Stress Responses to Tomato Yellow Leaf Curl Virus (TYLCV) Infection of Resistant and Susceptible Tomato Plants are Different

2012 ◽  
Vol s1 (01) ◽  
Author(s):  
Moshe Adi Pfannstiel Jens
Keyword(s):  
Stress Responses ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Susceptible Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Small RNA Profiling of Susceptible and Resistant Ty-1 Encoding Tomato Plants Upon Tomato Yellow Leaf Curl Virus Infection

2021 ◽  
Vol 12 ◽  
Author(s):  
Corien M. Voorburg ◽  
Yuling Bai ◽  
Richard Kormelink
Keyword(s):  
Gene Silencing ◽  
Cytosine Methylation ◽  
Tomato Yellow Leaf ◽  
Transcriptional Gene Silencing ◽  
Viral Gene ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Susceptible Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Ty-1 presents an atypical dominant resistance gene that codes for an RNA-dependent RNA polymerase (RDR) of the gamma class and confers resistance to tomato yellow leaf curl virus (TYLCV) and other geminiviruses. Tomato lines bearing Ty-1 not only produce relatively higher amounts of viral small interfering (vsi)RNAs, but viral DNA also exhibits a higher amount of cytosine methylation. Whether Ty-1 specifically enhances posttranscriptional gene silencing (PTGS), leading to a degradation of RNA target molecules and primarily relying on 21–22 nucleotides (nts) siRNAs, and/or transcriptional gene silencing (TGS), leading to the methylation of cytosines within DNA target sequences and relying on 24-nts siRNAs, was unknown. In this study, small RNAs were isolated from systemically TYLCV-infected leaves of Ty-1 encoding tomato plants and susceptible tomato Moneymaker (MM) and sequence analyzed. While in susceptible tomato plants vsiRNAs of the 21-nt size class were predominant, their amount was drastically reduced in tomato containing Ty-1. The latter, instead, revealed elevated levels of vsiRNAs of the 22- and 24-nt size classes. In addition, the genomic distribution profiles of the vsiRNAs were changed in Ty-1 plants compared with those from susceptible MM. In MM three clear hotspots were seen, but these were less pronounced in Ty-1 plants, likely due to enhanced transitive silencing to neighboring viral genomic sequences. The largest increase in the amount of vsiRNAs was observed in the intergenic region and the V1 viral gene. The results suggest that Ty-1 enhances an antiviral TGS response. Whether the elevated levels of 22 nts vsiRNAs contribute to an enhanced PTGS response or an additional TGS response involving a noncanonical pathway of RNA dependent DNA methylation remains to be investigated.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Virus Recombinant ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whitefly-mediated transmission and subsequent acquisition of highly similar and naturally occurring Tomato yellow leaf curl virus variants

2021 ◽  
Author(s):  
Wendy Marchant ◽  
Saurabh Gautam ◽  
Bhabesh Dutta ◽  
Rajagopalbab Srinivasan
Keyword(s):  
Amino Acids ◽  
Mixed Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Plant Interactions ◽  
Tomato Plants ◽  
Individual Host ◽  
Field Samples ◽  
Leaf Curl Virus ◽  
Leaf Curl

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (“variant #2” and “variant #4”) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants’ concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than variant#2 in tomato plants. Despite differences in variants’ accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly-infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

Interaction between ‘Candidatus Phytoplasma australasiae’ and Tomato yellow leaf curl virus in tomato plants

2020 ◽  
Vol 158 (3) ◽  
pp. 733-744
Author(s):  
Nazanin Ebadi ◽  
Gilda Najafipour ◽  
Mohammad Mehdi Faghihi ◽  
Kavous Ayazpour ◽  
Mohammad Salehi
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Rate of Tomato yellow leaf curl virus Translocation in the Circulative Transmission Pathway of its Vector, the Whitefly Bemisia tabaci

2001 ◽  
Vol 91 (2) ◽  
pp. 188-196 ◽  
Author(s):  
Murad Ghanim ◽  
Shai Morin ◽  
Henryk Czosnek
Keyword(s):  
Salivary Glands ◽  
Bemisia Tabaci ◽  
Virus Genome ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Hemolymph Sample ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whiteflies (Bemisia tabaci, biotype B) were able to transmit Tomato yellow leaf curl virus (TYLCV) 8 h after they were caged with infected tomato plants. The spread of TYLCV during this latent period was followed in organs thought to be involved in the translocation of the virus in B. tabaci. After increasing acquisition access periods (AAPs) on infected tomato plants, the stylets, the head, the midgut, a hemolymph sample, and the salivary glands dissected from individual insects were subjected to polymerase chain reaction (PCR) without any treatment; the presence of TYLCV was assessed with virus-specific primers. TYLCV DNA was first detected in the head of B. tabaci after a 10-min AAP. The virus was present in the midgut after 40 min and was first detected in the hemolymph after 90 min. TYLCV was found in the salivary glands 5.5 h after it was first detected in the hemolymph. Subjecting the insect organs to immunocapture-PCR showed that the virus capsid protein was in the insect organs at the same time as the virus genome, suggesting that at least some TYLCV translocates as virions. Although females are more efficient as vectors than males, TYLCV was detected in the salivary glands of males and of females after approximately the same AAP.

scholarly journals Host GRXC6 restricts Tomato yellow leaf curl virus infection by inhibiting the nuclear export of the V2 protein

2021 ◽  
Vol 17 (8) ◽  
pp. e1009844
Author(s):  
Wenhao Zhao ◽  
Yijun Zhou ◽  
Xueping Zhou ◽  
Xiaofeng Wang ◽  
Yinghua Ji
Keyword(s):  
Plant Growth ◽  
Stress Responses ◽  
Nuclear Export ◽  
Genomic Dna ◽  
Thioredoxin Reductase ◽  
Tomato Yellow Leaf ◽  
Nuclear Accumulation ◽  
Yellow Leaf ◽  
Leaf Curl Virus ◽  
Leaf Curl

Geminiviruses cause serious symptoms and devastating losses in crop plants. With a circular, single-stranded DNA genome, geminiviruses multiply their genomic DNA in the nucleus, requiring the nuclear shuttling of viral proteins and viral genomic DNAs. Many host factors, acting as proviral or antiviral factors, play key roles in geminivirus infections. Here, we report the roles of a tomato glutaredoxin (GRX), SlGRXC6, in the infection of Tomato yellow leaf curl virus (TYLCV), a single-component geminivirus. The V2 protein of TYLCV specifically and preferentially interacts with SlGRXC6 among the 55-member tomato GRX family that are broadly involved in oxidative stress responses, plant development, and pathogen responses. We show that overexpressed SlGRXC6 increases the nuclear accumulation of V2 by inhibiting its nuclear export and, in turn, inhibits trafficking of the V1 protein and viral genomic DNA. Conversely, the silenced expression of SlGRXC6 leads to an enhanced susceptibility to TYLCV. SlGRXC6 is also involved in symptom development as we observed a positive correlation where overexpression of SlGRXC6 promotes while knockdown of SlGRXC6 expression inhibits plant growth. We further showed that SlGRXC6 works with SlNTRC80, a tomato NADPH-dependent thioredoxin reductase, to regulate plant growth. V2 didn’t interact with SlNTRC80 but competed with SlNTR80 for binding to SlGRXC6, suggesting that the V2-disrupted SlGRXC6-SlNTRC80 interaction is partially responsible for the virus-caused symptoms. These results suggest that SlGRXC6 functions as a host restriction factor that inhibits the nuclear trafficking of viral components and point out a new way to control TYLCV infection by targeting the V2-SlGRXC6 interaction.

scholarly journals Tomato curly stunt virus, a New Begomovirus of Tomato Within the Tomato yellow leaf curl virus-IS Cluster in South Africa

Plant Disease ◽  
2000 ◽  
Vol 84 (7) ◽  
pp. 810-810 ◽  
Author(s):  
G. Pietersen ◽  
A. M. Idris ◽  
K. Krüger ◽  
J. K. Brown
Keyword(s):  
South Africa ◽  
Sequence Analysis ◽  
Mosaic Virus ◽  
Tomato Yellow Leaf ◽  
African Cassava Mosaic Virus ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Leaf Curl Virus ◽  
Cassava Mosaic Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) causes a serious disease of tomato in many countries throughout the world. Preliminary reports suggested that TYLC disease was present in 1997 in South Africa. In 1998 140 ha of tomato fields in the Onderberg area were assessed for possible presence of TYLCV. Symptoms like those caused by TYLCV isolates in Israel were observed in most fields, and disease incidence ranged from <1 to 50%. Yield losses in individual plants ranged from negligible to 100% and appeared related to the age of the plants at time of infection. Two isolates of the suspect virus were experimentally transmitted from symptomatic tomato to virus-free, glasshouse-grown tomato seedlings by colony. Field and colony whiteflies were identified as the Bemisia tabaci based on mt COI sequence analysis (1). Attempts to transmit the suspect begomovirus by sap inoculation between tomato plants were unsuccessful. Polymerase chain reaction (PCR) amplification with degenerate PCR primers (2) that permit detection of the coat protein gene (AV1) and the common region (CR) of other begomoviruses yielded an amplicon of the expected size (2,100 bp), suggesting begomovirus association with diseased tomato plants. Nucleotide (nt) sequence analysis of AV1 for both tomato isolate AF261885 indicated that they were indistinguishable and shared less than 78% sequence identity with other well-studied begomoviruses, indicating a distinct, previously undescribed begomovirus species. AV1 sequence comparisons also revealed that its closest relatives were members of the TYLCV cluster, which includes South African cassava mosaic virus (77.4%) (AF11785), East African cassava mosaic virus (77.3%) (AJ006459), and TYLCV-IS (76.2%) (X15656). The theoretical Rep binding element in the CR, TCGGT, was identical to TYLCV-IS and Cotton leaf curl virus-Pakistan (AJ002448) (AJ002449). Here, we provisionally designate this new tomato-infecting begomoviral species, Tomato curly stunt virus from South Africa (ToCSV-SA). References: (1) D. R. Frohlich et al. Mol. Ecol. 8:1683, 1999. (2) A. M. Idris and J. K. Brown. Phytopathology 88:648, 1998.

Sign in / Sign up

Export Citation Format

Share Document