Molecular and Morphological Data Confirmed First Record of Abbreviata kazakhstanica Markov and Paraskiv, 1956 (Spirurida: Physalopteridea) in Iran

Background: The genus Abbreviata (Spirurida: Physalopteridea) currently contains 47 species. Physalopteridae nematodes infect a large number of vertebrates, including mammals, birds, reptiles and amphibians. The current study is a report of the first morphological and molecular identification of A. kazakhstanica (Spirurida: Physalopteridea) in Pseudopus apodus in Iran. Methods: Eleven road-killed P. apodus, were collected from, Iran during 2016-2018. The nematodes were isolated from stomach. After morphological study, the genomic DNA of the parasites was extracted using CTAB method. The DNA was used for PCR amplification of cytochrome c oxidase subunit I (cox1). The PCR products were sequenced, the sequence data were analyzed and multiple alignments were conducted using the Clustal Omega. Results: After detailed microscopic examination, the A. kazakhstanica was identified. The cox1 sequences confirmed the species of helminth. The new sequences of A. kazakhstanica were submitted to GenBank under the accession number MK578751-2. Conclusion: Regarding the limited data on parasitological status of Iranian reptiles, more specific and comprehensive investigations are needed to identify the parasitic fauna.

COMPARAÇÃO FÍSICO-QUÍMICA E ESTRUTURAL DO PRECURSOR 11S DE GLOBULINA ENTRE HELIANTHUS ANNUUS L. E HELIANTHUS ARGOPHYLLUS TORR. & GRAY

Introdução: O girassol é uma planta cultivada no mundo todo e possui grande interesse comercial por suas características estéticas e nutricionais, sendo uma das oleaginosas mais comercializadas mundialmente para fins comestíveis e de biocombustível. Objetivo: Este trabalho teve como objetivo comparar dois precursores da proteína globulina 11S – que é uma proteína importante para o armazenamento vegetal – em níveis físico-químicos e estruturais de duas espécies do gênero Helianthus com a intenção de encontrar possíveis diferenças entre estes precursores, e inferir possível influência em que leva uma espécie a ter fins do uso do seu óleo e a outra para usos ornamentais, com baixa produção de óleo. Materiais e Métodos: Para realizar esta comparação foram utilizadas as ferramentas de bioinformática BLAST no servidor do National Center for Biotechnology Information (NCBI) para comparar as sequências das proteínas das duas espécies, sendo também utilizado o programa Clustal Ômega para que fosse feita a seleção da melhor sequência de H. annuus (L.); para a comparação da estrutura das proteínas inicialmente foi feita a modelagem no Swiss-Model e comparadas as estruturas no software PyMol. Resultados: As sequências apresentaram 96% de identidade, considerando os 2% de gaps, o escore do alinhamento foi de 671 bits, ao total apresentaram a conservação de 4 domínios de grupos fortes e 1 conservação de um domínio de grupos fracos, além das conservações completas do resto da sequência. Com isso, a sobreposição estrutural demonstrou que a área típica desta família de proteínas, a do barril característico das proteínas Cupin, prevaleceu conservada. A proteína de H. annus (L.) apresentou maior peso molecular, maior PI teórico e maior quantidade de resíduos com cargas negativas, contabilizando 32 peptídeos de aspartato e glutamato responsáveis por estas cargas. As variações notadas foram mínimas nas biomoléculas, porém ainda assim possuem os principais domínios quase que completamente conservados demonstrando que a baixa variação pode ocorrer devido à proximidade evolutiva das duas espécies. Conclusão: Logo, pode-se inferir que os precursores parciais 11S da globulina não seriam os principais agentes responsáveis para que H. annuus (L.) seja preferível para extração de seu óleo em comparação com H. agrophyllus Torr. & Gray.

Cargas virales en pacientes trasplantados y genotipificación de Citomegalovirus

Objetivo: Determinar el curso de infecciones virales por un periodo de un año, mediante la medición de la carga viral de Adenovirus, virus BK, virus Epstein-Barr, Citomegalovirus y Herpesvirus humano 6, en 30 pacientes del Hospital San Juan de Dios, sometidos a trasplante de riñón o células progenitoras hematopoyéticas. Métodos: Se determinaron las cargas virales en diez muestras de sangre por paciente: una muestra pretransplante, ocho muestras obtenidas cada dos semanas postrasplante y una última muestra a los seis meses posteriores al trasplante. La cuantificación de los virus se realizó por reacción en cadena de la polimerasa en tiempo real y, solo en el caso del Adenovirus, por reacción en cadena de la polimerasa de punto final. También se determinaron los genotipos de Citomegalovirus en los pacientes positivos para este virus, utilizando una reacción en cadena de la polimerasa dirigida al gen de la glicoproteína B y secuenciación de los fragmentos amplificados. Las secuencias obtenidas fueron comparadas y alineadas con una secuencia de referencia, utilizando el programa Clustal Omega. Resultados: Al 77 % de los pacientes se les detectó al menos uno de los cinco virus analizados y el virus con mayor prevalencia fue el Citomegalovirus, con un 57% de positividad del total de la población. El genotipo de Citomegalovirus que más se detectó fue el genotipo 3. Se monitoreó el comportamiento de las cargas virales para cada virus analizado y la proporción de su incidencia entre pacientes masculinos y femeninos. Conclusiones: La cuantificación y caracterización de virus en pacientes de trasplante, permite un mejor manejo clínico del paciente con infecciones oportunistas y también un manejo más adecuado de las terapias farmacológicas.

An Insight into the Proofreading Functions of Multisubunit DNA-Dependent RNA Polymerases and Their Catalytic Mechanism

Aim: To analyze the active sites of the proofreading (PR) functions in the multisubunit DNA-dependent RNA polymerases (MSU RNAPs) from prokaryotes, chloroplasts and eukaryotes, and propose a plausible unified catalytic mechanism for these enzymes. Study Design: Data collected on these enzymes from bioinformatics, biochemical, site-directed mutagenesis (SDM), X-ray crystallography and cryo-electron microscopy (cryo-EM) were used for the analyses. Methodology: The protein sequence data of MSU RNAPs from prokaryotes, prokaryotic-types (plant chloroplasts) and eukaryotes were obtained from PUBMED and SWISS-PROT databases. The advanced version of Clustal Omega was used for protein sequence analysis. Along with the conserved motifs identified by the bioinformatics analysis, the data already available from biochemical and SDM experiments, and X-ray crystallographic and cryo-EM data on these enzymes are also used to confirm the possible amino acids involved in the active site of the PR function in these MSU RNAPs Results: All the seven types of MSU RNAPs (I-VII) reported from prokaryotes to eukaryotes were analyzed by the multiple sequence alignment (MSA) software, Clustal Omega, to find out conservations among them. The MSA analysis showed many conserved amino acid motifs including small and large peptide regions from the MSU RNAPs of prokaryotes, eukaryotes and plant chloroplasts. Interestingly, the catalytic amino acid and template-binding pairs are highly conserved in all these polymerases, with a few exceptions. Most of them use a basic amino acid (R/K/H) for initiating catalysis and an -YG/FG- pair for template-binding. Some odd type of catalytic amino acids and template-binding pairs are observed in human pathogens, parasites and organisms which cannot ferment sugars. In all the MSU RNAPs, the proposed polymerase catalytic region also possessed three invariant Cs and an invariant H within it. The invariant Cs is shown to bind a zinc atom and proposed to involve in the PR function by excising any misincorporated nucleotide during the transcription process. In the plant-specific MSU RNAPs IV and V, which involve in transcriptional gene silencing in plants, the catalytic and template-binding pairs do not follow the regular distance conservations as observed with other five of the MSU RNAPs. Their polymerase/PR active site regions are similar to RNAP III rather than to RNAP II, as all three make only low molecular weight RNAs. Conclusions: All the known MSU RNAPs possess three invariant Cs and an invariant H embedded within the polymerase active site itself. The three invariant Cs are shown to bind a zinc atom and the invariant H could act as the proton acceptor from a metal-bound water molecule, for initiating excision of the mismatches by a Zn-mediated hydrolysis. Thus, the PR function in MSU RNAPs is integrated within the polymerase active site itself, which is in sharp contrast to the PR functions reported in DNA-dependent DNA polymerases and RNA-dependent RNA polymerases. Therefore, all the seven MSU RNAPs from prokaryotes and eukaryotes are proposed to follow a unified mechanism to excise the mismatches during transcription. The discovery of intrinsic self-correcting RNA transcription mechanism fulfils the missing link in molecular evolution.

CONFECÇÃO DE PRIMERS PARA O GENE DA METALOPROTEINASE - 2 (MMP-2) PARA REALIZAÇÃO DE METODOLOGIA DE PCR EM TEMPO REAL

Introdução: O câncer de mama (CM) é o segundo tipo de câncer mais frequente entre as mulheres, sendo responsável por 66.280 novos casos no ano passado. Biomarcadores são parâmetros biológicos que refletem desequilíbrios moleculares provenientes de patologias, colaborando com exames laboratoriais. A metaloproteinase de matriz 2 (MMP-2) é uma enzima que digere a matriz extracelular e responde à alterações moleculares, sendo que em células cancerígenas sua expressão é aumentada. Sua presença no soro e tecido de pacientes com câncer mamário pode indicar invasão tumoral. Objetivos: Confeccionar primers para detecção da expressão de MMP-2 em linhagem de células tumorais de mama. Materiais e métodos: A partir de levantamento bibliográfico no GenBank do gene da MMP-2 humana foram confeccionados primers para a realização da metodologia de PCR em tempo real. Os softwares IDT e Primer 3 foram os escolhidos para confecção dos primers forward e reverse. Após a confecção, os primers foram avaliados quanto aos parâmetros de reação e afinidade pelo gene alvo utilizando as plataformas Clustal Omega, IDT Tools e BLAST, para obtenção do melhor par de primers. Resultados: Foram confeccionados 5 pares de primers para MMP-2 e, após avaliação, foi selecionado o par de primers a seguir: GCAGCTCCTTACCAACCAGT e GGGGAGAGAGGGAAGGATGT. Conclusão: A etapa de confecção de primers é importante, pois a simulação em computador muitas vezes acaba se demonstrando diferente da reação in vitro. Portanto, quanto mais rigor na avaliação dos parâmetros de reação, maior chance de se obter um par de primers que apresente bom desempenho nas reações, poupando perda de tempo e de reagentes. A partir da confecção dos primers realizada neste trabalho, espera-se que os mesmo apresentem sensibilidade e especificidade suficientes para garantir que o produto formado durante a amplificação seja realmente a sequência esperada, confirmando que a etapa de confecção foi conduzida adequadamente.

Performance and scaling behavior of bioinformatic applications in virtualization environments to create awareness for the efficient use of compute resources

The large amount of biological data available in the current times, makes it necessary to use tools and applications based on sophisticated and efficient algorithms, developed in the area of bioinformatics. Further, access to high performance computing resources is necessary, to achieve results in reasonable time. To speed up applications and utilize available compute resources as efficient as possible, software developers make use of parallelization mechanisms, like multithreading. Many of the available tools in bioinformatics offer multithreading capabilities, but more compute power is not always helpful. In this study we investigated the behavior of well-known applications in bioinformatics, regarding their performance in the terms of scaling, different virtual environments and different datasets with our benchmarking tool suite BOOTABLE. The tool suite includes the tools BBMap, Bowtie2, BWA, Velvet, IDBA, SPAdes, Clustal Omega, MAFFT, SINA and GROMACS. In addition we added an application using the machine learning framework TensorFlow. Machine learning is not directly part of bioinformatics but applied to many biological problems, especially in the context of medical images (X-ray photographs). The mentioned tools have been analyzed in two different virtual environments, a virtual machine environment based on the OpenStack cloud software and in a Docker environment. The gained performance values were compared to a bare-metal setup and among each other. The study reveals, that the used virtual environments produce an overhead in the range of seven to twenty-five percent compared to the bare-metal environment. The scaling measurements showed, that some of the analyzed tools do not benefit from using larger amounts of computing resources, whereas others showed an almost linear scaling behavior. The findings of this study have been generalized as far as possible and should help users to find the best amount of resources for their analysis. Further, the results provide valuable information for resource providers to handle their resources as efficiently as possible and raise the user community’s awareness of the efficient usage of computing resources.

MUSCLE v5 enables improved estimates of phylogenetic tree confidence by ensemble bootstrapping

Phylogenetic tree confidence is often estimated from a multiple sequence alignment (MSA) using the Felsenstein bootstrap heuristic. However, this does not account for systematic errors in the MSA, which may cause substantial bias to the inferred phylogeny. Here, I describe the MSA ensemble bootstrap, a new procedure which generates a set of replicate MSAs by varying parameters such as gap penalties and substitution scores. Such an ensemble is called diagnostic if the typical distance between MSAs is comparable to the error rate. Confidence in a prediction derived from an MSA, e.g. a monophyletic clade, is expressed as the fraction of the ensemble where the prediction is reproduced. This approach is implemented in MUSCLE by modifying the Probcons algorithm, which is based on a hidden Markov model (HMM). An ensemble is generated by perturbing HMM parameters and permuting the guide tree. Ensembles generated by this method are shown to be diagnostic on the Balibase benchmark. To enable scaling to large datasets, divide-and-conquer heuristics are introduced. A new benchmark (Balifam) is described with 36 sets of 10000+ proteins. On Balifam, ensembles generated by MUSCLE are shown to align an average of 59% of columns correctly, 13% better than Clustal-omega (52% correct) and 26% better than MAFFT (47% correct). The ensemble bootstrap is applied to a previously published tree of RNA viruses, showing that the high reported Felsenstein bootstrap confidence of Ribovirus phylum branching order is an artifact of systematic MSA errors.

Prospecção in silico de enzimas do complexo ligninocelulolítico em bacillus thuringiensis

A busca por fontes de energia alternativa avançam a medida que a disponibilidade de recursos petróleo dependentes diminuem. As biomassas são matrizes orgânicas capazes de serem convertidas em energia. Bactérias do gênero Bacillus spp. são produtoras de enzimas do complexo ligninocelulolítico e apresentam grande potencial de uso na produção de biocombustíveis. Algumas espécies do gênero ainda carecem de maiores investigações na busca destas enzimas, como é o caso do Bacillus thuringiensis. Portanto, o objetivo do presente trabalho é identificar e descrever a presença de enzimas do complexo ligninocelulolítico em B. thuringiensis. Os proteomas das bactérias utilizadas no estudo foram coletados no banco de dados NCBI e os dados foram pré tratados utilizando linguagem de programação Python. Um script em VBA foi escrito para semi automatizar a procura das enzimas desejadas nos proteomas das bactérias via interface gráfica Excel. Por fim, foi utilizado o programa Clustal Omega para construção de árvore filogenética das espécies coletadas. Foram encontradas 4 diferentes enzimas no proteoma de B. Thuringiensis: 6phospho β glucosidase, ɑ glucosidase, ɑ amilase e laccase. Todas estas com potencial de degradação de biomassa, principalmente amido e lignina. Ao analisar outras espécies do gênero, foi indentificado um maior número e diversidade de enzimas do complexo ligninocelulolítico principalmente em B. amyloliquefaciens, B. licheniformis, B. velezensis e B. subtilis. Conclui se que apesar de B. thuringiensis apresentar um potencial na degradação de biomassa, outras espécies do gênero podem ser mais eficientes em aplicações reais. Esses achados ampliam o potencial biotecnológico de B. thuringiensis, antes restrito à produção de bioinseticidas e plantas resistentes à praga.

Altered N-/O-Glycosylation Sites On The Receptor-Binding Domain (RBD) in COVID-19 Are Related To Coronavirus Infection And Pathogenesis.

Objective: To discuss the possible significances of N-Linked and O-Linked glycosylation on the RBD of COVID-19Methods: Amino acid sequences multiple alignments of RBD used Clustal Omega (v.1.2.4) using default parameters. Prediction of potential N-linked glycosylation sites by NetNGlyc 1.0 server. Prediction of potential O-linked glycosylation sites by NetOGlyc 4.0 Server.Result: COVID-19 Spike glycoprotein has 22 potential N-linked glycosylation sites and 3 O-linked glycosylation sites. 2 of 22 N-linked glycosylation sites distributed in RBD. None of the 3 O-linked glycosylation sites distributed in RBD, which is markedly different from SARS and other bat coronavirus using ACE2 as a receptor. Comparing with its close coronavirus, but which can’t use ACE2 as a receptor, the COVID-19 has little N- and O-linked glycosylation sites.Conclusion: we show the obvious differences in glycosylation sites in RBD between COVID-19 and other coronaviruses. We speculate that altered N-/O-glycosylation sites on RBD in COVID-19 are related to its infection and pathogenesis.

A distinct molecular signature on anhydrobiotic cyanobacterial metallothioneins

Anhydrobiosis refers to a state of suspended animation in which some organisms enter when exposed to extreme desiccation, ensuring them an outstanding tolerance to several physical stresses due to molecular and cellular adaptations. Metallothioneins (MTs) are short cysteine-rich metal-chelating proteins that work as a cellular protection element in metal ion-rich conditions. Here we aimed to investigate possible molecular signatures in primary and tertiary structures in anhydrobiotic cyanobacterial MTs. Anhydrobiotic and non-anhydrobiotic cyanobacterial MT amino acid sequences were retrieved from NCBI database and aligned in Clustal Omega server. Additionally, the amino acid compositions of these sequences were determined by GeneRunner. Further, we carried out homology-modeling via SWISS-MODEL, structural superposition in UCSF Chimera 1.4 Matchmaker tool and ligand-binding site prediction via COFACTOR. In silico analyses revealed specific divergences in amino acid positions between MT groups, evidencing positive and negative selections, however without affecting final protein structures. Some of these changes on polypeptide sequence potentially enhance protein stabilization during desiccation, whereas others possibly act as additional metal-ion coordinating residues. Analyses on the molecular adaptations on anhydrobiotic cyanobacterial MTs help shed light on their molecular functions and biological roles, as well as may have applications on the development of desiccation- and metal-tolerant organisms.