Triticum Urartu ◽  
Bread Making ◽  
Genome Donor ◽  
A Genome ◽  
Pcr Products ◽  
Modern Wheat ◽  
Genetic Pool

Triticum urartu Thum. ex Gandil. is a wild species identified as A-genome donor for polyploid wheats, which could be used as gene source for wheat breeding. The high-molecular weight glutenin subunits are endosperm storage proteins that are associated with bread-making quality. In T. urartu, these proteins are encoded by the Ax and Ay genes at the Glu-Au1 locus. The Ay gene of 17 Glu-Au1 allelic variants previously detected in this species has been analysed using PCR amplification and digestion of the PCR products with two endonucleases (DdeI and PstI). The combination of two restriction patterns has revealed variations between the active and inactive alleles, and within each type. This variation, especially that detected among the active alleles, could enlarge the high-quality genetic pool of modern wheat and be used for bread-making quality improvement in durum and common wheat.

scholarly journals Presence of plasmid-mediated quinolone resistance (PMQR) genes in non-typhoidal Salmonella strains with reduced susceptibility to fluoroquinolones isolated from human salmonellosis in Gyeonggi-do, South Korea from 2016 to 2019

Gut Pathogens ◽  
2021 ◽  
Vol 13 (1) ◽  
Author(s):  
Sohyun Lee ◽  
Nanjoo Park ◽  
Sujung Yun ◽  
Eunseon Hur ◽  
Jiwon Song ◽  
...  
Keyword(s):  
South Korea ◽  
Pcr Amplification ◽  
Public Health Problem ◽  
Test Method ◽  
Quinolone Resistance ◽  
Human Salmonellosis ◽  
Pcr Products ◽  
Antimicrobial Susceptibility Tests ◽  
Susceptibility Tests ◽  
Sequence Types

AbstractNon-typhoidal salmonellosis remains a pressing public health problem worldwide. Quinolones, particularly fluoroquinolones, are widely used to treat various infections, including non-typhoidal salmonellosis, which can be a serious illness. The emergence of fluoroquinolone-resistant Salmonella has resulted in treatment failure and high mortality rates. In this study, we estimated the presence of plasmid-mediated quinolone resistance (PMQR) genes in Salmonella enterica isolated from human salmonellosis patients in South Korea from 2016 to 2019. We evaluated the association of these genes with fluoroquinolone susceptibility. Antimicrobial susceptibility tests for Salmonella isolates were performed using the Vitek II system, and the minimum inhibitory concentrations (MIC) of ciprofloxacin and levofloxacin were determined using the E-test method. Plasmid-mediated quinolone resistance (PMQR) genes were detected by PCR amplification and quinolone resistance-determining regions (QRDRs) of the gyrA and parC genes were analyzed following Sanger sequencing of the PCR products. Thirty-four Salmonella strains with reduced susceptibility to fluoroquinolones (ciprofloxacin MIC ≥ 0.125 µg/mL and levofloxacin MIC ≥ 0.25 µg/mL) were selected from 208 human clinical Salmonella isolates. Among them, 22 Salmonella strains harbored one PMQR gene (qnrA, qnrB, or qnrS), and three Salmonella strains carried two PMQR genes (qnrS and aac(6′)-Ib-cr or qnrA and qnrB). qnrS was the most common PMQR gene. Serotyping revealed that Salmonella 4,[5]12:i:- (32.4%, 11/34) and Salmonella Typhimurium (29.4%, 10/34) were the two most predominant serovars, and Multi-locus sequence typing (MLST) showed that ST19 and ST34 were the most frequent sequence types. In conclusion, qnr gene-positive Salmonella 4,[5],12:i:- and Salmonella Typhimurium were the main serovars responsible for reduced susceptibility to fluoroquinolones. Therefore, our findings suggest that PMQR-positive Salmonella strains, which can be isolated from various samples including human, food, and the environment, should be carefully monitored.

Sign in / Sign up

Export Citation Format

Share Document