scholarly journals Fungi Associated with Postharvest Diseases of Sweet Potato Storage Roots and In Vitro Antagonistic Assay of Trichoderma harzianum against the Diseases

2021 ◽  
Vol 7 (11) ◽  
pp. 927
Author(s):  
Narayan Chandra Paul ◽  
Soyoon Park ◽  
Haifeng Liu ◽  
Ju Gyeong Lee ◽  
Gui Hwan Han ◽  
...  
Keyword(s):  
Sweet Potato ◽  
Trichoderma Harzianum ◽  
Root Rot ◽  
Severe Disease ◽  
Dual Culture ◽  
Potato Storage ◽  
Postharvest Diseases ◽  
Storage Roots ◽  
Sweet Potatoes ◽  
Dry Rot

Sweet potato is the 11th most important food crop in the world and an excellent source of nutrition. Postharvest diseases were monitored in sweet potato storage roots collected from the local markets in Korea during 2021. Several diseases including Fusarium surface and root rot, charcoal rot, dry rot, and soft rot were observed in the postharvest sweet potatoes. A total of 68 fungal isolates were obtained from the diseased samples, and the isolates were grouped into 8 different fungal colony types. Based on multilocus phylogeny and morphological analysis of 17 representative isolates, the isolates were identified as Fusarium oxysporum, F. ipomoeae, F. solani, Penicillium citrinum, P. rotoruae, Aspergillus wentii, Mucor variicolumellatus (Mu. circinelloides species complex), and Macrophomina phaseolina. F. oxysporum was the predominant pathogen as this is the most common pathogen of sweet potato storage roots causing the surface rot disease, and M. phaseolina caused the most severe disease among the pathogens. Dual culture antagonistic assays were evaluated using Trichoderma harzianum strains CMML20–26 and CMML20–27. The results revealed that the two strains showed strong antifungal activity in different ranges against all tested pathogens. This study provides an understanding of diverse postharvest diseases in sweet potatoes and suggests potential biocontrol agents to manage the diseases. In addition, this is the first report of sweet potato storage root rot diseases caused by A. wentii, and P. rotoruae worldwide.

Influence of volatiles from healthy and decaying sweet potato storage roots on sclerotial germination and hyphal growth of Sclerotium rolfsii

1989 ◽  
Vol 67 (1) ◽  
pp. 53-57 ◽  
Author(s):  
C. A. Clark
Keyword(s):  
Sweet Potato ◽  
Sclerotium Rolfsii ◽  
Hyphal Growth ◽  
Root Tissue ◽  
Natural Soil ◽  
Potato Storage ◽  
Storage Root ◽  
Storage Roots ◽  
Sweet Potatoes ◽  
Directional Growth

Volatiles released from sweet potato storage root tissue infected by different sweet potato storage root pathogens stimulated eruptive germination of sclerotia of Sclerotium rolfsii but did not influence the direction of hyphal growth on agarose. Volatiles from healthy sweet potato storage root tissue did not affect percent hyphal or eruptive germination of sclerotia of S. rolfsii but stimulated directional growth of hyphae toward the healthy tissue. In laboratory experiments, the frequency of infection of sweet potato stem segments by S. rolfsii on the surface of natural soil was increased when sclerotia were incubated in the presence of decaying sweet potato storage root tissue. Incidence of sclerotial blight lesions on sprouts in plant beds was increased in the presence of roots infected by Fusarium solani or Erwinia chrysanthemi. Volatiles from decaying sweet potato mother roots may predispose sweet potatoes to sclerotial blight.

Isolation and characterisation of invertase inhibitor from sweet potato storage roots

2008 ◽  
Vol 88 (15) ◽  
pp. 2615-2621 ◽  
Author(s):  
Guan-Jhong Huang ◽  
Ming-Jyh Sheu ◽  
Yuan-Shiun Chang ◽  
Te-Ling Lu ◽  
Heng-Yuan Chang ◽  
...  
Keyword(s):  
Sweet Potato ◽  
Potato Storage ◽  
Storage Roots ◽  
Invertase Inhibitor

scholarly journals Effects of Arbuscular Mycorrhizal Fungal Inoculation on Growth and Yield of Two Sweet Potato Varieties

2019 ◽  
pp. 1-8 ◽  
Author(s):  
Michael Ajanja Sakha ◽  
Joyce Jefwa ◽  
Joseph P. Gweyi-Onyango
Keyword(s):  
Sweet Potato ◽  
Arbuscular Mycorrhizal ◽  
Growth And Yield ◽  
Shoot Biomass ◽  
Storage Roots ◽  
Sweet Potatoes ◽  
Potato Varieties ◽  
Significant Difference ◽  
Amf Inoculation ◽  
Number Of Branches

Arbuscular mycorrhizal fungi (AMF) represent a functionally important component of soil microbial community, being of particular significance for plant mineral nutrition in tropical agro ecosystems. The effects of AMF inoculation on growth and yield of two sweet potato varieties was studied during the short rains season of 2017/2018 in the Teaching and Research Farm of Agricultural Science and Technology Department, Kenyatta University. The experiment was laid down as 2x2 factorial design in a randomized complete block design (RCBD) with three replications. The experimental factors were two sweet potato varieties (Kemb-10 and Bungoma) and AMF inoculum (With and without inoculation). Data on growth parameters was collected on vine length and number of branches, while data on yield was collected on marketable storage roots and shoot biomass. Data was analyzed using Genstat 15th edition and the results showed that there was significantly difference at P≤0.05 among the treatments. AMF inoculation increased growth and yield of sweet potatoes by vine length 29.74%, Number of branches 22.36%, marketable storage roots 18.32%, and shoot biomass 28.68% in week 20. Also, variety interacting with AMF inoculation enhanced growth and yield parameters. In conclusion, the study demonstrated that the application of commercial AMF inoculum solely or when interacting with varieties enhanced growth and yield of sweet potatoes, though there was no significant difference between the two varieties.

scholarly journals First Report of Fusarium solani Causing Fusarium Root Rot and Stem Canker on Storage Roots of Sweet Potato in China

Plant Disease ◽  
2014 ◽  
Vol 98 (1) ◽  
pp. 160-160 ◽  
Author(s):  
R.-Y. Wang ◽  
B. Gao ◽  
X.-H. Li ◽  
J. Ma ◽  
S.-L. Chen
Keyword(s):  
Sweet Potato ◽  
Fusarium Solani ◽  
Root Rot ◽  
Gene Sequence ◽  
Fusarium Species ◽  
Stem Canker ◽  
Storage Roots ◽  
Tubulin Gene ◽  
Beta Tubulin ◽  
Beta Tubulin Gene

China is the biggest sweet potato (Ipomoea batatas (L.) Lam) producer in the world and its total production is about 100 million tons per year. Surveys for diseases of sweet potato in storage were conducted from 2011 to 2013 in Hebei Province, China. The storage roots from cultivars such as Yizi 138 and Beijing 553 developed lesions on their surface during storage. Typical lesions consisted of alternating light and dark brown concentric rings that were darker than the root surface. The size of the lesions was 49 × 63 mm (11 to 75 × 36 to 80 mm, n = 20) on average. The lesion spot was slightly concave. Cutting the diseased roots revealed the lesions could extend into the center of the roots, often with cavities. It smelled bitter within the necrotic tissues and was dark brown or black. The disease incidence was about 10 to 20%. A Fusarium species was consistently isolated from the diseased roots (n = 20). Mycelial plugs from a pure culture of the pathogen on potato dextrose agar were placed on the surface of disinfected sweet potato roots incubated at 25°C with 80 to 90% relative humidity and uninoculated roots were used as control. The same symptom was observed after 14 days on all roots (n = 20) inoculated with the pathogen. The same Fusarium species was consistently reisolated from all lesions. The pathogen was cultured on carnation leaf agar (CLA) for 10 days at 25°C with a 12-h photoperiod. The fungus produced two types of spores on CLA: microconidia were thin-walled, hyaline, fusiform to ovoid, generally 1- or 2-celled, and 3.1 to 9.4 × 1.3 to 2.9 μm (n = 20); macroconidia were slightly curved with blunt and rounded apical cell and notched basal cells, mostly 4- to 8-celled, and 13.3 to 36.5 × 2.3 to 3.8 μm (n = 40). On the basis of morphological characteristics, the fungal isolates were identified as Fusarium solani (Mart.) Appel & Wollenw. emend. Snyd. & Hans. (1). The genomic DNA of the pathogen cultured in potato dextrose broth for 3 days at 25°C was extracted with the CTAB method. The ITS-rDNA sequence, a fragment of the translation elongation factor 1-alpha (EF-1α) gene sequence, and the beta tubulin gene sequence was amplified using the paired primers ITS1F/ITS4(CTTGGTCATTTAGAGGAAGTAA/TCCTCCGCTTATTGA TATGC), EF-1/EF-2 (ATGGGTAAGGARGACAAGAC/GGARGTACCAGTSATCATGTT) and Bt-1/Bt-2(AACATGCGTGAGATTGTAAGT/TCTGGATGTTGTTGGGAATCC), respectively. Those sequence showed 97% homology with ITS sequence of F. solani (GenBank Accession No. AF178407), 99% homology with EF-1α sequence of F. solani (JX945169, DQ247593, and DQ247354), and 98% homology with beta tubulin gene sequence of F. solani (AB553621), respectively. The new sequences of ITS-rDNA, EF-1α, and beta tubulin were deposited in GenBank (KF255997, KF255995, and KF255996). The pathogen was identified as F. solani based on its morphological and molecular characteristics. To our knowledge, this is the first report of F. solani-induced fusarium root rot and stem canker on sweet potato storage roots in China. A rootlet root rot attributed to F. solani in China was reported previously (2). References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, Blackwell Publishing, Ames, IA, 2006. (2) Q. J. Liu et al. Acta Phytopathol. Sin. 12(3):21,1982.

scholarly journals EFFECT OF CHANNEL DEPTH ON YIELD OF SWEET POTATOES GROWN HYDROPONICALLY

HortScience ◽  
1990 ◽  
Vol 25 (8) ◽  
pp. 856b-856
Author(s):  
C. Morris ◽  
D. Mortley ◽  
P. Loretan ◽  
C. Bonsi ◽  
W. Hill
Keyword(s):  
Sweet Potato ◽  
Life Support ◽  
Storage Root ◽  
Life Support System ◽  
Storage Roots ◽  
Channel Depth ◽  
Sweet Potatoes ◽  
Manned Space ◽  
Manned Space Missions

The potential of the sweet potato as a food source for future long-term manned space missions is being evaluated for the National Aeronautics and Space Administration's (NASA) Controlled Ecological Life Support System (CELSS) Program. Several experiments have shown that the sweet potato can be grown hydroponically. However, an evaluation of the NASA fan-shaped Biomass Production Chamber (BPC) channel was initiated to determine if channel depths influenced the yield of hydroponically grownsweet potatoes. Three channel depths were studied, 5 cm (2 in) standard NASA BPC channel, 10 cm (4 in) channel and 15 cm (6 in) channel. The experiment consisted of one replication. The results show that channel depth does effect the yield of storage roots. The 15 cm depth channel provided the most consistent yield with all channels having significantly different fresh storage root yields in the replicate.

scholarly journals Bioactivity of Trichoderma harzianum isolates against the fungal root rot pathogens with special reference to Macrophomina phaseolina causing dry root rot of mungbean

2020 ◽  
Vol 73 (4) ◽  
pp. 787-792
Author(s):  
Alyssa Swehla ◽  
Abhay K. Pandey ◽  
Ramakrishnan M. Nair
Keyword(s):  
Growth Inhibition ◽  
Trichoderma Harzianum ◽  
Root Rot ◽  
Mycelial Growth ◽  
Sclerotium Rolfsii ◽  
Macrophomina Phaseolina ◽  
Antagonistic Activity ◽  
Culture Technique ◽  
Dual Culture ◽  
Fallow System

AbstractIn the rice-fallow system, dry root rot (DRR) is an emerging disease of mungbean (Vigna radiata (L.) R. Wilczek var. radiata) caused by the necrotrophic fungus Macrophomina phaseolina. The pathogen causes extensive production losses. In this study, the bioactivity of four Trichoderma harzianum isolates, namely Th-Dharwad, Th-Raichur, Th-Niphm, and Th-Udaipur procured from the Indian research institutes were evaluated against M. phaseolina of mungbean by the dual culture technique. The efficacy of these T. harzianum isolates were also compared with the effective fungicides such as thiram and carbendazim by the poison food method. Results showed that among the T. harzianum isolates, isolate of Th-Raichur was most effective, exhibiting 76.96% mycelial growth inhibition of the test pathogen. As compared to the thiram, carbendazim was more effective, and exhibited 100% mycelial growth inhibition of the test pathogen. In addition, carbendazim was also more effective than the isolate of Th-Raichur. In the sick pot experiment, mungbean seeds treated with Th-Raichur isolate showed a lower percent incidence of DRR (20%) than the untreated seeds (86.6%). The biological spectrum of Th-Raichur isolate was examined against M. phaseolina isolated from the different hosts such as urdbean and vegetable soybean, alongwith two other root pathogens, namely Fusarium solani of mungbean, and Sclerotium rolfsii of urdbean. The isolate of Th-Raichur showed maximum antagonistic activity against the pathogens M. phaseolina and F. solani of mungbean. Thus, Th-Raichur isolate can be used as a potential fungal biocontrol agent for the reduction of DRR in mungbean.

scholarly journals 162 Assessment of daily intake by beef heifers of sweet potato storage roots under competitive limit-feeding conditions

2019 ◽  
Vol 97 (Supplement_1) ◽  
pp. 57-57
Author(s):  
Jane A Parish ◽  
Cobie Rutherford ◽  
Stephen L Meyers ◽  
Mark W Shankle
Keyword(s):  
Sweet Potato ◽  
Bos Taurus ◽  
Daily Intake ◽  
Feeding Strategies ◽  
Potato Storage ◽  
Beef Heifers ◽  
Storage Roots ◽  
Study Objective ◽  
Mean Values ◽  
Limit Feeding

Abstract Excess consumption of sweet potato storage roots (SWP) poses an acidosis risk to cattle that may be mitigated by limit-feeding strategies. Yet limit-feeding is often administered to achieve mean desired daily DMI in groups of cattle with little regard for DMI variation among individuals. The study objective was to assess variation in daily DMI of SWP by beef heifers in limit-fed, competitive feeding groups. Twenty-four 9- to 10-mo-old Bos taurus crossbred heifers were stratified by initial BW (261.9 ± 8.8 kg) to 4 paddocks (6 heifers/ paddock) and offered SWP (24.9% DM on an as-fed basis; 7.7% CP, 5.9% ADF and 80% TDN on a DM basis) supplementation daily at a rate of 3.4 kg DM/ paddock with ad libitum access to mixed-grass pasture. After a 7-d acclimation period in which all heifers were trained to use a GrowSafe system, daily SWP DMI was monitored for 39 days. Standard deviation estimates were calculated from DMI data and used to classify DMI into the following levels: low (2.0 kg, >0.5 SD). Half of the heifers (mean SWP DMI = 0.0 ± 0.02 kg) never consumed SWP at the high DMI level, but 42% of the heifers (mean SWP DMI = 1.1 ± 0.02 kg) consumed SWP at the high DMI level for at least 18 days over the study duration. No heifers consumed at the moderate DMI level more than 16 days during the trial. This suggests that DMI of individual cattle offered SWP in limit-fed groups often either exceeds by approximately 2-fold per animal mean values of SWP offered per group or is at or near zero. Additional research is needed to elucidate optimal group feeding strategies to achieve individual DMI targets among cattle offered SWP.

Sign in / Sign up

Export Citation Format

Share Document