Differentiation of Staphylococcus spp. by high-resolution melting analysis

2010 ◽  
Vol 56 (12) ◽  
pp. 1040-1049 ◽  
Author(s):  
Michal Slany ◽  
Martina Vanerkova ◽  
Eva Nemcova ◽  
Barbora Zaloudikova ◽  
Filip Ruzicka ◽  
...  
Keyword(s):  
High Resolution ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
High Resolution Melting ◽  
Bacterial Species ◽  
High Resolution Melting Analysis ◽  
Rrna Gene ◽  
Staphylococcus Capitis ◽  
Melting Analysis ◽  
The 16S Rrna Gene

High-resolution melting analysis (HRMA) is a fast (post-PCR) high-throughput method to scan for sequence variations in a target gene. The aim of this study was to test the potential of HRMA to distinguish particular bacterial species of the Staphylococcus genus even when using a broad-range PCR within the 16S rRNA gene where sequence differences are minimal. Genomic DNA samples isolated from 12 reference staphylococcal strains ( Staphylococcus aureus , Staphylococcus capitis , Staphylococcus caprae , Staphylococcus epidermidis , Staphylococcus haemolyticus , Staphylococcus hominis , Staphylococcus intermedius , Staphylococcus saprophyticus , Staphylococcus sciuri , Staphylococcus simulans , Staphylococcus warneri , and Staphylococcus xylosus ) were subjected to a real-time PCR amplification of the 16S rRNA gene in the presence of fluorescent dye EvaGreen™, followed by HRMA. Melting profiles were used as molecular fingerprints for bacterial species differentiation. HRMA of S. saprophyticus and S. xylosus resulted in undistinguishable profiles because of their identical sequences in the analyzed 16S rRNA region. The remaining reference strains were fully differentiated either directly or via high-resolution plots obtained by heteroduplex formation between coamplified PCR products of the tested staphylococcal strain and phylogenetically unrelated strain.

scholarly journals Rapid Detection and Identification of Clinically Important Bacteria by High-Resolution Melting Analysis after Broad-Range Ribosomal RNA Real-Time PCR

2006 ◽  
Vol 52 (11) ◽  
pp. 1997-2004 ◽  
Author(s):  
Ju-Chien Cheng ◽  
Chien-Ling Huang ◽  
Chung-Ching Lin ◽  
Chi-Ching Chen ◽  
Yi-Chih Chang ◽  
...  
Keyword(s):  
High Resolution ◽  
16S Rrna ◽  
Real Time ◽  
Real Time Pcr ◽  
High Resolution Melting ◽  
Bacterial Species ◽  
High Resolution Melting Analysis ◽  
Rrna Gene ◽  
Melting Analysis ◽  
The 16S Rrna Gene

Abstract Background: Broad-range PCR provides valuable information for detecting bacterial infections. This study assesses the combined use of broad-range real-time PCR and high-resolution melting analysis for rapid detection and identification of clinically important bacteria. Methods: We subjected 46 bacterial culture colonies representing 25 clinically important bacterial species to LightCycler real-time PCR amplification of the 16S rRNA gene in the presence of LCGreen I fluorescent dye. We performed high-resolution melting analysis of the PCR products with the HR-1 instrument and used melting profiles as molecular fingerprints for bacterial species identification. We validated this method via assessment of 54 consecutive bacteria culture colonies obtained from a clinical microbiology laboratory. Results: The 16S rRNA gene of all 25 bacterial species was amplifiable by this method, with PCR product lengths of 216 or 217 bp. Of the 25 bacterial species, we identified 11 via a 1-step post-PCR high-resolution melting analysis. The remaining bacterial species were identified via the high-resolution melting plots obtained by heteroduplex formation between the PCR products of the tested and reference bacterial species or by a 2nd real-time PCR targeting a different region of the 16S rRNA gene. A high-resolution melting database and a working protocol were established for identifying these 25 bacterial species. In the validation assay, a 94% accuracy rate was achieved when the bacterial species were in the high-resolution melting database. Conclusions: This assay requires no multiplexing or hybridization probes and provides a new approach for bacterial species identification in a molecular diagnostic laboratory.

scholarly journals Mucilaginibacter polysacchareus sp. nov., an exopolysaccharide-producing bacterial species isolated from the rhizoplane of the herb Angelica sinensis

2012 ◽  
Vol 62 (Pt_3) ◽  
pp. 632-637 ◽  
Author(s):  
Song-Ih Han ◽  
Hyo-Jin Lee ◽  
Hae-Ran Lee ◽  
Ki-Kwang Kim ◽  
Kyung-Sook Whang
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Dna Hybridization ◽  
Gene Sequence ◽  
Novel Species ◽  
Bacterial Species ◽  
Angelica Sinensis ◽  
Rrna Gene ◽  
The 16S Rrna Gene ◽  
Sequence Similarities

Three exopolysaccharide-producing bacteria, designated strains DRP28T, DRP29 and DRP31, were isolated from the rhizoplane of Angelica sinensis from the Geumsan, Republic of Korea. Cells were straight rods, Gram reaction-negative, aerobic, non-motile, and catalase- and oxidase- positive. Flexirubin-type pigments were absent. Phylogenetic analysis of the 16S rRNA gene indicated that these bacteria belong to the genus Mucilaginibacter in the phylum Bacteroidetes. 16S rRNA gene sequence similarities to strains of recognized species of the genus Mucilaginibacter were 93.8–97.4 %. The major fatty acids were iso-C15 : 0 and summed feature 3 (C16 : 1ω7c and/or iso-C15 : 0 2-OH). The strains contained MK-7 as the major isoprenoid quinone. Strains DRP28T, DRP29 and DRP31 formed a single, distinct genomospecies with DNA G+C contents of 41.9–42.7 mol% and DNA hybridization values of 82.6–86.8 %; the strains exhibited DNA–DNA hybridization values of only 20.4–41.3 % with related species of the genus Mucilaginibacter. On the basis of evidence presented in this study, strains DRP28T, DRP29 and DRP31 were considered to represent a novel species of the genus Mucilaginibacter, for which the name Mucilaginibacter polysacchareus sp. nov. is proposed. The type strain is DRP28T ( = KACC 15075T  = NBRC 107757T).

scholarly journals Combining 16S rRNA gene variable regions enables high-resolution microbial community profiling

2017 ◽  
Author(s):  
Garold Fuks ◽  
Michael Elgart ◽  
Amnon Amir ◽  
Amit Zeisel ◽  
Peter J. Turnbaugh ◽  
...  
Keyword(s):  
High Resolution ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Read Length ◽  
Rrna Gene ◽  
Sample Number ◽  
Variable Regions ◽  
Total Length ◽  
Fragmented Dna ◽  
The 16S Rrna Gene

AbstractBackgroundMost of our knowledge about the remarkable microbial diversity on Earth comes from sequencing the 16S rRNA gene. The use of next-generation sequencing methods has increased sample number and sequencing depth, but the read length of the most widely used sequencing platforms today is quite short, requiring the researcher to choose a subset of the gene to sequence (typically 16-33% of the total length). Thus, many bacteria may share the same amplified region and the resolution of profiling is inherently limited. Platforms that offer ultra long read lengths, whole genome shotgun sequencing approaches, and computational frameworks formerly suggested by us and by others, all allow different ways to circumvent this problem yet suffer various shortcomings. There is need for a simple and low cost 16S rRNA gene based profiling approach that harnesses the short read length to provide a much larger coverage of the gene to allow for high resolution, even in harsh conditions of low bacterial biomass and fragmented DNA.ResultsThis manuscript suggests Short MUltiple Regions Framework (SMURF), a method to combine sequencing results from different PCR-amplified regions to provide one coherent profiling. The de facto amplicon length is the total length of all amplified regions, thus providing much higher resolution compared to current techniques. Computationally, the method solves a convex optimization problem that allows extremely fast reconstruction and requires only moderate memory. We demonstrate the increase in resolution by in silico simulations and by profiling two mock mixtures and real-world biological samples. Reanalyzing a mock mixture from the Human Microbiome Project achieved about two-fold improvement in resolution when combing two independent regions. Using a custom set of six primer pairs spanning about 1200bp (80%) of the 16S rRNA gene we were able to achieve ~100 fold improvement in resolution compared to a single region, over a mock mixture of common human gut bacterial isolates. Finally, profiling of a Drosophila melanogaster microbiome using the set of six primer pairs provided a ~100 fold increase in resolution, and thus enabling efficient downstream analysis.ConclusionsSMURF enables identification of near full-length 16S rRNA gene sequences in microbial communities, having resolution superior compared to current techniques. It may be applied to standard sample preparation protocols with very little modifications. SMURF also paves the way to high-resolution profiling of low-biomass and fragmented DNA, e.g., in the case of Formalin-fixed and Paraffin-embedded samples, fossil-derived DNA or DNA exposed to other degrading conditions. The approach is not restricted to combining amplicons of the 16S rRNA gene and may be applied to any set of amplicons, e.g., in Multilocus Sequence Typing (MLST).

In Silico Study of the Effectiveness of 16S rRNA Gene as a Universal Genetic Marker to Identify Closely Related Burkholderia Spp. in Panicle Blight of Rice

2022 ◽  
Vol 16 (1) ◽  
pp. 102
Author(s):  
Nur Alifah Ilyana Mohamad Naim ◽  
Nabihah Raihanah Tajul Anuar ◽  
Lyena Watty Zuraine Ahmad ◽  
Roziah Kambol ◽  
Sharifah Aminah Syed Mohamad ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Genetic Marker ◽  
Bacterial Species ◽  
Rrna Gene ◽  
Partial Region ◽  
Substitution Saturation ◽  
Almost All ◽  
The 16S Rrna Gene ◽  
Panicle Blight

The 16S rRNA gene is a housekeeping genetic marker that is available in almost all bacterial species and it is used in bacterial phylogeny and taxonomy studies. In many studies, the 16S rRNA gene is used in identification of certain bacterial species. Being a less conserved genetic marker, certain studies found it is a useful tool to infer the genome-wide similarity levels among the closely related prokaryotic organisms. Thus, this study aimed to compare the variation in the 16S rRNA partial region of Burkholderia spp. that infect the panicle of rice from eight different geographical areas. 58 sequences with total of 688 base pairs (bp) of 16S rRNA gene in B. glumae and B. gladioli were retrieved from public database based on several countries namely United State, Panama, Ecuador, Thailand, China, India, Korea and Malaysia. Then, the data sequences were analysed and validated using MEGAX and ABGD software respectively. The result of phylogenetic tree confirmed that B. glumae and B. gladioli were species that present in the panicle blight of rice. However, Data Analysis in Molecular Biology and Evolution (DAMBE) and Automatic Barcode Gap Discovery (ABGD) software were not able to detect substitution saturation and divergence between B. glumae and B. gladioli respectively based on the 58 sequences of the 16S rRNA partial region. Hence, it proves that 16S rRNA gene is an ineffective genetic marker to be used to differentiate the closely related species of bacteria from similar genus.

scholarly journals FILOGENI MOLEKULER ISOLAT BAKTERI F0-0-3-1 DARI MEDIA PEMELIHARAAN ROTIFER

2020 ◽  
Vol 8 (2) ◽  
pp. 73
Author(s):  
Oktavianus Dalenoh ◽  
Stenly Wullur ◽  
Elvy L Ginting ◽  
Veibe Warouw ◽  
Detty N Rumampuk ◽  
...  
Keyword(s):  
16S Rrna ◽  
Molecular Phylogeny ◽  
16S Rrna Gene ◽  
Bacillus Cereus ◽  
Molecular Analysis ◽  
Bacterial Species ◽  
Rrna Gene ◽  
Neighbor Joining ◽  
Sequence Quality ◽  
The 16S Rrna Gene

The aim of this study was to construct molecular phylogeny of bacteria suspected to involve in decomposing the fishery waste as diet for rotifer culture. The bacteria were isolated from culture of rotifer and propagated for molecular analysis. Genomic DNA of the bacteria was extracted using DNeasy Blood and Tissue Kit (Qiagen). The 16S rRNA gene was amplified using primer pairs i.e. 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCCT GTTACGACTT) and sequenced. The sequences were analyzed using Sequence Scanner and MEGA 7, and BLASTed on the NCBI website (www.ncbi.nml.nih.gov). Molecular phylogeny of the isolate was constructed using Neighbor Joining Tree method. Isolate bacteria F0-0-3-1 from culture of rotifer fed with fish waste diet was successfully propagated for molecular analysis. 16S rRNA gene of the isolate bacteria was successfully amplified and showed a DNA band at 1400 bp. Nucleotides sequence quality of the 16S rRNA gene i.,e QV+20 and CRL were 995 and 941 nucletides. BLAST result of the 16S rRNA gene showed 98.87% percent identity of the isolate bacteria F0- 0-3-1 with bacterial species in the genus Bacillus i.e. Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Molecular phylogeny analysis showed that the three species was in the same clade.Keywords: Phylogeny, molecular, bacteria, rotifer, 16S rRNA gene Penelitian ini bertujuan untuk mengkonstruksi filogeni molekuler bakteri yang diduga terlibat dalam proses penguraian limbah perikanan sebagai pakan untuk kultur rotifer. Isolat bakteri yang diperoleh dari kultur rotifer tersebut, dibiakkan dan DNA genomnya diekstrak menggunakan DNeasy Blood and Tissue Kit (Qiagen). Gen 16S rRNA isolat bakteri tersebut, diamplifikasi menggunakan primer 8F (AGAGTTTGATCCTGGCTCAG) dan 1492R (GGTTACCCT GTTACGACTT) selanjutnya, disekuens dan urutan nukleotida hasil sekuens dianalisis menggunakan program Sequence Scanner dan MEGA 7. Analisis homologi sekuens dilakukan dengan program BLAST nucleotide blast, pada situs NCBI (www.ncbi.nml.nih.gov) dan dilanjutkan dengan konstruksi filogeni molekuler menggunakan metode Neigbor Joining Tree. Isolat bakteri F0-0-3-1 berhasil disolasi dari kultur rotifer yang diberi pakan limbah ikan. Hasil amplifikasi Gen 16S rRNA isolat bakteri F0-0-3-1 terdeteksi dalam bentuk pita DNA pada posisi sekitar 1400 bp. Kualitas nukleotida gen 16S rRNA hasil sekuens menunjukan nilai QV 995 dan CRL 941. Hasil BLAST sekuens gen 16S rRNA isolat bakteri F0-0-3-1 pada database menunjukkan kemiripan 98% dengan spesies Bacillus wiedmanni. Hasil kontruksi filogeni menggunakan metode Neighbor Joining Tree menunjukan posisi isolat bakteri F0-0-3-1 berada pada clade yang sama dengan Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Kata kunci: Filogeni, molekuler, bakteri, rotifer, Gen 16S rRNA

Characterization ofChlamydiaceaespecies using PCR and high resolution melt curve analysis of the 16S rRNA gene

2009 ◽  
Vol 107 (6) ◽  
pp. 2017-2028 ◽  
Author(s):  
T. Robertson ◽  
S. Bibby ◽  
D. O’Rourke ◽  
T. Belfiore ◽  
H. Lambie ◽  
...  
Keyword(s):  
High Resolution ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Curve Analysis ◽  
Rrna Gene ◽  
High Resolution Melt ◽  
Melt Curve Analysis ◽  
The 16S Rrna Gene

scholarly journals FILOGENI MOLEKULER BAKTERI DARI MEDIA PEMELIHARAAN ROTIFER YANG DIBERI OLAHAN LIMBAH IKAN SEBAGAI SUMBER NUTRISI

2021 ◽  
Vol 9 (1) ◽  
pp. 38
Author(s):  
Herlin S Hubu ◽  
Stenly Wullur ◽  
Veibe Warouw ◽  
Elvy L Ginting ◽  
Robert A Bara ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacterial Species ◽  
16S Rrna Genes ◽  
Rrna Genes ◽  
Local Alignment ◽  
Rrna Gene ◽  
Fish Waste ◽  
Positive Effects ◽  
The 16S Rrna Gene

This study aims to identify and construct molecular phylogeny of an isolate bacteria from culture media of rotifer Brachionus rotudiforis supplied with processed fishery waste feed as nutritional source. The use of fish waste-based food for rotifer showed positive effects on growth and nutrient content of the rotifers. Genomic DNA of the isolate bacteria BRLI- 01 was extracted and the 16S rRNA gene was amplified using primers (8F and 1492F) and further sequenced using Sanger sequence technique. The 16S rRNA gene was analysed using SeqScanner® and MEGA® followed with BLAST (Basic Local Alignment Search Tool) analyses in the NCBI (National Centre for Biotechnology Information). Amplification result of 16S rRNA gene bacteria s NCBI site as a reference for identification and phylogeny of bacterial species. BRLI-01 was successfully cultured on rotifer rearing media. The results of the 16S rRNA gene amplification of the isolate bacteria showed a DNA band with a length of 1400 bp. The BLAST result on the NCBI showed that the isolate bacteria BRLI-01 had a percent identity (98.46%) and is in the same phylogony branching position with Vibrio rotiferianus Keywords: Rotifers, Bacteria, Fish waste, 16S rRNA Genes, Phylogeny identification

scholarly journals Comprehensive Analysis of Bacterial Flora in Postoperative Maxillary Cyst Fluid by 16S rRNA Gene and Culture Methods

2012 ◽  
Vol 2012 ◽  
pp. 1-11 ◽  
Author(s):  
Naoto Sano ◽  
Yoshio Yamashita ◽  
Kazumasa Fukuda ◽  
Hatsumi Taniguchi ◽  
Masaaki Goto ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacterial Species ◽  
Bacterial Flora ◽  
Gene Analysis ◽  
Rrna Gene ◽  
Culture Methods ◽  
16S Rrna Gene Analysis ◽  
Staphylococcus Capitis ◽  
Maxillary Cyst

Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC.

Sign in / Sign up

Export Citation Format

Share Document