In silico assessment of dehalogenase from Bacillus thuringiensis H2 in relation to its salinity-stability and pollutants degradation

2021 ◽  
pp. 1-15
Author(s):  
Habeebat Adekilekun Oyewusi ◽  
Fahrul Huyop ◽  
Roswanira Abdul Wahab ◽  
Azzmer Azzar Abdul Hamid
Keyword(s):  
Bacillus Thuringiensis ◽  
In Silico

Localization and in silico study of the vegetative insecticidal proteins Vip2S-Vip1S of Bacillus thuringiensis

2016 ◽  
Vol 91 ◽  
pp. 510-517
Author(s):  
Sameh Sellami ◽  
Sonia Jemli ◽  
Nouha Abdelmalek ◽  
Emna Dabbéche ◽  
Kaïs Jamoussi
Keyword(s):  
Bacillus Thuringiensis ◽  
In Silico ◽  
Insecticidal Proteins ◽  
In Silico Study

scholarly journals Prospecção in silico de enzimas do complexo ligninocelulolítico em bacillus thuringiensis

2021 ◽  
Author(s):  
Dimitri Sokolowskei ◽  
Edvar Carneiro Da Silva Junior ◽  
Paulo Roberto Martins Queiroz
Keyword(s):  
Bacillus Thuringiensis ◽  
In Silico ◽  
Bacillus Spp ◽  
Clustal Omega

A busca por fontes de energia alternativa avançam a medida que a disponibilidade de recursos petróleo dependentes diminuem. As biomassas são matrizes orgânicas capazes de serem convertidas em energia. Bactérias do gênero Bacillus spp. são produtoras de enzimas do complexo ligninocelulolítico e apresentam grande potencial de uso na produção de biocombustíveis. Algumas espécies do gênero ainda carecem de maiores investigações na busca destas enzimas, como é o caso do Bacillus thuringiensis. Portanto, o objetivo do presente trabalho é identificar e descrever a presença de enzimas do complexo ligninocelulolítico em B. thuringiensis. Os proteomas das bactérias utilizadas no estudo foram coletados no banco de dados NCBI e os dados foram pré tratados utilizando linguagem de programação Python. Um script em VBA foi escrito para semi automatizar a procura das enzimas desejadas nos proteomas das bactérias via interface gráfica Excel. Por fim, foi utilizado o programa Clustal Omega para construção de árvore filogenética das espécies coletadas. Foram encontradas 4 diferentes enzimas no proteoma de B. Thuringiensis: 6phospho β glucosidase, ɑ glucosidase, ɑ amilase e laccase. Todas estas com potencial de degradação de biomassa, principalmente amido e lignina. Ao analisar outras espécies do gênero, foi indentificado um maior número e diversidade de enzimas do complexo ligninocelulolítico principalmente em B. amyloliquefaciens, B. licheniformis, B. velezensis e B. subtilis. Conclui se que apesar de B. thuringiensis apresentar um potencial na degradação de biomassa, outras espécies do gênero podem ser mais eficientes em aplicações reais. Esses achados ampliam o potencial biotecnológico de B. thuringiensis, antes restrito à produção de bioinseticidas e plantas resistentes à praga.

Biochemical, molecular and in silico characterization of arsenate reductase from Bacillus thuringiensis KPWP1 tolerant to salt, arsenic and a wide range of pH

2021 ◽  
Vol 204 (1) ◽  
Author(s):  
Paromita Banerjee ◽  
Ananya Chatterjee ◽  
Sushmita Jha ◽  
Nirbhay K. Bhadani ◽  
Partha P. Datta ◽  
...  
Keyword(s):  
Bacillus Thuringiensis ◽  
In Silico ◽  
Arsenate Reductase ◽  
Wide Range ◽  
In Silico Characterization

scholarly journals Experimental evolution in silico: a custom-designed mathematical model for virulence evolution of Bacillus thuringiensis

Zoology ◽  
2016 ◽  
Vol 119 (4) ◽  
pp. 359-365 ◽  
Author(s):  
Jakob Friedrich Strauß ◽  
Philip Crain ◽  
Hinrich Schulenburg ◽  
Arndt Telschow
Keyword(s):  
Mathematical Model ◽  
Bacillus Thuringiensis ◽  
Experimental Evolution ◽  
In Silico ◽  
Virulence Evolution

scholarly journals Genomic exploration of Bacillus thuringiensis MORWBS1.1 - candidate biocontrol agent, predicts genes for biosynthesis of zwittermicin, 4,5-DOPA dioxygenase extradiol, and quercetin 2,3-dioxygenase

2021 ◽  
Author(s):  
Adetomiwa A Adeniji ◽  
Ayansina Segun Ayangbenro ◽  
Olubukola Oluranti Babalola
Keyword(s):  
South Africa ◽  
Bacillus Thuringiensis ◽  
Genome Sequencing ◽  
In Silico ◽  
Biocontrol Agent ◽  
Biotechnological Applications ◽  
In Vitro Evaluation ◽  
Thuringiensis Strain

Many strains from the Bacillus thuringiensis spp. are known for their genomic robustness and antimicrobial potentials. As a result, the quest for their biotechnological applications especially in the agroindustry (e.g. as biopesticides) has increased over the years. This study documents the genome sequencing and probing of a Fusarium antagonist (B. thuringiensis strain - MORWBS1.1) with possible biopesticidal metabolite producing capacity from South Africa. Based on in vitro evaluation and in silico antiSMASH investigation, B. thuringiensis strain - MORWBS1.1 exhibited distinctive genomic properties that could be further exploited.

scholarly journals In-Silico Analysis for cryI Gene Amplification from Bacillus thuringiensis

BIOEDUKASI ◽  
2020 ◽  
pp. 8
Author(s):  
Febriana Dwi Wahyuni ◽  
Henny Saraswati ◽  
Kartika Sari Dewi
Keyword(s):  
Bacillus Thuringiensis ◽  
Gene Amplification ◽  
In Silico ◽  
In Silico Analysis ◽  
Control Agent ◽  
Gene Encoding ◽  
Pcr Product ◽  
Microbiological Control ◽  
Reverse Primer ◽  
Silico Analysis

Abstract Bacillus thuringiensis is one type of bacteria that has been used as a microbiological control agent for pests and a vector of plant disease. The presence of Cry proteins inside the B. thuringiensis can be acted as a specific insect repellent that only toxic to certain insects. The CryI protein is toxic to Lepidoptera insects which can attack various types of plants. Polymerase Chain Reaction (PCR) is a common method that can be used to amplify the gene encoding CryI proteins from B. thuringiensis. This research aimed to design a good primer candidate for cryI gene amplification from B. thuringiensis. In silico analysis for designing cryI primer was carried out using some software, such as BLAST for searching cryI gene sequence, Bioedit for sequences alignment, and DINAmelt for analyzing dimer structure of primers. Ten primer candidates were successfully obtained based on the result of the primer3 software. A pair of primer was selected to amplify the cryI gene, with forward primer 5’- CGGTGAATGCCCTGTTTACT -3’ and reverse primer 5’-CGGTCTGGTTGCCTATTGAT -3’. Amplification of the cryI gene by PCR method using selected primer resulting in a PCR product with a length of approximately 200 bp.

PROSPECÇÃO IN SILICO DE ENZIMAS DO COMPLEXO LIGNINOCELULOLÍTICO EM BACILLUS THURINGIENSIS

2021 ◽  
pp. 34-49
Author(s):  
Dimitri Sokolowskei ◽  
Edvar Carneiro Silva Junior ◽  
Paulo Roberto Martins Queiroz
Keyword(s):  
Bacillus Thuringiensis ◽  
In Silico

scholarly journals Biochemical, molecular and in silico characterization of arsenate reductase from pH, salt and arsenic tolerant Bacillus thuringiensis KPWP1

2021 ◽  
Author(s):  
Paromita Banerjee ◽  
Ananya Chatterjee ◽  
Sushmita Jha ◽  
Nirbhay Bhadani ◽  
Partha Datta ◽  
...  
Keyword(s):  
Enzyme Activity ◽  
Bacillus Subtilis ◽  
Surface Water ◽  
Bacillus Thuringiensis ◽  
Bacillus Cereus ◽  
Binding Site ◽  
In Silico ◽  
Arsenate Tolerance ◽  
In Silico Characterization

Abstract The objective of the present study was to characterize aresenate reductase of pH, salt and arsenate tolerant Bacillus thuringiensis KPWP1, isolated from contaminated surface water. Interestingly, it was found that the arsC, arsB and arsR genes involved in arsenate tolerance are distributed in the genome of KPWP1. The inducible arsC gene was cloned, expressed and the purified ArsC protein showed profound enzyme activity with the KM and Kcat values as 25 µM and 0.00119 s− 1, respectively. In silico studies of KPWP1 ArsC revealed that in spite of 19–26% differences in gene sequences, the ArsC proteins of Bacillus thuringiensis, Bacillus subtilis and Bacillus cereus are structurally conserved and KPWP1 ArsC structure is close to nature. Docking and analysis of binding site showed that arsenate ion interacts with three cysteine residues of ArsC of KPWP1and predicts that the ArsC from B. thuringiensis reduces arsenate by using the triple Cys redox relay mechanism.

scholarly journals Generation of Cry11 Variants of Bacillus thuringiensis by Heuristic Computational Modeling

2020 ◽  
Vol 16 ◽  
pp. 117693432092468
Author(s):  
Efraín Hernando Pinzón-Reyes ◽  
Daniel Alfonso Sierra-Bueno ◽  
Miguel Orlando Suarez-Barrera ◽  
Nohora Juliana Rueda-Forero ◽  
Sebastián Abaunza-Villamizar ◽  
...  
Keyword(s):  
Bacillus Thuringiensis ◽  
Directed Evolution ◽  
In Silico ◽  
Structural Characteristics ◽  
Optimization Techniques ◽  
Darwinian Evolution ◽  
Statistical Thermodynamic ◽  
Experimental Conditions ◽  
Conserved Domains

Directed evolution methods mimic in vitro Darwinian evolution, inducing random mutations and selective pressure in genes to obtain proteins with enhanced characteristics. These techniques are developed using trial-and-error testing at an experimental level with a high degree of uncertainty. Therefore, in silico modeling of directed evolution is required to support experimental assays. Several in silico approaches have reproduced directed evolution, using statistical, thermodynamic, and kinetic models in an attempt to recreate experimental conditions. Likewise, optimization techniques using heuristic models have been used to understand and find the best scenarios of directed evolution. Our study uses an in silico model named HeurIstics DirecteD EvolutioN, which is based on a genetic algorithm designed to generate chimeric libraries from 2 parental genes, cry11Aa and cry11Ba, of Bacillus thuringiensis. These genes encode crystal-shaped δ-endotoxins with 3 conserved domains. Cry11 toxins are of biotechnological interest because they have shown to be effective as biopesticides for disease-spreading vectors. With our heuristic model, we considered experimental parameters such as DNA fragmentation length, number of generations or simulation cycles, and mutation rate, to get characteristics of Cry11 chimeric libraries such as percentage of population identity, truncation of variants obtained from the presence of internal stop codons, percentage of thermodynamic diversity, and stability of variants. Our study allowed us to focus on experimental conditions that may be useful for the design of in vitro and in silico experiments of directed evolution with Cry toxins of 3 conserved domains. Furthermore, we obtained in silico libraries of Cry11 variants, in which structural characteristics of wild Cry families were observed in a review of a sample of in silico sequences. We consider that future studies could use our in silico libraries and heuristic computational models, as the one suggested here, to support in vitro experiments of directed evolution.

Sign in / Sign up

Export Citation Format

Share Document