PKM2 Inhibition Enhances the Sensitivity of Doxorubicin in ABC Diffuse Large B-Cell Lymphoma Cells

Abstract Background: Pyruvate kinase muscle isoenzyme 2 (PKM2) is a key enzyme in aerobic glycolysis and thought to contribute to cancer cell metabolic reprogramming and regulating the reactive oxygen species (ROS). Doxorubicin has been showed to induced activated-B cell types diffuse large B-cell lymphoma (ABC-DLBCL) cells death by ROS accumulation. Our purpose was to evaluate whether PKM2 inhibition could enhance the sensitivity of doxorubicin in ABC-DLBCL. Methods: MTT assay was used to evaluate the proliferation of 2 ABC-DLBCL cell lines by treated with PKM2 inhibitor, PKM2 shRNA and doxorubicin. Apoptosis were detected by FCM after staining with Annexin V/SYTOX Green. Western Blot was used to evaluated the expression of PARP, Mcl1, Bcl2, Bax, Bim, p38 and JNK in ABC-DLBCL cells treated with PKM2 inhibition, PKM2 shRNA and doxorubicin. Results: PKM2 expression was found in both U2932 and SuDHL2 cell lines. Both PKM2 inhibitor and doxorubicin could inhibit the proliferation and induce apoptosis in ABC-DLBCL cell lines. PKM2 inhibitor could enhance the doxorubicin-induced apoptosis. ShRNA was used to knock down the PKM2 expression in ABC-DLBCL cell lines and PKM2 KD cell lines were more sensitive to doxorubicin. PKM2 inhibition could increase the expression of cleaved PARP, Bax, Bim, p38 and JNK as well as decrease Mcl1 and Bcl2 expression Conclusions: PKM2 inhibition could sensitize ABC-DLBCL cell lines to the cytotoxic effects of doxorubicin. Key words: PKM2, Doxorubicin, Diffuse large B cell lymphoma Disclosures No relevant conflicts of interest to declare.

Download Full-text

NIK Is Involved In the Activation of the Classical and Alternative NF-κB Pathways In Diffuse Large B Cell Lymphoma

Blood ◽

10.1182/blood.v116.21.3099.3099 ◽

2010 ◽

Vol 116 (21) ◽

pp. 3099-3099

Author(s):

Lina Odqvist ◽

Margarita Sánchez-Beato ◽

Santiago Montes-Moreno ◽

Ken H Young ◽

Francesco Acquadro ◽

...

Keyword(s):

B Cell ◽

Cell Lines ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

Alternative Pathway ◽

B Cell Lymphoma ◽

Classical Pathway ◽

Strong Positive Correlation ◽

Large B Cell Lymphoma ◽

Large B Cell

Abstract Abstract 3099 Deregulated NF-κB activity plays a role in the lymphoma pathogenesis, and has been proposed to constitute a cardinal feature of some subtypes of diffuse large B cell lymphoma (DLBCL). The NF-κB-Inducing Kinase (NIK) is essential for the activation of the alternative NF-κB pathway by inducing the phosphorylation of the NF-κB member p100, which leads to its processing to p52 and its subsequent nuclear translocation. A role for NIK in the classical NF-κB pathway as well has been shown, suggesting NIK as an attractive therapeutic target in lymphomas. Here, we study the frequency and extent of alternative and classical NF-κB activation in diffuse large B cell lymphoma, and the implication of NIK in both pathways. The activation of the classical and alternative NF-κB pathways was present in 28 and 34% of DLBCL cases respectively, as assessed by nuclear expression of p50 (classical pathway) and p52 (alternative pathway) by immunohistochemistry in a series of 301 samples. Activation of both NF-κB pathways was observed in germinal centre B-cell like (GC) and activated B-cell like (ABC) subtypes, with a slight predominance, although not significant, in ABC subtype. In contrast, the levels of p52 and p50 were significantly higher in ABC-DLBCL cell lines than those of GC subtype. The activation of both pathways was mostly overlapped and there was a strong positive correlation between nuclear p52 and p50 (p<0.001). Eighteen % of the cases expressed both p50 and p52 while only 8 and 16% expressed exclusively p50 or p52, respectively. Activation of the alternative NF-κB pathway was strongly associated with Epstein-Barr virus (EBV), since 93% of EBV+ cases expressed nuclear p52 (p<0.001). In our study, no TRAF3 deletions were detected in a panel of 25 DLBCL samples, although absence of TRAF3 was observed in one DLBCL cell line. Since NIK acts as a bottleneck in the activation of the alternative pathway but has also been described to play a role in the classical pathway, we wanted to analyze the effect of the knockdown of NIK on both pathways. Using small interference RNA in two lymphoma cell lines, we observed that the silencing of NIK had an effect on both pathways, decreasing the processing of p100 as well as p105. Taken together, our results show that the activation of NF-κB distinguishes a subset of DLBCL cases, comprising both ABC and GC subtypes, suggest a frequent overlap between the classical and alternative NF-κB pathway in DLBCL, and identify a possible role for NIK in the activation of both pathways. Disclosures: No relevant conflicts of interest to declare.

Download Full-text

CD44 over Expression Caused Drug Resistance in Activated B Cell-like Diffuse Large B-Cell Lymphoma

Blood ◽

10.1182/blood.v128.22.5316.5316 ◽

2016 ◽

Vol 128 (22) ◽

pp. 5316-5316

Author(s):

Qinjun Zhou ◽

Yongqiang Wei ◽

Xiaolei Wei ◽

Qi Wei ◽

Ru Feng

Keyword(s):

Drug Resistance ◽

B Cell ◽

Growth Regulation ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

Annexin V ◽

B Cell Lymphoma ◽

Over Expression ◽

Large B Cell Lymphoma ◽

Large B Cell

Abstract CD44, a transmembrane glycocoptotein, involved in tumor cell survival, migration , invasion, metastasis and prognosis of many cancers. This study was performed to investigate the effects of CD44 over expression on the biological function and the chemotherapeutic sensitivity of ABC-DLBCL. The full length CD44 cDNA was cloned into pEASY-T vector and then transfected into activated B cell-like diffuse large B-cell lymphoma cell line OCI-ly3. QPCR and western blot confirmed that the CD44 expression was up-regulated in both mRNA and protein levels in CD44-transfected OCI-ly3 cells. The cell proliferation of OCI-ly3-CD44 cells was significantly faster than that in OCI-ly3-GFP cells and the OCI-ly3 cells (p<0.001). Annexin V-APC/PI staining results showed that the apoptosis ratio wasn't difference among three groups (p=0.676). OCI-ly3-CD44 cells showed significantly higher migration ratio than OCI-ly3-GFP cells and the OCI-ly3 cells(p=0.031). The IC50 of doxorubicin in OCI-ly3-CD44 cells (0.348±0.072uM) was higher than that in OCI-ly3-GFP (0.348±0.072uM ) and OCI-ly3cells(0.138±0.029uM ) ( P<0.001). After treatment with doxorubicin for 24h, the OCI-ly3-CD44 cells showed lower apoptotic ratio than OCI-ly3-GFP and OCI-ly3 cells ( (17.5±1.33)% VS. (41.7±9.91) %, (41.8±7.23)%), P<0.001). In conclusion, CD44 plays a key role in cell growth regulation and chemo-resistance and is a potential target to overcome drug resistance and improve prognosis in DLBCL. Disclosures No relevant conflicts of interest to declare.

Download Full-text

Imbalance in Alternative Splicing of MCL-1 Inhibits Apoptosis in Diffuse Large B-Cell Lymphoma

Blood ◽

10.1182/blood.v124.21.5424.5424 ◽

2014 ◽

Vol 124 (21) ◽

pp. 5424-5424

Author(s):

Nicolle H Rekers ◽

Laura M Moesbergen ◽

Nathalie J Hijmering ◽

Wim Vos ◽

Joost Oudejans ◽

...

Keyword(s):

Alternative Splicing ◽

B Cell ◽

Cell Lines ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Apoptosis Resistance ◽

Expression Levels ◽

Large B Cell Lymphoma ◽

Large B Cell

Abstract Diffuse large B-cell lymphoma (DLBCL) remains eventually fatal in 30-40% of the patients, despite intensive chemotherapy (CHOP) in combination with rituximab. A subgroup of chemotherapy-refractory DLBCL is characterized by high expression levels of both pro- and anti-apoptotic genes, including MCL-1. Alternative splicing of the MCL-1 gene results in a Bcl-2-like anti-apoptotic MCL-1L protein and a BH3-only pro-apoptotic MCL-1S protein. In the present study, we investigated if a switch in alternative splicing of MCL-1 is involved in apoptosis-resistance in primary lymphoma cells of 20 DLBCL patients and 5 DLBCL cell lines. RT-MLPA analysis revealed that MCL-1L and MCL-1S are both expressed in all tested DLBCL samples and DLBCL cell lines, however expression levels varied strongly. An imbalance between the expression levels of MCL-1L and MCL-1S to an anti-apoptotic status was observed in DLBCL patient cells and DLBCL cell lines, especially in activated B-cell like (ABC)-DLBCL, compared to tonsillar germinal center B-cells. MCL-1 mRNA expression was confirmed at protein level using immunohistochemistry and western blot analysis. Co-immunoprecipitation demonstrated that MCL-1L inhibited apoptosis by binding of Bak in MCL-1L positive DLBCL cell lines. Knockdown of MCL-1L with siRNA analysis resulted in induction of apoptosis in both GCB- and ABC-DLBCL cell lines and also in increased sensitivity to the conventional chemotherapeutical drugs etoposide. Downregulation of MCL-1L using flavopiridol induced apoptotic cell death of MCL-1L-positive DLBCL cells with low Bcl-2 expression. In summary, a switch in alternative splicing of MCL-1 occurs in a subgroup of DLBCL leading to an increase in the level of anti-apoptotic MCL-1L that contributes to therapy-resistance. These preclinical data suggest that targeting of MCL-1L might be a therapeutic option for MCL-1L positive DLBCL. Disclosures No relevant conflicts of interest to declare.

Download Full-text

Inhibition of Fatty Acid Synthase Suppresses c-Met Receptor Kinase and Induces Apoptosis in Diffuse Large B Cell Lymphoma.

Blood ◽

10.1182/blood.v114.22.4787.4787 ◽

2009 ◽

Vol 114 (22) ◽

pp. 4787-4787

Author(s):

Shahab Uddin ◽

Azhar Hussain ◽

Prashant Bavi ◽

Khawla Al-Kuraya

Keyword(s):

Fatty Acid ◽

B Cell ◽

Cell Lines ◽

Fatty Acid Synthase ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Specific Chemical ◽

Large B Cell Lymphoma ◽

Large B Cell

Abstract Abstract 4787 Targeted approaches are expected to revolutionize cancer treatment in near future. Fatty acid synthase (FASN), the enzyme responsible for de novo synthesis of fatty acids has emerged as a potential therapeutic target for several cancers however its role in diffuse large B-cell lymphoma (DLBCL) has not been fully elucidated.. Therefore, we investigated the expression of FASN in tissue micro array cohort of 301 DLBCL patients. FASN was found to be expressed in 62.6% (162/259) DLBCL samples and was seen in highly proliferative tumors manifested by high Ki67 (p<0.0001). Significant association was found between tumors expressing high FASN and c-Met tyrosine kinase (p<0.0002) as well as p-AKT (p=0.0309). In vitro, pharmacological FASN inhibition and SiRNA targeted against FASN triggered caspase dependent apoptosis and suppressed expression of c-Met kinase in DLBCL cell lines which further highlighted the molecular link between FASN and c-Met kinase. Finally, simultaneous targeting of FASN and c-Met with specific chemical inhibitors induced a synergistically stimulated apoptotic response in DLBCL cell lines. These findings provide evidence of an active role of FASN in DLBCL evolution by specifically regulating tyrosine kinases related to malignant transformation strongly suggest that targeting FASN may have therapeutic value in treatment of DLBCL. Disclosures: No relevant conflicts of interest to declare.

Download Full-text

HIF-1a Regulating the Chemoresistance By Upregulating the Expression of xCT and GCLM in the Diffuse Large B Cell Lymphoma

Blood ◽

10.1182/blood-2019-127612 ◽

2019 ◽

Vol 134 (Supplement_1) ◽

pp. 5236-5236

Author(s):

Yongqiang Wei ◽

Hong Zeng ◽

Xiaolei Wei ◽

Weimin Huang ◽

Jialin Song ◽

...

Keyword(s):

Drug Resistance ◽

B Cell ◽

Cell Lines ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Response To Treatment ◽

Chop Regimen ◽

Large B Cell Lymphoma ◽

Large B Cell

Background Diffuse large B-cell lymphoma (DLBCL) is the most common subtype of non-hodgkin lymphoma with great heterogeneity in clinical behavior and response to treatment. Although the addition of rituximab to CHOP regimen has significantly improved the survival of DLBCL, 1/3 will be eventually relapse and progression. HIF1a has been reported to be related with the drug resistance in DLBCL, but the mechanism remains unknown. Methods Two DLBCL cell lines (Riva and SuDHL2) were treated with doxorubicin and HIF-1a inhibitors digoxin, YC-1. The proliferation of these cell lines (Riva and SuDHL2) were measured by MTT and apoptosis were detected by FCM after staining with Annexin V/SYTOX Green. Expression of IF-1α, PHD, xCT, GCLM and apoptosis-related proteins was detected by Western Blot. Results With the increase concentration of doxorubicin treatment, the proliferation of Riva and SuDHL2 cell lines could be gradually inhibited. xCT and GCLM expression were upregulated after treated with doxorubicin and can be reversed by N-acetylcysteine. HIF-1a inhibitors digoxin and YC-1 could inhibited the expression of xCT and GCLM, proliferation and apoptosis induced by doxorubicin. Furthermore, we treated shHIF-1a RNA to significantly reduce the expression of HIF-1a, and the decrease of HIF-1a expression enhanced the proliferation inhibition and apoptosis of lymphoma cells by Dox. Downregulation the expression of HIF-1a by shRNA enhanced the doxorubicin induced apoptosis and inhibited the proliferation in DLBCL cell lines. Conclusions Taken together, our results showed that HIF-1a could regulate the expression of xCT and GCLM and further mediate drug resistance in the diffuse large B cell lymphoma. Disclosures No relevant conflicts of interest to declare.

Download Full-text

Curcumin Enhances the Sensitivity of Bortezomib By Inhibiting NF-Κb in ABC Diffuse Large B-Cell Lymphoma Cells

Blood ◽

10.1182/blood-2019-127705 ◽

2019 ◽

Vol 134 (Supplement_1) ◽

pp. 5237-5237

Author(s):

Xiaolei Wei ◽

Jialin Song ◽

Yongqiang Wei ◽

Hong Zeng ◽

Weimin Huang ◽

...

Keyword(s):

B Cell ◽

Cell Lines ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Response To Treatment ◽

Proliferation Inhibition ◽

Cell Type ◽

Large B Cell Lymphoma ◽

Large B Cell

Background Diffuse large B-cell lymphoma (DLBCL) is the most common subtype of non-hodgkin lymphoma with great heterogeneity in clinical behavior and response to treatment. According to gene expression profile, DLBCL can be divided into at least two subtypes: germinal center B cell type (GCB) and activated B cell type (ABC). ABC-type DLBCL is commonly activated by the NF-κB pathway, but the proteasome inhibitor bortezomib does not significantly improve the prognosis of ABC-DLBCL. Curcumin inhibit the proliferation of various tumor cells by inhibiting the activation of NF-κB. Our purpose was to evaluate whether curcumin could enhance the ensitivity of Bortezomib in ABC-DLBCL. Methods MTT assay was used to evaluate the proliferation of 2 ABC-DLBCL cell lines by treated with curcumin and bortezomib. Apoptosis were detected by FCM after staining with Annexin V/SYTOX Green.Western Blot was used to evaluated the expression of PARP, NF-κB, I κBα/p-IκBα and caspase-3 in ABC-DLBCL cells treated with curcumin and bortezomib. Results Both curcumin and bortezomib could inhibit the proliferation and induce apoptosis in ABC-DLBCL cell lines. Curcumin decreased the expression of p-IκBα, NF-κB/p65 and increased the expression of Cleaved PARP in ABC-DLBCL cell lines. Caspase Inhibitor Z-VAD could reverse the curcumin induced proliferation inhibition and apoptosis by decreasing the cleaved PARP expression. The combination of curcumin and bortezomib could further enhance the proliferation inhibition and apoptosis in ABC-DLBCL cell lines by inhibiting NF-κB. Conclusions Curcumin induced proliferation inhibition and apoptosis by inhibiting NF-κB in ABC-DLBCL. It may sensitize ABC-DLBCL cell lines to the cytotoxic effects of bortezomib by inhibiting NF-κB. Disclosures No relevant conflicts of interest to declare.

Download Full-text

Interleukin-9 Promotes Survival of Diffuse Large B Cell Lymphoma Cells Through Upregulation of P21cip1

Blood ◽

10.1182/blood.v120.21.1544.1544 ◽

2012 ◽

Vol 120 (21) ◽

pp. 1544-1544

Author(s):

Xiao Lv ◽

Xin Wang ◽

Lili Feng ◽

Xueling Ge ◽

Xiaosheng Fang ◽

...

Keyword(s):

B Cell ◽

Cell Lines ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Therapeutic Interventions ◽

Th2 Cells ◽

Large B Cell Lymphoma ◽

Interleukin 9 ◽

Large B Cell

Abstract Abstract 1544 Introduction: Diffuse large-B-cell lymphoma (DLBCL) is known as an aggressive malignancy arising from B lymphocytes. Despite its greatly improved prognosis as a result of chemotherapy and immunotherapy with monoclonal antibodies, the exact molecular etiology of DLBCL is not well understood. Interleukin-9 (IL-9) is initially described as a growth factor secreted by activated Th2 cells. Various observations have demonstrated its diverse actions in immune disorders. Recent years, the determination of its growth-proliferative and anti-apoptotic activities on multiple transformed cells implies a potential role of this cytokine in tumorigenesis but there are still no reports about its oncogenic activities in DLBCL. Our study is aimed to test the expression of IL-9 and its receptor (IL-9R) in DLBCL patients and illustrate its pathogenic effect on DLBCL cell lines in vitro. Methods: Blood samples and araffin-embedded tissues from twenty DLBCL patients were collected prior to therapeutic interventions. Serums from healthy volunteers served as normal control. IL-9 levels in sera were quantified using human ELISA kits. The expression of IL-9R protein in DLBCL tissues and lymphoma cell lines (LY1, LY8, SP53, Mino and Jurket) was determined by immunohistochemical staining and western-blot, respectively. IL-9R genes were knocked down in DLBCL cell lines LY1 and LY8 by lentivirus-mediated gene silencing (interference sequence 5'- GCTCGTGCCATCTGACAATTT -3'). LY1, LY8 and the stable transfected cells were treated with IL-9 alone and in synergy with rituximab (10ug/ml). Disclosures: No relevant conflicts of interest to declare.

Download Full-text

PDK4-Mediated Metabolic Reprogramming Promotes Rituximab Resistance in Diffuse Large B-Cell Lymphoma Via Negative Regulation of MS4A1/CD20

10.21203/rs.3.rs-490131/v1 ◽

2021 ◽

Author(s):

Duanfeng Jiang ◽

Qiuyu Mo ◽

Xiaoying Sun ◽

Xiaotao Wang ◽

Min Dong ◽

...

Keyword(s):

B Cell ◽

Cell Lines ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Metabolic Reprogramming ◽

Cell Counting ◽

Expression Levels ◽

Large B Cell Lymphoma ◽

Cd20 Expression ◽

Large B Cell

Abstract Background: Diffuse large B cell lymphoma (DLBCL) heterogeneity promotes the recurrence and anti-CD20-based therapeutic resistance. In previous studies, it has been demonstrated that the downregulation of MS4A1/CD20 expression after chemoimmunotherapy with rituximab can lead to rituximab resistance. However, the the mechanisms of CD20-loss remains unknown. Methods: The expression levels of PDK4 were investigated in DLBCL patients and cell lines by RNA-seq, qRT-PCR, western blotting and immunofluorescence analysis. Lentiviral infection was used to regulate the level of PDK4 in DLBCL cells. The effects of PDK4 on apoptosis, drug sensitivity and proliferation of DLBCL cells were evaluated by flow cytometry and cell-counting kit-8 (CCK-8) assay, as well as being assessed in a murine model. Cell metabolism was conducted by measurement of glucose consumption, lactate production, ATP levels, ECAR and OCR with corresponding assay kit. Results: Our data showed that PDK4 expression levels elevated significantly in DLBCL cells derived from both the patients and cell lines with rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone regimen) resistant. We further found that the overexpression of PDK4 in DLBCL cells can lead to cell proliferation and rituximab resistance both in vitro and in vivo. Furthermore, the loss of PDK4 expression or treatment with the PDK4 inhibitor dichloroacetate is effective in increasing the rituximab-induced cell apoptosis in DLBCL cells. According to the mechanism studies, PDK4 mediated a metabolic shift that the main energy source was changed from OXPHOS to glycolysis. More importantly, with the knockdown or overexpression of PDK4 in DLBCL cells leads to a reverse MS4A1/CD20 expression. Conclusion: Our data identify a metabolic reprogramming role of PDK4 in rituximab resistance of DLBCL and highlight the unique function of PDK4 as an attractive therapeutic target.

Download Full-text

The Significance of CD44ICD in Difuse Large B- Cell Lymphoma Cell Line SUDHL2 and the Preliminary Study On the Mechanism

Blood ◽

10.1182/blood.v120.21.5087.5087 ◽

2012 ◽

Vol 120 (21) ◽

pp. 5087-5087

Author(s):

Ru Feng ◽

Wenbing Duan ◽

Dayan Chen ◽

Xiaolei Wei ◽

Yongqiang Wei ◽

...

Keyword(s):

B Cell ◽

Cell Line ◽

Conflicts Of Interest ◽

Cell Lymphoma ◽

Annexin V ◽

B Cell Lymphoma ◽

Surface Expression ◽

Surface Markers ◽

Large B Cell Lymphoma ◽

Large B Cell

Abstract Abstract 5087 Objective: Diffuse large B cell lymphoma (the diffuse large B-cell lymphoma, DLBCL), is one of the most common type of non-Hodhkin's lymphomawith high heterogeneity. γ-secretase can induce the hydrolysis of CD44, which play a key important in DLBCL, producing the CD44 intracellular domain. According to our research, the inhibition of CD44ICD can decrease the expression of NF-„KB and Stat-3 in SUDHL2 cell line from ABC-DLBCL cell line. Therefore the aim of this study was put important on the change of proliferation, apoptosis and main surface markers, ERK1/2 and phosphor-ERK1/2 in CD44 positive cell line from ABC-DLBCL after inhibiting the production of CD44ICD. Method: The surface expression of CD44 in SUDHL2 and OCI-ly3 cell lines was tested by flow cytometry, and then chose the CD44 positive cell line. Using 0. 1, 1. 0, 5. 0, 10, 25, 50, 75 and 100μM DAPT inhibited the production of CD44ICD in CD44 positive cell line respectively, and then tested the cell proliferation, apoptosis and main surface markers(CD44, CD19, CD20) by MTT analysis, Annexin V-FITC/PI and flow cytomety separately after 24h. mean while western blot was used to detected whether ERK1/2 and phosphor-ERK1/2 expressed in the chosen cell line, if they expressed in it, tested their change after blocking the release of CD44ICD for 1h. Results Conclusion The ERK1/2 signal path participated in the regulation of SUDHL2 cell line, moreover after inhibited the release of CD44ICD, both the ERK1/2 and phosphor-ERK1/2 could be regulated up, however further study must go on. Disclosures: No relevant conflicts of interest to declare.

Download Full-text

MicroRNA-181a Inhibits Activated B-Cell-Like Diffuse Large B-Cell Lymphoma Progression by Repressing CARD11

Journal of Oncology ◽

10.1155/2019/9832956 ◽

2019 ◽

Vol 2019 ◽

pp. 1-9 ◽

Cited By ~ 1

Author(s):

Danxia Zhu ◽

Cheng Fang ◽

Wenting He ◽

Chen Wu ◽

Xiaodong Li ◽

...

Keyword(s):

B Cell ◽

Binding Site ◽

Cell Lines ◽

Expression Vector ◽

Cell Lymphoma ◽

B Cell Lymphoma ◽

Wild Type ◽

Protein Levels ◽

Large B Cell Lymphoma ◽

Large B Cell

We investigated the role of miR-181a in diffuse large B-cell lymphoma (DLBCL) and its potential target genes. miR-181a levels were lower in activated B-cell- (ABC-) like DLBCL cells than that in germinal center B-cell- (GCB-) like DLBCL cells. Overexpression of miR-181a in ABC-like DLBCL cell lines (OCI-LY10 and U2932) resulted in G0/G1 cell cycle arrest, increased apoptosis, and decreased invasiveness. miRNA target prediction programs (miRanda, TargetScan, and miRDB) identified caspase recruitment domain-containing protein 11 (CARD11) as a putative miR-181a target. CARD11 mRNA and protein levels were higher in the ABC-like DLBCL than that in GCB-like DLBCL. Moreover, CARD11 mRNA and protein levels were downregulated in the OCI-LY10 and U2932 cell lines overexpressing miR-181a. Dual luciferase reporter assays confirmed the miR-181a binding site in the CARD11 3′UTR region. OCI-LY10 and U2932 cells transfected with a CARD11 expression vector encoding miR-181a with a mutated binding site showed higher CARD11 protein levels, cell viability, G2/M phase cells, and invasiveness compared to those transfected with a wild-type CARD11 expression vector. Nude mice xenografted with OCI-LY10 cells with overexpressed wild-type miR-181a generated smaller tumors compared to those with overexpressed mutated binding site of CARD11 3′UTR and miR-181a. These results indicate that miR-181a inhibits ABC-like DLBCL by repressing CARD11.

Download Full-text