Insight into the Dual Functions of Bacterial Enhancer-Binding Protein Rrp2 of Borrelia burgdorferi

ABSTRACTIt is well established that the RpoN-RpoS sigma factor (σ54-σS) cascade plays an essential role in differential gene expression during the enzootic cycle ofBorrelia burgdorferi, the causative agent of Lyme disease. The RpoN-RpoS pathway is activated by the response regulator/σ54-dependent activator (also called bacterial enhancer-binding protein [bEBP]) Rrp2. One unique feature of Rrp2 is that this activator is essential for cell replication, whereas RpoN-RpoS is dispensable for bacterial growth. How Rrp2 controls cell replication, a function that is independent of RpoN-RpoS, remains to be elucidated. In this study, by generating a series of conditionalrrp2mutant strains, we demonstrated that the N-terminal receiver domain of Rrp2 is required for spirochetal growth. Furthermore, a D52A point mutation at the phosphorylation site within the N terminus of Rrp2 abolished cell replication. Mutation of the ATPase motif within the central domain of Rrp2 did not affect spirochetal replication, indicating that phosphorylation-dependent ATPase activity of Rrp2 for σ54activation is not required for cell growth. However, deletion of the C-terminal domain or a 16-amino-acid truncation of the helix-turn-helix (HTH) DNA-binding motif within the C-terminal domain of Rrp2 abolished spirochetal replication. It was shown that constitutive expression ofrpoSis deleterious to borrelial growth. We showed that the essential nature of Rrp2 is not due to an effect onrpoS. These data suggest that phosphorylation-dependent oligomerization and DNA binding of Rrp2 likely function as a repressor, independently of the activation of σ54, controlling an essential step of cell replication inB. burgdorferi.IMPORTANCEBacterial enhancer-binding proteins (bEBPs) are a unique group of transcriptional activators specifically required for σ54-dependent gene transcription. This work demonstrates that theB. burgdorferibEBP, Rrp2, has an additional function that is independent of σ54, that of its essentiality for spirochetal growth, and such a function is dependent on its N-terminal signal domain and C-terminal DNA-binding domain. These findings expand our knowledge on bEBP and provide a foundation to further study the underlying mechanism of this new function of bEBP.

Download Full-text

Natural synthesis of a DNA-binding protein from the C-terminal domain of DNA gyrase A in Borrelia burgdorferi

The EMBO Journal ◽

10.1093/emboj/18.17.4875 ◽

1999 ◽

Vol 18 (17) ◽

pp. 4875-4881 ◽

Cited By ~ 34

Author(s):

S. W. Knight

Keyword(s):

Dna Binding ◽

Borrelia Burgdorferi ◽

Binding Protein ◽

Dna Gyrase ◽

Dna Binding Protein ◽

Terminal Domain ◽

Gyrase A

Download Full-text

Disruption of the Borrelia burgdorferi gac Gene, Encoding the Naturally Synthesized GyrA C-Terminal Domain

Journal of Bacteriology ◽

10.1128/jb.182.7.2048-2051.2000 ◽

2000 ◽

Vol 182 (7) ◽

pp. 2048-2051 ◽

Cited By ~ 18

Author(s):

Scott W. Knight ◽

Betsy J. Kimmel ◽

Christian H. Eggers ◽

D. Scott Samuels

Keyword(s):

Dna Binding ◽

Borrelia Burgdorferi ◽

Binding Protein ◽

Dna Gyrase ◽

Dna Binding Protein ◽

Gene Encoding ◽

Terminal Domain ◽

A Subunit ◽

Dna Maintenance ◽

Independent Protein

ABSTRACT The C-terminal domain of the A subunit of DNA gyrase, which we term Gac, is naturally synthesized in Borrelia burgdorferi as an abundant DNA-binding protein. Full-length GyrA, which includes the C-terminal domain, is also synthesized by the spirochete and functions as a subunit of DNA gyrase. We have disrupted synthesis of Gac as an independent protein and demonstrated that it is not essential for growth in a coumarin-resistant background. We detected no alterations in DNA maintenance, condensation, or topology in B. burgdorferi lacking this small DNA-binding protein.

Download Full-text

Specific DNA binding to a major histocompatibility complex enhancer sequence by a synthetic 57-residue double zinc finger peptide from a human enhancer binding protein.

Journal of Biological Chemistry ◽

10.1016/s0021-9258(20)89645-8 ◽

1991 ◽

Vol 266 (11) ◽

pp. 7306-7311

Author(s):

K Sakaguchi ◽

E Appella ◽

J G Omichinski ◽

G M Clore ◽

A M Gronenborn

Keyword(s):

Major Histocompatibility Complex ◽

Dna Binding ◽

Zinc Finger ◽

Binding Protein ◽

Major Histocompatibility ◽

Enhancer Sequence ◽

Histocompatibility Complex ◽

Enhancer Binding Protein ◽

Zinc Finger Peptide

Download Full-text

Prevention of CCAAT/Enhancer-binding Protein β DNA Binding by Hypoxia during Adipogenesis

Journal of Biological Chemistry ◽

10.1074/jbc.m109.059212 ◽

2009 ◽

Vol 285 (5) ◽

pp. 3289-3299 ◽

Cited By ~ 22

Author(s):

Young-Kwon Park ◽

Hyunsung Park

Keyword(s):

Dna Binding ◽

Binding Protein ◽

Enhancer Binding Protein ◽

Ccaat Enhancer Binding Protein

Download Full-text

A novel DNA-binding motif in the nuclear matrix attachment DNA-binding protein SATB1

Molecular and Cellular Biology ◽

10.1128/mcb.14.3.1852-1860.1994 ◽

1994 ◽

Vol 14 (3) ◽

pp. 1852-1860

Author(s):

K Nakagomi ◽

Y Kohwi ◽

L A Dickinson ◽

T Kohwi-Shigematsu

Keyword(s):

Amino Acid ◽

Dna Binding ◽

Direct Contact ◽

Binding Protein ◽

Binding Activity ◽

Binding Domain ◽

Binding Motif ◽

Dna Binding Domain ◽

Sequence Context ◽

Dna Binding Activity

The nuclear matrix attachment DNA (MAR) binding protein SATB1 is a sequence context-specific binding protein that binds in the minor groove, making virtually no contact with the DNA bases. The SATB1 binding sites consist of a special AT-rich sequence context in which one strand is well-mixed A's, T's, and C's, excluding G's (ATC sequences), which is typically found in clusters within different MARs. To determine the extent of conservation of the SATB1 gene among different species, we cloned a mouse homolog of the human STAB1 cDNA from a cDNA expression library of the mouse thymus, the tissue in which this protein is predominantly expressed. This mouse cDNA encodes a 764-amino-acid protein with a 98% homology in amino acid sequence to the human SATB1 originally cloned from testis. To characterize the DNA binding domain of this novel class of protein, we used the mouse SATB1 cDNA and delineated a 150-amino-acid polypeptide as the binding domain. This region confers full DNA binding activity, recognizes the specific sequence context, and makes direct contact with DNA at the same nucleotides as the whole protein. This DNA binding domain contains a novel DNA binding motif: when no more than 21 amino acids at either the N- or C-terminal end of the binding domain are deleted, the majority of the DNA binding activity is lost. The concomitant presence of both terminal sequences is mandatory for binding. These two terminal regions consist of hydrophilic amino acids and share homologous sequences that are different from those of any known DNA binding motifs. We propose that the DNA binding region of SATB1 extends its two terminal regions toward DNA to make direct contact with DNA.

Download Full-text

Inhibition of CCAAT/Enhancer Binding Protein Family DNA Binding in Mouse Epidermis Prevents and Regresses Papillomas

Cancer Research ◽

10.1158/0008-5472.can-06-2746 ◽

2007 ◽

Vol 67 (4) ◽

pp. 1867-1876 ◽

Cited By ~ 19

Author(s):

Won Jun Oh ◽

Vikas Rishi ◽

Andras Orosz ◽

Michael J. Gerdes ◽

Charles Vinson

Keyword(s):

Dna Binding ◽

Binding Protein ◽

Protein Family ◽

Mouse Epidermis ◽

Enhancer Binding Protein ◽

Ccaat Enhancer Binding Protein

Download Full-text

DNA-binding protein activated by gamma radiation in human cells

Molecular and Cellular Biology ◽

10.1128/mcb.10.10.5279-5285.1990 ◽

1990 ◽

Vol 10 (10) ◽

pp. 5279-5285

Author(s):

S P Singh ◽

M F Lavin

Keyword(s):

Dna Binding ◽

Ionizing Radiation ◽

Mammalian Cells ◽

Binding Protein ◽

Simian Virus 40 ◽

Dna Binding Protein ◽

Simian Virus ◽

Human Cells ◽

Binding Motif ◽

Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Download Full-text

The Bacterial DNA Binding Protein MatP Involved in Linking the Nucleoid Terminal Domain to the Divisome at Midcell Interacts with Lipid Membranes

mBio ◽

10.1128/mbio.00376-19 ◽

2019 ◽

Vol 10 (3) ◽

Cited By ~ 5

Author(s):

Begoña Monterroso ◽

Silvia Zorrilla ◽

Marta Sobrinos-Sanguino ◽

Miguel Ángel Robles-Ramos ◽

Carlos Alfonso ◽

...

Keyword(s):

Dna Binding ◽

Dna Sequences ◽

Lipid Membranes ◽

Binding Protein ◽

Dna Binding Protein ◽

Content Type ◽

E Coli ◽

Daughter Cells ◽

Z Ring

ABSTRACTDivision ring formation at midcell is controlled by various mechanisms inEscherichia coli, one of them being the linkage between the chromosomal Ter macrodomain and the Z-ring mediated by MatP, a DNA binding protein that organizes this macrodomain and contributes to the prevention of premature chromosome segregation. Here we show that, during cell division, just before splitting the daughter cells, MatP seems to localize close to the cytoplasmic membrane, suggesting that this protein might interact with lipids. To test this hypothesis, we investigated MatP interaction with lipidsin vitro. We found that, when encapsulated inside vesicles and microdroplets generated by microfluidics, MatP accumulates at phospholipid bilayers and monolayers matching the lipid composition in theE. coliinner membrane. MatP binding to lipids was independently confirmed using lipid-coated microbeads and biolayer interferometry assays, which suggested that the recognition is mainly hydrophobic. Interaction of MatP with the lipid membranes also occurs in the presence of the DNA sequences specifically targeted by the protein, but there is no evidence of ternary membrane/protein/DNA complexes. We propose that the association of MatP with lipids may modulate its spatiotemporal localization and its recognition of other ligands.IMPORTANCEThe division of anE. colicell into two daughter cells with equal genomic information and similar size requires duplication and segregation of the chromosome and subsequent scission of the envelope by a protein ring, the Z-ring. MatP is a DNA binding protein that contributes both to the positioning of the Z-ring at midcell and the temporal control of nucleoid segregation. Our integratedin vivoandin vitroanalysis provides evidence that MatP can interact with lipid membranes reproducing the phospholipid mixture in theE. coliinner membrane, without concomitant recruitment of the short DNA sequences specifically targeted by MatP. This observation strongly suggests that the membrane may play a role in the regulation of the function and localization of MatP, which could be relevant for the coordination of the two fundamental processes in which this protein participates, nucleoid segregation and cell division.

Download Full-text