scholarly journals A Bipartite Geminivirus with a Highly Divergent Genomic Organization Identified in Olive Trees May Represent a Novel Evolutionary Direction in the Family Geminiviridae

Viruses ◽  
2021 ◽  
Vol 13 (10) ◽  
pp. 2035
Author(s):  
Patrick Materatski ◽  
Susan Jones ◽  
Mariana Patanita ◽  
Maria Doroteia Campos ◽  
António Bento Dias ◽  
...  
Keyword(s):  
Phosphorylation Site ◽  
Cell Movement ◽  
Typical Feature ◽  
Bipartite Begomoviruses ◽  
World Begomoviruses ◽  
A Genome ◽  
Bipartite Genome ◽  
Virion Sense ◽  
Olive Trees ◽  
Complementary Sense

Olea europaea Geminivirus (OEGV) was recently identified in olive in Italy through HTS. In this work, we used HTS to show the presence of an OEGV isolate in Portuguese olive trees and suggest the evolution direction of OEGV. The bipartite genome (DNA-A and DNA-B) of the OEGV-PT is similar to Old World begomoviruses in length, but it lacks a pre-coat protein (AV2), which is a typical feature of New World begomoviruses (NW). DNA-A genome organization is closer to NW, containing four ORFs; three in complementary-sense AC1/Rep, AC2/TrAP, AC3/REn and one in virion-sense AV1/CP, but no AC4, typical of begomoviruses. DNA-B comprises two ORFs; MP in virion sense with higher similarity to the tyrosine phosphorylation site of NW, but in opposite sense to begomoviruses; BC1, with no known conserved domains in the complementary sense and no NSP typical of bipartite begomoviruses. Our results show that OEGV presents the longest common region among the begomoviruses, and the TATA box and four replication-associated iterons in a completely new arrangement. We propose two new putative conserved regions for the geminiviruses CP. Lastly, we highlight unique features that may represent a new evolutionary direction for geminiviruses and suggest that OEGV-PT evolution may have occurred from an ancient OW monopartite Begomovirus that lost V2 and C4, gaining functions on cell-to-cell movement by acquiring a DNA-B component.

scholarly journals Olea Europaea Geminivirus: A Novel Bipartite Geminivirid Infecting Olive Trees

Viruses ◽  
2021 ◽  
Vol 13 (3) ◽  
pp. 481
Author(s):  
Michela Chiumenti ◽  
Claudia Greco ◽  
Angelo De Stradis ◽  
Giuliana Loconsole ◽  
Vincenzo Cavalieri ◽  
...  
Keyword(s):  
Olea Europaea ◽  
High Throughput Sequencing ◽  
Snp Analysis ◽  
A Genome ◽  
Virion Sense ◽  
Genomic Dnas ◽  
Olive Trees ◽  
Specific Symptoms ◽  
Full Length Genome ◽  
Olea Europaéa

In 2014, high-throughput sequencing of libraries of total DNA from olive trees allowed the identification of two geminivirus-like contigs. After conventional resequencing of the two genomic DNAs, their analysis revealed they belonged to the same viral entity, for which the provisional name of Olea europaea geminivirus (OEGV) was proposed. Although DNA-A showed a genome organization similar to that of New World begomoviruses, DNA-B had a peculiar ORF arrangement, consisting of a movement protein (MP) in the virion sense and a protein with unknown function on the complementary sense. Phylogenetic analysis performed either on full-length genome or on coat protein, replication associated protein (Rep), and MP sequences did not endorse the inclusion of this virus in any of the established genera in the family Geminiviridae. A survey of 55 plants revealed that the virus is widespread in Apulia (Italy) with 91% of the samples testing positive, although no correlation of OEGV with a disease or specific symptoms was encountered. Southern blot assay suggested that the virus is not integrated in the olive genome. The study of OEGV-derived siRNA obtained from small RNA libraries of leaves and fruits of three different cultivars, showed that the accumulation of the two genomic components is influenced by the plant genotype while virus-derived-siRNA profile is in line with other geminivirids reported in literature. Single-nucleotide polymorphism (SNP) analysis unveiled a low intra-specific variability.

scholarly journals Orchid fleck virus is a rhabdovirus with an unusual bipartite genome

2006 ◽  
Vol 87 (8) ◽  
pp. 2413-2421 ◽  
Author(s):  
Hideki Kondo ◽  
Takanori Maeda ◽  
Yukio Shirako ◽  
Tetsuo Tamada
Keyword(s):  
Reading Frame ◽  
Orchid Fleck Virus ◽  
Rna Molecules ◽  
Glycoprotein G ◽  
Bipartite Genome ◽  
Intergenic Sequences ◽  
The Family ◽  
Sequence Complementarity ◽  
Complementary Sense ◽  
Negative Sense

Orchid fleck virus (OFV) has an unusual bipartite negative-sense RNA genome with clear sequence similarities to those of nucleorhabdoviruses. The OFV genome consists of two single-stranded RNA molecules, RNA1 and RNA2 that are 6413 and 6001 nt long, respectively, with open reading frame (ORF) information in the complementary sense. RNA1 encodes 49 (ORF1), 26 (ORF2), 38 (ORF3), 20 (ORF4) and 61 kDa (ORF5) proteins, and RNA2 encodes a single protein of 212 kDa (ORF6). ORF1, ORF5 and ORF6 proteins had significant similarities (21–38 % identity) to the nucleocapsid protein (N), glycoprotein (G) and polymerase (L) gene products, respectively, of other rhabdoviruses, especially nucleorhabdoviruses, whereas ORF2, ORF3 and ORF4 proteins had no significant similarities to other proteins in the international databases. Similarities between OFV and rhabdoviruses were also found in the sequence complementarity at both termini of each RNA segment (the common terminal sequences are 3′-UGUGUC---GACACA-5′), the conserved intergenic sequences and in being negative sense. It was proposed that a new genus Dichorhabdovirus in the family Rhabdoviridae of the order Mononegavirales should be established with OFV as its prototype member and type species.

scholarly journals A Bipartite Begomovirus Infecting Boerhavia erecta (Family Nyctaginaceae) in the Dominican Republic Represents a Distinct Phylogenetic Lineage and has a High Degree of Host Specificity

2019 ◽  
Vol 109 (8) ◽  
pp. 1464-1474
Author(s):  
Tomas A. Melgarejo ◽  
Maria R. Rojas ◽  
Robert L. Gilbertson
Keyword(s):  
Dominican Republic ◽  
Mosaic Virus ◽  
Phylogenetic Analyses ◽  
Bipartite Begomoviruses ◽  
Mechanical Transmission ◽  
Bipartite Begomovirus ◽  
Degenerate Primers ◽  
Phylogenetic Lineage ◽  
A Genome ◽  
High Degree

Boerhavia erecta plants in and around agricultural fields in the Azua Valley of the southeastern Dominican Republic often show striking golden mosaic symptoms. Leaf samples from B. erecta plants showing these symptoms were collected in 2012 and 2013, and PCR tests with degenerate primers revealed begomovirus DNA-A and DNA-B components. The complete sequences of the DNA-A and DNA-B components of four isolates show a high degree of sequence identity (>96%) and a genome organization typical of New World (NW) bipartite begomoviruses. Sequence comparisons and phylogenetic analyses revealed that these isolates composed a new phylogenetic lineage of NW bipartite begomoviruses. The most closely related begomovirus is Merremia mosaic virus, a weed-infecting species from Puerto Rico. Because DNA-A sequence identities are well below the 91% threshold, these isolates represent a new begomovirus species, for which the name Boerhavia golden mosaic virus (BoGMV) is proposed. Infectious cloned BoGMV DNA-A and DNA-B components induced golden mosaic symptoms in agroinoculated B. erecta plants, thereby fulfilling Koch’s postulates for this disease. Agroinoculation and mechanical transmission experiments revealed that BoGMV has an unusually narrow host range, limited to members of the family Nyctaginaceae and not including the permissive host Nicotiana benthamiana. The inability of BoGMV to infect N. benthamiana was due to a deficiency in cell-to-cell movement but not to a unique amino acid residue in the movement protein.

scholarly journals A Distinct Strain of Chickpea chlorotic dwarf virus Infecting Pepper in Oman

Plant Disease ◽  
2014 ◽  
Vol 98 (2) ◽  
pp. 286-286 ◽  
Author(s):  
S. Akhtar ◽  
A. J. Khan ◽  
R. W. Briddon
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Intergenic Region ◽  
Rolling Circle Amplification ◽  
Dwarf Virus ◽  
Hybridization Technique ◽  
Homologous Proteins ◽  
Sequence Identity ◽  
A Genome ◽  
Complementary Sense

During a field survey in 2011, pepper (Capsicum annum) plants showing symptoms suggestive of geminivirus infection were observed in three fields in the Al-Sharqiya region of Oman. Symptoms observed included upward leaf curling leading to cupping and stunting with 15 to 25% disease incidence in surveyed fields. Total DNA was extracted from the leaves of seven symptomatic plants and subjected to rolling circle amplification (RCA). The RCA product was digested with several restriction endonucleases to obtain unit length of ~2.6 to 2.8, typical of geminivirus. Out of seven samples, only four yielded a product of ~2.6 kb in size by KpnI digestion. The fragments were cloned in pUC19 and sequenced. The partial sequences of four isolates were >95% identical to each other at the nucleotide (nt) level and thus only one isolate (P-25) was fully sequenced, determined to be 2,572 nt in length, and its sequence deposited in GenBank (KF111683). The P-25 sequence showed a genome organization typical of a mastrevirus, with four open reading frames (ORFs), two in virion-sense and two in complementary-sense. The virion and complementary-sense ORFs were separated by a long intergenic region, containing a predicted hairpin structure with the nonanucleotide sequence (TAATATTAC) in the loop, and a short intergenic region. An initial comparison to all sequences in the NCBI database using BlastN showed the isolate to have the highest level of sequence identity with isolates of the dicot-infecting mastrevirus Chickpea chlorotic dwarf virus (CpCDV). Subsequent alignments of all available CpCDV isolates using the species demarcation tool (2) showed the isolate P-25 to share between 83.6 and 90.3% identity to isolates of CpCDV available in databases, with the highest (90.3%) to CpCDV strain A originating from Syria (FR687959) (3). Amino acid sequence comparison showed that the predicted proteins encoded by the four ORFs of P-25 (coat protein [CP], movement protein [MP], replication associated protein A [RepA], and RepB) share 91.5, 88.2, 89.1, and 90.8% amino acid sequence identity, respectively, with the homologous proteins of the CpCDV isolate from Syria. Based on the recently revised mastreviruses species and strain demarcation criteria (78 and 94% whole genome nt identity, respectively) proposed by Muhire et al. (2), the results indicate that isolate P-25 represents a newly identified strain (strain F) of CpCDV. The presence of CpCDV in symptomatic pepper plants was further confirmed by Southern blot hybridization technique using digoxygenin (DIG) labeled probe prepared from CpCDV isolate P-25. The genus Mastrevirus consists of geminiviruses with single component genomes that are transmitted by leafhoppers. Mastreviruses have so far only been identified in the Old World and infect either monocotyledonous or dicotyledonous plants (1). To our knowledge, this is the first report of a mastrevirus on the Arabian Peninsula and the first record of pepper as host of CpCDV. Recently, several begomoviruses of diverse geographic origins have been found infecting vegetable crops in Oman. The propensity of geminiviruses to evolve through recombination may lead to evolution of recombinant CpCDV with new host adaptability. Due to extensive agricultural/travel links of Oman with rest of the world, there exists high probability for the spread of this virus. References: (1) M. I. Boulton. Physiol. Mol. Plant Pathol. 60:243, 2002. (2) B. Muhire et al. Arch. Virol. 158:1411, 2013 (3) H. Mumtaz et al. Virus Genes 42:422, 2011.

scholarly journals Cotton leaf crumple virus Is a Distinct Western Hemisphere Begomovirus Species with Complex Evolutionary Relationships Indicative of Recombination and Reassortment

2004 ◽  
Vol 94 (10) ◽  
pp. 1068-1074 ◽  
Author(s):  
A. M. Idris ◽  
J. K. Brown
Keyword(s):  
Sonoran Desert ◽  
Phylogenetic Analyses ◽  
Western Hemisphere ◽  
Bipartite Begomoviruses ◽  
Progeny Virus ◽  
Cotton Leaf ◽  
Sequence Comparisons ◽  
Squash Leaf Curl Virus ◽  
A Genome ◽  
Cotton Leaf Crumple Virus

The bipartite DNA genome of Cotton leaf crumple virus (CLCrV), a whitefly-transmitted begomovirus from the Sonoran Desert, was cloned and completely sequenced. The cloned CLCrV genome was infectious when biolistically delivered to cotton or bean seedlings and progeny virus was whitefly-transmissible. Koch's postulates were completed by the reproduction of characteristic leaf crumple symptoms in cotton seedlings infected with cloned CLCrV DNA, thereby verifying the etiology of leaf crumple disease, which has been known in the southwestern United States since the 1950s. Sequence comparisons confirmed that CLCrV has a genome organization typical of yet sufficiently divergent from all other bipartite begomoviruses to justify recognition as a distinct species. Phylogenetic analyses indicated that CLCrV has a complex evolutionary history probably involving both recombination and reassortment. The relatively low nucleotide sequence identity (77%) of the common region shared by the CLCrV DNA-A and DNA-B components and the distinct phylogenetic relationships of each component are consistent with component reassortment. Sequence analyses indicated that the CLCrV DNA-A component was likely derived by recombination among ancestors of two divergent clades (e.g., the Squash leaf curl virus [SLCV] clade and the Abutilon mosaic virus clade) of Western Hemisphere begomoviruses. The CLCrV DNA-B component also may have originated by recombination among an ancestor of the SLCV clade and another distantly related but unknown Western Hemisphere begomovirus.

scholarly journals Transcriptional Analysis of Complementary Sense Genes in Spinach curly top virus and Functional Role of C2 in Pathogenesis

2007 ◽  
Vol 20 (2) ◽  
pp. 194-206 ◽  
Author(s):  
Surendranath Baliji ◽  
Janet Sunter ◽  
Garry Sunter
Keyword(s):  
Amino Acids ◽  
Symptom Severity ◽  
Functional Role ◽  
Mutant Virus ◽  
Transcriptional Analysis ◽  
Beet Curly Top Virus ◽  
The Family ◽  
Virion Sense ◽  
Complementary Sense

Spinach curly top virus (SCTV), the fifth characterized Curtovirus species belonging to the family Geminiviridae, is an agriculturally significant plant pathogen representing an emerging disease threat in the southern United States. The SCTV genome comprises a single DNA chromosome of approximately 3.0 kb, with the potential to code for seven proteins larger than 10 kDa but which relies extensively on the host for replication and transcription of its genome. In this study, we have identified viral and complementary sense transcripts in SCTV-infected plants, confirming a bidirectional transcription strategy for SCTV. The most abundant RNA maps to the virion sense (1.1-kb transcript) and is comparable in size and location to that observed in Beet curly top virus (BCTV). Two complementary sense transcripts (1.7 and 0.7 kb) were identified in SCTV-infected plants. The large, 1.7-kb transcript is comparable in size and position to that identified in BCTV and several begomoviruses and most likely encodes the C1 protein. Both complementary sense RNAs could potentially direct expression of C2 and C3 from polycistronic mRNAs. A mutation in the C2 gene of SCTV results in expression of a truncated protein of 38 amino acids that is capable of interacting with two cellular kinases, AKIN11 and ADK2, and the resulting mutant virus remains highly infectious. A second mutant virus can only express the first three amino acids of the C2 protein and is unable to interact with the same kinases. However, this mutant virus still remains infectious, although a reduction in infectivity and symptom severity was seen in both Arabidopsis and spinach. A possible relationship between the interaction of C2 with AKIN11 and ADK2 and disease severity is presented.

scholarly journals First Report of Tomato leaf curl Albatinah virus (ToLCABV) and its Associated Betasatellite Infecting Papaya in Oman

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 421-421 ◽  
Author(s):  
U. E. Ammara ◽  
A. Al-Shihi ◽  
I. Amin ◽  
A. M. Al-Sadi
Keyword(s):  
Coat Protein ◽  
Tomato Leaf ◽  
Transcription Activator ◽  
Sequence Identity ◽  
Sense Strand ◽  
Virion Sense ◽  
Tomato Leaf Curl ◽  
Leaf Curl Disease ◽  
Complementary Sense ◽  
Leaf Curl

Leaf curl disease with severe curling, vein darkening, and vein thickening was observed on papaya plants in a field in Qurayat district of Oman during December 2013. Disease incidence ranged from 50 to 70%, particularly in young papaya plants. The presence of a large population of whiteflies and symptoms observed on papaya plants suggested that the causal agent could be begomoviruses (family Geminiviridae) and associated satellites. Four leaf samples with mild and severe leaf curling were collected from the field. Total nucleic acid extracted from symptomatic and healthy plants using the CTAB method were used as a template to amplify circular DNAs using Φ29 DNA polymerase, and products were digested with restriction enzymes to identify fragments of 2.6 to 2.8 kb typical of geminiviruses. BamHI yielded fragments of ~2.8 and 1.4 kb when the digested products were resolved by electrophoresis on a 1% agarose gel. These fragments were cloned and sequenced using a primer walking strategy in both directions. Sequencing results confirmed the exact sizes of 1,303, 1,358, and 2,765 bp; the sequences were deposited in GenBank under the accession numbers HG969296, HG969297, and HG969260, respectively. BLAST results showed that the first two sequences are Tomato leaf curl betasatellite (ToLCB; isolates Pap-2 and Pap-3) showing 97% sequence identity with a previously reported ToLCB sequence (Accession No. KF229728). Both satellites encode a single gene in the complementary sense strand referred to as βC1, which showed 97% sequence identity to ToLCB (HE800551). The viral sequence (isolate Pap-6) showed four genes in the complementary sense (the replication-associated protein [Rep] gene, the transcription-activator protein [TrAP] gene, the replication-enhancer protein [REn] gene, and the C4 gene) and two genes (pre-coat protein [V2] and coat protein [CP]) in virion-sense (2). BLAST analysis showed 95.2% sequence identity to Tomato leaf curl Albatinah virus (ToLCABV; FJ956700), reported earlier to infect tomato in Oman (3). Amino acid sequence comparison of the four predicted proteins (Rep, TrAP, Ren, and C4) encoded by Pap-6 shared 95, 96, 100, and 100% sequence identity, whereas virion-sense proteins (V1 and V2) shared 99% sequence identity with ToLCABV (FJ956700). According to the recommendations of the International Committee on Taxonomy of Viruses, these results indicate that the virus identified in association with papaya leaf curl disease in Oman is a variant of ToLCABV (1). All infected samples showed the presence of ToLCABV, while no hybridization was observed in healthy control DNA using ToLCABV probe. These findings are indicative of the rapid spread of diseases involving Begomovirus and betasatellites, which often result in increased host range, as is evident from this study. References: (1) C. M. Fauquet et al. Arch. Virol. 148:405, 2003. (2) L. Hanley-Bowdoin et al. Crit. Rev. Plant Sci. 18:71, 1999. (3) A. J. Khan et al. Arch. Virol. 159:445, 2013.

scholarly journals Evidence that Watermelon Leaf Curl Disease in Pakistan Is Associated with Tomato Leaf Curl Virus-India, a Bipartite Begomovirus

Plant Disease ◽  
2000 ◽  
Vol 84 (1) ◽  
pp. 102-102 ◽  
Author(s):  
S. Mansoor ◽  
S. H. Khan ◽  
M. Hussain ◽  
N. Mushtaq ◽  
Y. Zafar ◽  
...  
Keyword(s):  
Southern Hybridization ◽  
Tomato Leaf ◽  
Tomato Leaf Curl Virus ◽  
Virion Sense ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Complementary Sense ◽  
Full Length Clone ◽  
Leaf Curl

Whitefly-transmitted geminiviruses (begomoviruses) have emerged as major constraints on food and fiber crops worldwide, and there are several examples of begomovirus mobilization in previously unknown host plants. Here we report on evidence that leaf curl disease of watermelon in Pakistan is caused by Tomato leaf curl virus-India (TLCV-India). Leaf curl disease of watermelon, characterized by leaf curling and mottling and stunted plant growth, was observed at several locations in the Punjab Province of Pakistan. Symptomatic and asymptomatic leaf samples were collected from three locations, and total DNA was isolated by the cetyltrimethylammoniumbromide method and resolved in agarose gel. A full-length clone of Cotton leaf curl virus DNA A was labeled with [32P]dCTP and used as a general probe in Southern hybridization. The probe detected characteristic geminivirus DNA forms in infected watermelon plants, whereas no signal was detected in asymptomatic plants. The association of a begomovirus was confirmed further by polymerase chain reaction (PCR) amplification with degenerate primers PAL1V and pAR1c (2). Samples were screened for infection by TLCV-India, because of symptom similarity. A full-length clone of DNA B of TLCV-India (1) was labeled with [32P]dCTP by random priming and was used as a specific probe in Southern hybridization. The probe detected geminivirus DNA forms, showing that the disease is associated with TLCV-India. Primers TLCV1 (GAGGTACCAAAACTTGTCGTTTTGATTCGG), in the virion-sense, and TLCV2 (GCCCATGGTTCTTTGCTCGGAGAACAAGAA), in the complementary-sense, were designed based on the sequence of DNA A of TLCV-India. These primers were used in PCR and amplified a product of the expected size from infected plants. Similarly, primers TLCVBC1 (GCGGATCCTTATTCCGTAATTATATCTGCA), in the virion-sense, and TLCV BC2 (CACCATGGCAATAGGAAATGATGGTATGGG), in the complementary-sense, were designed based on the sequence of DNA B of TLCV-India (1). These primers amplified a product of expected size when used in PCR. The results show that watermelon leaf curl disease in Pakistan is associated with TLCV-India. This the first report of detection of a begomovirus in watermelon in Pakistan and the first report of detection of TLCV-India on a plant other than tomato from Southeast Asia. References: (1) M. Padidam et al. J. Gen. Virol. 76:25, 1995. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Sign in / Sign up

Export Citation Format

Share Document