In Silico Study of the Effectiveness of 16S rRNA Gene as a Universal Genetic Marker to Identify Closely Related Burkholderia Spp. in Panicle Blight of Rice

The 16S rRNA gene is a housekeeping genetic marker that is available in almost all bacterial species and it is used in bacterial phylogeny and taxonomy studies. In many studies, the 16S rRNA gene is used in identification of certain bacterial species. Being a less conserved genetic marker, certain studies found it is a useful tool to infer the genome-wide similarity levels among the closely related prokaryotic organisms. Thus, this study aimed to compare the variation in the 16S rRNA partial region of Burkholderia spp. that infect the panicle of rice from eight different geographical areas. 58 sequences with total of 688 base pairs (bp) of 16S rRNA gene in B. glumae and B. gladioli were retrieved from public database based on several countries namely United State, Panama, Ecuador, Thailand, China, India, Korea and Malaysia. Then, the data sequences were analysed and validated using MEGAX and ABGD software respectively. The result of phylogenetic tree confirmed that B. glumae and B. gladioli were species that present in the panicle blight of rice. However, Data Analysis in Molecular Biology and Evolution (DAMBE) and Automatic Barcode Gap Discovery (ABGD) software were not able to detect substitution saturation and divergence between B. glumae and B. gladioli respectively based on the 58 sequences of the 16S rRNA partial region. Hence, it proves that 16S rRNA gene is an ineffective genetic marker to be used to differentiate the closely related species of bacteria from similar genus.

Download Full-text

Differentiation of Staphylococcus spp. by high-resolution melting analysis

Canadian Journal of Microbiology ◽

10.1139/w10-091 ◽

2010 ◽

Vol 56 (12) ◽

pp. 1040-1049 ◽

Cited By ~ 10

Author(s):

Michal Slany ◽

Martina Vanerkova ◽

Eva Nemcova ◽

Barbora Zaloudikova ◽

Filip Ruzicka ◽

...

Keyword(s):

High Resolution ◽

16S Rrna ◽

16S Rrna Gene ◽

High Resolution Melting ◽

Bacterial Species ◽

High Resolution Melting Analysis ◽

Rrna Gene ◽

Staphylococcus Capitis ◽

Melting Analysis ◽

The 16S Rrna Gene

High-resolution melting analysis (HRMA) is a fast (post-PCR) high-throughput method to scan for sequence variations in a target gene. The aim of this study was to test the potential of HRMA to distinguish particular bacterial species of the Staphylococcus genus even when using a broad-range PCR within the 16S rRNA gene where sequence differences are minimal. Genomic DNA samples isolated from 12 reference staphylococcal strains ( Staphylococcus aureus , Staphylococcus capitis , Staphylococcus caprae , Staphylococcus epidermidis , Staphylococcus haemolyticus , Staphylococcus hominis , Staphylococcus intermedius , Staphylococcus saprophyticus , Staphylococcus sciuri , Staphylococcus simulans , Staphylococcus warneri , and Staphylococcus xylosus ) were subjected to a real-time PCR amplification of the 16S rRNA gene in the presence of fluorescent dye EvaGreen™, followed by HRMA. Melting profiles were used as molecular fingerprints for bacterial species differentiation. HRMA of S. saprophyticus and S. xylosus resulted in undistinguishable profiles because of their identical sequences in the analyzed 16S rRNA region. The remaining reference strains were fully differentiated either directly or via high-resolution plots obtained by heteroduplex formation between coamplified PCR products of the tested staphylococcal strain and phylogenetically unrelated strain.

Download Full-text

Mucilaginibacter polysacchareus sp. nov., an exopolysaccharide-producing bacterial species isolated from the rhizoplane of the herb Angelica sinensis

INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY ◽

10.1099/ijs.0.029793-0 ◽

2012 ◽

Vol 62 (Pt_3) ◽

pp. 632-637 ◽

Cited By ~ 29

Author(s):

Song-Ih Han ◽

Hyo-Jin Lee ◽

Hae-Ran Lee ◽

Ki-Kwang Kim ◽

Kyung-Sook Whang

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Dna Hybridization ◽

Gene Sequence ◽

Novel Species ◽

Bacterial Species ◽

Angelica Sinensis ◽

Rrna Gene ◽

The 16S Rrna Gene ◽

Sequence Similarities

Three exopolysaccharide-producing bacteria, designated strains DRP28T, DRP29 and DRP31, were isolated from the rhizoplane of Angelica sinensis from the Geumsan, Republic of Korea. Cells were straight rods, Gram reaction-negative, aerobic, non-motile, and catalase- and oxidase- positive. Flexirubin-type pigments were absent. Phylogenetic analysis of the 16S rRNA gene indicated that these bacteria belong to the genus Mucilaginibacter in the phylum Bacteroidetes. 16S rRNA gene sequence similarities to strains of recognized species of the genus Mucilaginibacter were 93.8–97.4 %. The major fatty acids were iso-C15 : 0 and summed feature 3 (C16 : 1ω7c and/or iso-C15 : 0 2-OH). The strains contained MK-7 as the major isoprenoid quinone. Strains DRP28T, DRP29 and DRP31 formed a single, distinct genomospecies with DNA G+C contents of 41.9–42.7 mol% and DNA hybridization values of 82.6–86.8 %; the strains exhibited DNA–DNA hybridization values of only 20.4–41.3 % with related species of the genus Mucilaginibacter. On the basis of evidence presented in this study, strains DRP28T, DRP29 and DRP31 were considered to represent a novel species of the genus Mucilaginibacter, for which the name Mucilaginibacter polysacchareus sp. nov. is proposed. The type strain is DRP28T ( = KACC 15075T = NBRC 107757T).

Download Full-text

Intragenomic and intraspecific heterogeneity of the 16S rRNA gene in seven bacterial species from the respiratory tract of cystic fibrosis patients assessed by PCR-Temporal Temperature Gel Electrophoresis

Pathologie Biologie ◽

10.1016/j.patbio.2011.03.014 ◽

2012 ◽

Vol 60 (3) ◽

pp. e30-e35 ◽

Cited By ~ 6

Author(s):

A.-L. Michon ◽

E. Jumas-Bilak ◽

A. Imbert ◽

L. Aleyrangues ◽

F. Counil ◽

...

Keyword(s):

Cystic Fibrosis ◽

16S Rrna ◽

Respiratory Tract ◽

16S Rrna Gene ◽

Gel Electrophoresis ◽

Bacterial Species ◽

Rrna Gene ◽

The 16S Rrna Gene

Download Full-text

Microbiota profiling with long amplicons using Nanopore sequencing: full-length 16S rRNA gene and the 16S-ITS-23S of the rrn operon

F1000Research ◽

10.12688/f1000research.16817.2 ◽

2019 ◽

Vol 7 ◽

pp. 1755 ◽

Cited By ~ 10

Author(s):

Anna Cuscó ◽

Carlotta Catozzi ◽

Joaquim Viñes ◽

Armand Sanchez ◽

Olga Francino

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Genetic Marker ◽

Species Level ◽

Full Length ◽

Rrna Gene ◽

Nanopore Sequencing ◽

Microbiota Composition ◽

The 16S Rrna Gene ◽

Mock Communities

Background: Profiling the microbiome of low-biomass samples is challenging for metagenomics since these samples are prone to contain DNA from other sources (e.g. host or environment). The usual approach is sequencing short regions of the 16S rRNA gene, which fails to assign taxonomy to genus and species level. To achieve an increased taxonomic resolution, we aim to develop long-amplicon PCR-based approaches using Nanopore sequencing. We assessed two different genetic markers: the full-length 16S rRNA (~1,500 bp) and the 16S-ITS-23S region from the rrn operon (4,300 bp). Methods: We sequenced a clinical isolate of Staphylococcus pseudintermedius, two mock communities and two pools of low-biomass samples (dog skin). Nanopore sequencing was performed on MinION™ using the 1D PCR barcoding kit. Sequences were pre-processed, and data were analyzed using EPI2ME or Minimap2 with rrn database. Consensus sequences of the 16S-ITS-23S genetic marker were obtained using canu. Results: The full-length 16S rRNA and the 16S-ITS-23S region of the rrn operon were used to retrieve the microbiota composition of the samples at the genus and species level. For the Staphylococcus pseudintermedius isolate, the amplicons were assigned to the correct bacterial species in ~98% of the cases with the16S-ITS-23S genetic marker, and in ~68%, with the 16S rRNA gene when using EPI2ME. Using mock communities, we found that the full-length 16S rRNA gene represented better the abundances of a microbial community; whereas, 16S-ITS-23S obtained better resolution at the species level. Finally, we characterized low-biomass skin microbiota samples and detected species with an environmental origin. Conclusions: Both full-length 16S rRNA and the 16S-ITS-23S of the rrn operon retrieved the microbiota composition of simple and complex microbial communities, even from the low-biomass samples such as dog skin. For an increased resolution at the species level, targeting the 16S-ITS-23S of the rrn operon would be the best choice.

Download Full-text

FILOGENI MOLEKULER ISOLAT BAKTERI F0-0-3-1 DARI MEDIA PEMELIHARAAN ROTIFER

JURNAL PESISIR DAN LAUT TROPIS ◽

10.35800/jplt.8.2.2020.29909 ◽

2020 ◽

Vol 8 (2) ◽

pp. 73

Author(s):

Oktavianus Dalenoh ◽

Stenly Wullur ◽

Elvy L Ginting ◽

Veibe Warouw ◽

Detty N Rumampuk ◽

...

Keyword(s):

16S Rrna ◽

Molecular Phylogeny ◽

16S Rrna Gene ◽

Bacillus Cereus ◽

Molecular Analysis ◽

Bacterial Species ◽

Rrna Gene ◽

Neighbor Joining ◽

Sequence Quality ◽

The 16S Rrna Gene

The aim of this study was to construct molecular phylogeny of bacteria suspected to involve in decomposing the fishery waste as diet for rotifer culture. The bacteria were isolated from culture of rotifer and propagated for molecular analysis. Genomic DNA of the bacteria was extracted using DNeasy Blood and Tissue Kit (Qiagen). The 16S rRNA gene was amplified using primer pairs i.e. 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCCT GTTACGACTT) and sequenced. The sequences were analyzed using Sequence Scanner and MEGA 7, and BLASTed on the NCBI website (www.ncbi.nml.nih.gov). Molecular phylogeny of the isolate was constructed using Neighbor Joining Tree method. Isolate bacteria F0-0-3-1 from culture of rotifer fed with fish waste diet was successfully propagated for molecular analysis. 16S rRNA gene of the isolate bacteria was successfully amplified and showed a DNA band at 1400 bp. Nucleotides sequence quality of the 16S rRNA gene i.,e QV+20 and CRL were 995 and 941 nucletides. BLAST result of the 16S rRNA gene showed 98.87% percent identity of the isolate bacteria F0- 0-3-1 with bacterial species in the genus Bacillus i.e. Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Molecular phylogeny analysis showed that the three species was in the same clade.Keywords: Phylogeny, molecular, bacteria, rotifer, 16S rRNA gene Penelitian ini bertujuan untuk mengkonstruksi filogeni molekuler bakteri yang diduga terlibat dalam proses penguraian limbah perikanan sebagai pakan untuk kultur rotifer. Isolat bakteri yang diperoleh dari kultur rotifer tersebut, dibiakkan dan DNA genomnya diekstrak menggunakan DNeasy Blood and Tissue Kit (Qiagen). Gen 16S rRNA isolat bakteri tersebut, diamplifikasi menggunakan primer 8F (AGAGTTTGATCCTGGCTCAG) dan 1492R (GGTTACCCT GTTACGACTT) selanjutnya, disekuens dan urutan nukleotida hasil sekuens dianalisis menggunakan program Sequence Scanner dan MEGA 7. Analisis homologi sekuens dilakukan dengan program BLAST nucleotide blast, pada situs NCBI (www.ncbi.nml.nih.gov) dan dilanjutkan dengan konstruksi filogeni molekuler menggunakan metode Neigbor Joining Tree. Isolat bakteri F0-0-3-1 berhasil disolasi dari kultur rotifer yang diberi pakan limbah ikan. Hasil amplifikasi Gen 16S rRNA isolat bakteri F0-0-3-1 terdeteksi dalam bentuk pita DNA pada posisi sekitar 1400 bp. Kualitas nukleotida gen 16S rRNA hasil sekuens menunjukan nilai QV 995 dan CRL 941. Hasil BLAST sekuens gen 16S rRNA isolat bakteri F0-0-3-1 pada database menunjukkan kemiripan 98% dengan spesies Bacillus wiedmanni. Hasil kontruksi filogeni menggunakan metode Neighbor Joining Tree menunjukan posisi isolat bakteri F0-0-3-1 berada pada clade yang sama dengan Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Kata kunci: Filogeni, molekuler, bakteri, rotifer, Gen 16S rRNA

Download Full-text

FILOGENI MOLEKULER BAKTERI DARI MEDIA PEMELIHARAAN ROTIFER YANG DIBERI OLAHAN LIMBAH IKAN SEBAGAI SUMBER NUTRISI

JURNAL PESISIR DAN LAUT TROPIS ◽

10.35800/jplt.9.1.2021.33574 ◽

2021 ◽

Vol 9 (1) ◽

pp. 38

Author(s):

Herlin S Hubu ◽

Stenly Wullur ◽

Veibe Warouw ◽

Elvy L Ginting ◽

Robert A Bara ◽

...

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Bacterial Species ◽

16S Rrna Genes ◽

Rrna Genes ◽

Local Alignment ◽

Rrna Gene ◽

Fish Waste ◽

Positive Effects ◽

The 16S Rrna Gene

This study aims to identify and construct molecular phylogeny of an isolate bacteria from culture media of rotifer Brachionus rotudiforis supplied with processed fishery waste feed as nutritional source. The use of fish waste-based food for rotifer showed positive effects on growth and nutrient content of the rotifers. Genomic DNA of the isolate bacteria BRLI- 01 was extracted and the 16S rRNA gene was amplified using primers (8F and 1492F) and further sequenced using Sanger sequence technique. The 16S rRNA gene was analysed using SeqScanner® and MEGA® followed with BLAST (Basic Local Alignment Search Tool) analyses in the NCBI (National Centre for Biotechnology Information). Amplification result of 16S rRNA gene bacteria s NCBI site as a reference for identification and phylogeny of bacterial species. BRLI-01 was successfully cultured on rotifer rearing media. The results of the 16S rRNA gene amplification of the isolate bacteria showed a DNA band with a length of 1400 bp. The BLAST result on the NCBI showed that the isolate bacteria BRLI-01 had a percent identity (98.46%) and is in the same phylogony branching position with Vibrio rotiferianus Keywords: Rotifers, Bacteria, Fish waste, 16S rRNA Genes, Phylogeny identification

Download Full-text

Phyllobacterium loti sp. nov. isolated from nodules of Lotus corniculatus

INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY ◽

10.1099/ijs.0.052993-0 ◽

2014 ◽

Vol 64 (Pt_3) ◽

pp. 781-786 ◽

Cited By ~ 33

Author(s):

Maximo Sánchez ◽

Martha-Helena Ramírez-Bahena ◽

Alvaro Peix ◽

María J. Lorite ◽

Juan Sanjuán ◽

...

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Sequence Similarity ◽

Carbon Sources ◽

Lotus Corniculatus ◽

Culture Conditions ◽

Rrna Gene ◽

Content Type ◽

Link Type ◽

The 16S Rrna Gene

Strain S658T was isolated from a Lotus corniculatus nodule in a soil sample obtained in Uruguay. Phylogenetic analysis of the 16S rRNA gene and atpD gene showed that this strain clustered within the genus Phyllobacterium . The closest related species was, in both cases, Phyllobacterium trifolii PETP02T with 99.8 % sequence similarity in the 16S rRNA gene and 96.1 % in the atpD gene. The 16S rRNA gene contains an insert at the beginning of the sequence that has no similarities with other inserts present in the same gene in described rhizobial species. Ubiquinone Q-10 was the only quinone detected. Strain S658T differed from its closest relatives through its growth in diverse culture conditions and in the assimilation of several carbon sources. It was not able to reproduce nodules in Lotus corniculatus. The results of DNA–DNA hybridization, phenotypic tests and fatty acid analyses confirmed that this strain should be classified as a representative of a novel species of the genus Phyllobacterium , for which the name Phyllobacterium loti sp. nov. is proposed. The type strain is S658T( = LMG 27289T = CECT 8230T).

Download Full-text