Inhibition of Fatty Acid Synthase Suppresses c-Met Receptor Kinase and Induces Apoptosis in Diffuse Large B Cell Lymphoma.

Abstract Abstract 4787 Targeted approaches are expected to revolutionize cancer treatment in near future. Fatty acid synthase (FASN), the enzyme responsible for de novo synthesis of fatty acids has emerged as a potential therapeutic target for several cancers however its role in diffuse large B-cell lymphoma (DLBCL) has not been fully elucidated.. Therefore, we investigated the expression of FASN in tissue micro array cohort of 301 DLBCL patients. FASN was found to be expressed in 62.6% (162/259) DLBCL samples and was seen in highly proliferative tumors manifested by high Ki67 (p<0.0001). Significant association was found between tumors expressing high FASN and c-Met tyrosine kinase (p<0.0002) as well as p-AKT (p=0.0309). In vitro, pharmacological FASN inhibition and SiRNA targeted against FASN triggered caspase dependent apoptosis and suppressed expression of c-Met kinase in DLBCL cell lines which further highlighted the molecular link between FASN and c-Met kinase. Finally, simultaneous targeting of FASN and c-Met with specific chemical inhibitors induced a synergistically stimulated apoptotic response in DLBCL cell lines. These findings provide evidence of an active role of FASN in DLBCL evolution by specifically regulating tyrosine kinases related to malignant transformation strongly suggest that targeting FASN may have therapeutic value in treatment of DLBCL. Disclosures: No relevant conflicts of interest to declare.

Download Full-text

NIK Is Involved In the Activation of the Classical and Alternative NF-κB Pathways In Diffuse Large B Cell Lymphoma

Blood ◽

10.1182/blood.v116.21.3099.3099 ◽

2010 ◽

Vol 116 (21) ◽

pp. 3099-3099

Author(s):

Lina Odqvist ◽

Margarita Sánchez-Beato ◽

Santiago Montes-Moreno ◽

Ken H Young ◽

Francesco Acquadro ◽

...

Keyword(s):

B Cell ◽

Cell Lines ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

Alternative Pathway ◽

B Cell Lymphoma ◽

Classical Pathway ◽

Strong Positive Correlation ◽

Large B Cell Lymphoma ◽

Large B Cell

Abstract Abstract 3099 Deregulated NF-κB activity plays a role in the lymphoma pathogenesis, and has been proposed to constitute a cardinal feature of some subtypes of diffuse large B cell lymphoma (DLBCL). The NF-κB-Inducing Kinase (NIK) is essential for the activation of the alternative NF-κB pathway by inducing the phosphorylation of the NF-κB member p100, which leads to its processing to p52 and its subsequent nuclear translocation. A role for NIK in the classical NF-κB pathway as well has been shown, suggesting NIK as an attractive therapeutic target in lymphomas. Here, we study the frequency and extent of alternative and classical NF-κB activation in diffuse large B cell lymphoma, and the implication of NIK in both pathways. The activation of the classical and alternative NF-κB pathways was present in 28 and 34% of DLBCL cases respectively, as assessed by nuclear expression of p50 (classical pathway) and p52 (alternative pathway) by immunohistochemistry in a series of 301 samples. Activation of both NF-κB pathways was observed in germinal centre B-cell like (GC) and activated B-cell like (ABC) subtypes, with a slight predominance, although not significant, in ABC subtype. In contrast, the levels of p52 and p50 were significantly higher in ABC-DLBCL cell lines than those of GC subtype. The activation of both pathways was mostly overlapped and there was a strong positive correlation between nuclear p52 and p50 (p<0.001). Eighteen % of the cases expressed both p50 and p52 while only 8 and 16% expressed exclusively p50 or p52, respectively. Activation of the alternative NF-κB pathway was strongly associated with Epstein-Barr virus (EBV), since 93% of EBV+ cases expressed nuclear p52 (p<0.001). In our study, no TRAF3 deletions were detected in a panel of 25 DLBCL samples, although absence of TRAF3 was observed in one DLBCL cell line. Since NIK acts as a bottleneck in the activation of the alternative pathway but has also been described to play a role in the classical pathway, we wanted to analyze the effect of the knockdown of NIK on both pathways. Using small interference RNA in two lymphoma cell lines, we observed that the silencing of NIK had an effect on both pathways, decreasing the processing of p100 as well as p105. Taken together, our results show that the activation of NF-κB distinguishes a subset of DLBCL cases, comprising both ABC and GC subtypes, suggest a frequent overlap between the classical and alternative NF-κB pathway in DLBCL, and identify a possible role for NIK in the activation of both pathways. Disclosures: No relevant conflicts of interest to declare.

Download Full-text

Fatty Acid Synthase and Diffuse Large B Cell Lymphoma

Blood ◽

10.1182/blood.v112.11.4979.4979 ◽

2008 ◽

Vol 112 (11) ◽

pp. 4979-4979

Author(s):

Shahab Uddin ◽

Azhar Hussain ◽

Prashant Bavi ◽

Khawla Al-Kuraya

Keyword(s):

Fatty Acid ◽

Cell Lines ◽

Fatty Acid Synthase ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Large B Cell Lymphoma ◽

Arabian Population ◽

Large B Cell

Abstract Diffuse Large B-cell Lymphoma (DLBCL) is considered to be the most common type of lymphoma in adults, accounting for 30–40 percent of cases of non-Hodgkin’s lymphoma. The incidence of DLBCL is about 40–60% in Saudi Arabian population. The reason of high rate for DLBCL in Saudi Arabian population is not known, however recent studies suggests that differences in molecular signature as compared to western population accounts for this incidence. Although patients with DLBCL are potentially curable with combination chemotherapy, the disease proves fatal in approximately 50% of patients. The cause of most DLBCLs remains unknown; however several studies suggest that dysregulated survival/apoptosis or defective repair pathways have been implicated. Many human cancers, particularly those with a poor prognosis express high levels of fatty acid synthase (FASN), a key metabolic enzyme linked to the synthesis of membrane phospholipids in cancer cells. Over-expression of FASN can be largely attributed to activation of phosphatidylinositol-3′-kinase (PI3K)/AKT pathway. However, the role of FASN in the pathogenesis of DLBCL has not been elucidated. Therefore, in this study, we investigated the role of FASN in a large series (301) of DLBCL patient samples and a panel of DLBCL cell lines. Using immunohistochemistry, FASN was detected in appreciable number of DLBCL tumors and was strongly associated with the expression of p-AKT protein. We next examined the effect of C-75, a synthetic slow binding inhibitor of FASN activity on DLBCL cell lines (SUDHL4, SUDHL5, SUDHL8 and OCI-LY19) in vitro and found that C-75 treatment inhibits growth and induces apoptosis in all 4 DLBCL cell linesused in the study. We show based on in vitro studies employing a variety of experimental tools using different FASN inhibitors, FASN siRNA and AKT siRNA that FASN exert its oncogenic action in DLBCL cells via activated AKT. Our data show that inhibition of FASN leads to de-phosphorylation of p-AKT and it’s down stream effectors, FOXO1 and GSK-3. This, in turn leads to activation of the intrinsic apoptotic pathway by, initially causing conformational changes of the Bax protein leading to changes in the mitochondrial membrane potential and release of cytochrome c into cytosole. This causes activation of caspases-9 and -3 and cleavage of PARP. zVAD-fmk, a universal inhibitor of caspases prevents caspase-9 and -3 activation and abrogates apoptosis induced by C-75 treatment. Finally, C-75 treament of DLBCL cell lines causes down-regulation of the inhibitor of apoptosis proteins, XIAP, cIAP1 and Survivin. In summary, data presented here demonstrate a significant correlation between the expression of FASN and active AKT in DLBCL and indicate that inhibition of PI3K/AKT signaling synergize the FAS inhibitors to induce apoptosis in DLBCL cell lines with constitutively active AKT. This may have significant clinical implications. Therefore, FASN has become a promising target for anti cancer drug development.

Download Full-text

Imbalance in Alternative Splicing of MCL-1 Inhibits Apoptosis in Diffuse Large B-Cell Lymphoma

Blood ◽

10.1182/blood.v124.21.5424.5424 ◽

2014 ◽

Vol 124 (21) ◽

pp. 5424-5424

Author(s):

Nicolle H Rekers ◽

Laura M Moesbergen ◽

Nathalie J Hijmering ◽

Wim Vos ◽

Joost Oudejans ◽

...

Keyword(s):

Alternative Splicing ◽

B Cell ◽

Cell Lines ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Apoptosis Resistance ◽

Expression Levels ◽

Large B Cell Lymphoma ◽

Large B Cell

Abstract Diffuse large B-cell lymphoma (DLBCL) remains eventually fatal in 30-40% of the patients, despite intensive chemotherapy (CHOP) in combination with rituximab. A subgroup of chemotherapy-refractory DLBCL is characterized by high expression levels of both pro- and anti-apoptotic genes, including MCL-1. Alternative splicing of the MCL-1 gene results in a Bcl-2-like anti-apoptotic MCL-1L protein and a BH3-only pro-apoptotic MCL-1S protein. In the present study, we investigated if a switch in alternative splicing of MCL-1 is involved in apoptosis-resistance in primary lymphoma cells of 20 DLBCL patients and 5 DLBCL cell lines. RT-MLPA analysis revealed that MCL-1L and MCL-1S are both expressed in all tested DLBCL samples and DLBCL cell lines, however expression levels varied strongly. An imbalance between the expression levels of MCL-1L and MCL-1S to an anti-apoptotic status was observed in DLBCL patient cells and DLBCL cell lines, especially in activated B-cell like (ABC)-DLBCL, compared to tonsillar germinal center B-cells. MCL-1 mRNA expression was confirmed at protein level using immunohistochemistry and western blot analysis. Co-immunoprecipitation demonstrated that MCL-1L inhibited apoptosis by binding of Bak in MCL-1L positive DLBCL cell lines. Knockdown of MCL-1L with siRNA analysis resulted in induction of apoptosis in both GCB- and ABC-DLBCL cell lines and also in increased sensitivity to the conventional chemotherapeutical drugs etoposide. Downregulation of MCL-1L using flavopiridol induced apoptotic cell death of MCL-1L-positive DLBCL cells with low Bcl-2 expression. In summary, a switch in alternative splicing of MCL-1 occurs in a subgroup of DLBCL leading to an increase in the level of anti-apoptotic MCL-1L that contributes to therapy-resistance. These preclinical data suggest that targeting of MCL-1L might be a therapeutic option for MCL-1L positive DLBCL. Disclosures No relevant conflicts of interest to declare.

Download Full-text

Inhibition of Fatty Acid Synthase Suppresses c-Met Receptor Kinase and Induces Apoptosis in Diffuse Large B-Cell Lymphoma

Molecular Cancer Therapeutics ◽

10.1158/1535-7163.mct-09-1061 ◽

2010 ◽

Vol 9 (5) ◽

pp. 1244-1255 ◽

Cited By ~ 24

Author(s):

Shahab Uddin ◽

Azhar R. Hussain ◽

Maqbool Ahmed ◽

Rong Bu ◽

Saeeda O. Ahmed ◽

...

Keyword(s):

Fatty Acid ◽

B Cell ◽

Fatty Acid Synthase ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Receptor Kinase ◽

Met Receptor ◽

Large B Cell Lymphoma ◽

Large B Cell

Download Full-text

HIF-1a Regulating the Chemoresistance By Upregulating the Expression of xCT and GCLM in the Diffuse Large B Cell Lymphoma

Blood ◽

10.1182/blood-2019-127612 ◽

2019 ◽

Vol 134 (Supplement_1) ◽

pp. 5236-5236

Author(s):

Yongqiang Wei ◽

Hong Zeng ◽

Xiaolei Wei ◽

Weimin Huang ◽

Jialin Song ◽

...

Keyword(s):

Drug Resistance ◽

B Cell ◽

Cell Lines ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Response To Treatment ◽

Chop Regimen ◽

Large B Cell Lymphoma ◽

Large B Cell

Background Diffuse large B-cell lymphoma (DLBCL) is the most common subtype of non-hodgkin lymphoma with great heterogeneity in clinical behavior and response to treatment. Although the addition of rituximab to CHOP regimen has significantly improved the survival of DLBCL, 1/3 will be eventually relapse and progression. HIF1a has been reported to be related with the drug resistance in DLBCL, but the mechanism remains unknown. Methods Two DLBCL cell lines (Riva and SuDHL2) were treated with doxorubicin and HIF-1a inhibitors digoxin, YC-1. The proliferation of these cell lines (Riva and SuDHL2) were measured by MTT and apoptosis were detected by FCM after staining with Annexin V/SYTOX Green. Expression of IF-1α, PHD, xCT, GCLM and apoptosis-related proteins was detected by Western Blot. Results With the increase concentration of doxorubicin treatment, the proliferation of Riva and SuDHL2 cell lines could be gradually inhibited. xCT and GCLM expression were upregulated after treated with doxorubicin and can be reversed by N-acetylcysteine. HIF-1a inhibitors digoxin and YC-1 could inhibited the expression of xCT and GCLM, proliferation and apoptosis induced by doxorubicin. Furthermore, we treated shHIF-1a RNA to significantly reduce the expression of HIF-1a, and the decrease of HIF-1a expression enhanced the proliferation inhibition and apoptosis of lymphoma cells by Dox. Downregulation the expression of HIF-1a by shRNA enhanced the doxorubicin induced apoptosis and inhibited the proliferation in DLBCL cell lines. Conclusions Taken together, our results showed that HIF-1a could regulate the expression of xCT and GCLM and further mediate drug resistance in the diffuse large B cell lymphoma. Disclosures No relevant conflicts of interest to declare.

Download Full-text

Curcumin Enhances the Sensitivity of Bortezomib By Inhibiting NF-Κb in ABC Diffuse Large B-Cell Lymphoma Cells

Blood ◽

10.1182/blood-2019-127705 ◽

2019 ◽

Vol 134 (Supplement_1) ◽

pp. 5237-5237

Author(s):

Xiaolei Wei ◽

Jialin Song ◽

Yongqiang Wei ◽

Hong Zeng ◽

Weimin Huang ◽

...

Keyword(s):

B Cell ◽

Cell Lines ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Response To Treatment ◽

Proliferation Inhibition ◽

Cell Type ◽

Large B Cell Lymphoma ◽

Large B Cell

Background Diffuse large B-cell lymphoma (DLBCL) is the most common subtype of non-hodgkin lymphoma with great heterogeneity in clinical behavior and response to treatment. According to gene expression profile, DLBCL can be divided into at least two subtypes: germinal center B cell type (GCB) and activated B cell type (ABC). ABC-type DLBCL is commonly activated by the NF-κB pathway, but the proteasome inhibitor bortezomib does not significantly improve the prognosis of ABC-DLBCL. Curcumin inhibit the proliferation of various tumor cells by inhibiting the activation of NF-κB. Our purpose was to evaluate whether curcumin could enhance the ensitivity of Bortezomib in ABC-DLBCL. Methods MTT assay was used to evaluate the proliferation of 2 ABC-DLBCL cell lines by treated with curcumin and bortezomib. Apoptosis were detected by FCM after staining with Annexin V/SYTOX Green.Western Blot was used to evaluated the expression of PARP, NF-κB, I κBα/p-IκBα and caspase-3 in ABC-DLBCL cells treated with curcumin and bortezomib. Results Both curcumin and bortezomib could inhibit the proliferation and induce apoptosis in ABC-DLBCL cell lines. Curcumin decreased the expression of p-IκBα, NF-κB/p65 and increased the expression of Cleaved PARP in ABC-DLBCL cell lines. Caspase Inhibitor Z-VAD could reverse the curcumin induced proliferation inhibition and apoptosis by decreasing the cleaved PARP expression. The combination of curcumin and bortezomib could further enhance the proliferation inhibition and apoptosis in ABC-DLBCL cell lines by inhibiting NF-κB. Conclusions Curcumin induced proliferation inhibition and apoptosis by inhibiting NF-κB in ABC-DLBCL. It may sensitize ABC-DLBCL cell lines to the cytotoxic effects of bortezomib by inhibiting NF-κB. Disclosures No relevant conflicts of interest to declare.

Download Full-text

Interleukin-9 Promotes Survival of Diffuse Large B Cell Lymphoma Cells Through Upregulation of P21cip1

Blood ◽

10.1182/blood.v120.21.1544.1544 ◽

2012 ◽

Vol 120 (21) ◽

pp. 1544-1544

Author(s):

Xiao Lv ◽

Xin Wang ◽

Lili Feng ◽

Xueling Ge ◽

Xiaosheng Fang ◽

...

Keyword(s):

B Cell ◽

Cell Lines ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Therapeutic Interventions ◽

Th2 Cells ◽

Large B Cell Lymphoma ◽

Interleukin 9 ◽

Large B Cell

Abstract Abstract 1544 Introduction: Diffuse large-B-cell lymphoma (DLBCL) is known as an aggressive malignancy arising from B lymphocytes. Despite its greatly improved prognosis as a result of chemotherapy and immunotherapy with monoclonal antibodies, the exact molecular etiology of DLBCL is not well understood. Interleukin-9 (IL-9) is initially described as a growth factor secreted by activated Th2 cells. Various observations have demonstrated its diverse actions in immune disorders. Recent years, the determination of its growth-proliferative and anti-apoptotic activities on multiple transformed cells implies a potential role of this cytokine in tumorigenesis but there are still no reports about its oncogenic activities in DLBCL. Our study is aimed to test the expression of IL-9 and its receptor (IL-9R) in DLBCL patients and illustrate its pathogenic effect on DLBCL cell lines in vitro. Methods: Blood samples and araffin-embedded tissues from twenty DLBCL patients were collected prior to therapeutic interventions. Serums from healthy volunteers served as normal control. IL-9 levels in sera were quantified using human ELISA kits. The expression of IL-9R protein in DLBCL tissues and lymphoma cell lines (LY1, LY8, SP53, Mino and Jurket) was determined by immunohistochemical staining and western-blot, respectively. IL-9R genes were knocked down in DLBCL cell lines LY1 and LY8 by lentivirus-mediated gene silencing (interference sequence 5'- GCTCGTGCCATCTGACAATTT -3'). LY1, LY8 and the stable transfected cells were treated with IL-9 alone and in synergy with rituximab (10ug/ml). Disclosures: No relevant conflicts of interest to declare.

Download Full-text

Modeling guided synthesis of potential fatty acid synthase inhibitors for the treatment of diffuse large B-cell lymphoma

10.17760/d20194016 ◽

2015 ◽

Author(s):

Paige Kozlowski

Keyword(s):

Fatty Acid ◽

B Cell ◽

Fatty Acid Synthase ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Large B Cell Lymphoma ◽

Large B Cell

Download Full-text

PKM2 Inhibition Enhances the Sensitivity of Doxorubicin in ABC Diffuse Large B-Cell Lymphoma Cells

Blood ◽

10.1182/blood-2021-146371 ◽

2021 ◽

Vol 138 (Supplement 1) ◽

pp. 4336-4336

Author(s):

Minglang Zhan ◽

Xiaolei Wei ◽

Weimin Huang ◽

Yongqiang Wei ◽

Ru Feng

Keyword(s):

B Cell ◽

Cell Lines ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

Aerobic Glycolysis ◽

Annexin V ◽

B Cell Lymphoma ◽

Metabolic Reprogramming ◽

Large B Cell Lymphoma ◽

Large B Cell

Abstract Background: Pyruvate kinase muscle isoenzyme 2 (PKM2) is a key enzyme in aerobic glycolysis and thought to contribute to cancer cell metabolic reprogramming and regulating the reactive oxygen species (ROS). Doxorubicin has been showed to induced activated-B cell types diffuse large B-cell lymphoma (ABC-DLBCL) cells death by ROS accumulation. Our purpose was to evaluate whether PKM2 inhibition could enhance the sensitivity of doxorubicin in ABC-DLBCL. Methods: MTT assay was used to evaluate the proliferation of 2 ABC-DLBCL cell lines by treated with PKM2 inhibitor, PKM2 shRNA and doxorubicin. Apoptosis were detected by FCM after staining with Annexin V/SYTOX Green. Western Blot was used to evaluated the expression of PARP, Mcl1, Bcl2, Bax, Bim, p38 and JNK in ABC-DLBCL cells treated with PKM2 inhibition, PKM2 shRNA and doxorubicin. Results: PKM2 expression was found in both U2932 and SuDHL2 cell lines. Both PKM2 inhibitor and doxorubicin could inhibit the proliferation and induce apoptosis in ABC-DLBCL cell lines. PKM2 inhibitor could enhance the doxorubicin-induced apoptosis. ShRNA was used to knock down the PKM2 expression in ABC-DLBCL cell lines and PKM2 KD cell lines were more sensitive to doxorubicin. PKM2 inhibition could increase the expression of cleaved PARP, Bax, Bim, p38 and JNK as well as decrease Mcl1 and Bcl2 expression Conclusions: PKM2 inhibition could sensitize ABC-DLBCL cell lines to the cytotoxic effects of doxorubicin. Key words: PKM2, Doxorubicin, Diffuse large B cell lymphoma Disclosures No relevant conflicts of interest to declare.

Download Full-text