An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

2012 ◽  
Vol 89 (6) ◽  
pp. 784-790 ◽  
Author(s):  
Kelly M. Elkins ◽  
Raelynn E. Kadunc
Keyword(s):  
Molecular Biology ◽  
Laboratory Experiment ◽  
Forensic Science ◽  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Human Dna ◽  
Undergraduate Laboratory ◽  
Sybr Green Detection ◽  
Upper Level

scholarly journals Role of Laboratory Medicine in SARS-CoV-2 Diagnostics. Lessons Learned from a Pandemic

Healthcare ◽  
2021 ◽  
Vol 9 (7) ◽  
pp. 915
Author(s):  
Irena Duś-Ilnicka ◽  
Aleksander Szymczak ◽  
Małgorzata Małodobra-Mazur ◽  
Miron Tokarski
Keyword(s):  
Molecular Biology ◽  
Real Time ◽  
Real Time Pcr ◽  
Laboratory Medicine ◽  
Lessons Learned ◽  
Diagnostic Methods ◽  
Medical Community ◽  
Medical Diagnostic ◽  
Novel Coronavirus ◽  
Available Information

Since the 2019 novel coronavirus outbreak began in Wuhan, China, diagnostic methods in the field of molecular biology have been developing faster than ever under the vigilant eye of world’s research community. Unfortunately, the medical community was not prepared for testing such large volumes or ranges of biological materials, whether blood samples for antibody immunological testing, or salivary/swab samples for real-time PCR. For this reason, many medical diagnostic laboratories have made the switch to working in the field of molecular biology, and research undertaken to speed up the flow of samples through laboratory. The aim of this narrative review is to evaluate the current literature on laboratory techniques for the diagnosis of SARS-CoV-2 infection available on pubmed.gov, Google Scholar, and according to the writers’ knowledge and experience of the laboratory medicine. It assesses the available information in the field of molecular biology by comparing real-time PCR, LAMP technique, RNA sequencing, and immunological diagnostics, and examines the newest techniques along with their limitations for use in SARS-CoV-2 diagnostics.

Quantification of human DNA by real-time PCR in forensic casework

2006 ◽  
Vol 1288 ◽  
pp. 750-752 ◽  
Author(s):  
U. Ricci ◽  
C. Marchi ◽  
C. Previderè ◽  
P. Fattorini
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Forensic Casework ◽  
Human Dna

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

scholarly journals Primers designed for the detection of grapevine pathogens spreading with propagating material by quantitative real-time PCR

2015 ◽  
Vol 21 (1-2) ◽  
Author(s):  
N. Czotter ◽  
E. Manduláné Farkas ◽  
R. Lózsa ◽  
I. Ember ◽  
G. Szûcsné Varga ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Molecular Techniques ◽  
Latent Infections ◽  
Quantitative Real Time Pcr ◽  
Detection And Identification

Several grapevine pathogens are disseminated by propagating material as systemic, but latent infections. Their detection and identification have a basic importance in the production and handling of propagating stocks. Thus several sensitive and reliable diagnostic protocols mostly based on molecular techniques have been developed. Of these methods quantitative real-time PCR (q-PCR) has recently got an emerging importance. Here we collected primer data for the detection and identification of grapevine pathogens which are important in the production of propagating stocks by q-PCR. Additional novel techniques that use DNA amplification, hybridization and  sequencing are also briefly reviewed.

Immunomagnetic Capture of Big Six Shiga Toxin–Producing Escherichia coli Strains in Apple Juice with Detection by Multiplex Real-Time PCR Eliminates Interference from the Food Matrix

2019 ◽  
Vol 82 (9) ◽  
pp. 1512-1523
Author(s):  
ODBERT A. TRIPLETT ◽  
JIEKUN XUAN ◽  
STEVEN FOLEY ◽  
RAJESH NAYAK ◽  
WILLIAM H. TOLLESON
Keyword(s):  
Escherichia Coli ◽  
Real Time ◽  
Internal Control ◽  
Shiga Toxin ◽  
Real Time Pcr ◽  
Apple Juice ◽  
Dna Amplification ◽  
Probability Of Detection ◽  
Solid Agar ◽  
Big Six

ABSTRACT Having reliable methods for detecting Shiga toxin–producing Escherichia coli (STEC) in foods is an important food safety goal. The majority of STEC outbreaks have involved either the O157:H7 serotype or one of six non-O157 serogroups, O26, O45, O103, O111, O121, and O145, termed “The Big Six.” We have compared detection by PCR of the Shiga toxin genes stx1a and stx2a from STEC bacteria isolated from unclarified apple juice by simple centrifugation with the use of an immunocapture technique to minimize contaminants (such as pectin and polyphenols that may copurify with DNA) that may interfere with DNA amplification efficiencies and limit sensitivity. An internal control for successful immunocapture, DNA extraction, and PCR amplification was generated by introducing the pmRaspberry plasmid into an stx null strain, yielding an E. coli O45 pmRaspberry derivative that can be added to food samples directly. Using serial dilutions of a representative Big Six STEC in apple juice, our immunocapture method resulted in a 50% probability of detection value of 3.34, 2.25, and 4.25 CFU for detection by multiplex real-time PCR, growth on solid agar, and multiplex endpoint PCR, respectively. The time to result was 6.5 h, 9.5 h, and 1.5 days for immunocapture of Big Six STECs and detection by multiplex real-time PCR, endpoint PCR, and growth on solid agar, respectively. A set of 52 Big Six STEC isolates and 30 non–Big Six STEC strains was used to establish the inclusivity and exclusivity of the method. Finally, the ability to detect Big Six STEC contamination reliably was confirmed at 4.5 and 45 CFU/25-mL portions of refrigerated apple juice.

Selective quantification of human DNA by real-time PCR of FOXP2

2012 ◽  
Vol 6 (4) ◽  
pp. 447-451 ◽  
Author(s):  
Mikiko Soejima ◽  
Kenichi Hiroshige ◽  
Joji Yoshimoto ◽  
Yoshiro Koda
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Human Dna

Development and usage of a NIST standard reference material for real time PCR quantitation of human DNA

2008 ◽  
Vol 1 (1) ◽  
pp. 80-82 ◽  
Author(s):  
P.M. Vallone ◽  
M.C. Kline ◽  
D.L. Duewer ◽  
A.E. Decker ◽  
J.W. Redman ◽  
...  
Keyword(s):  
Reference Material ◽  
Real Time ◽  
Standard Reference Material ◽  
Real Time Pcr ◽  
Human Dna ◽  
Nist Standard Reference Material
Sign in / Sign up

Export Citation Format

Share Document