The Toxicity of Srikaya Seed Granules (Annona squamosa L.) with Different Heating Temperatures Against the Larva of Aedes aegypti L.

Aedes aegypti L. is a mosquito carrying dengue virus that causes dengue fever, especially in Southeast Asia which is a tropical rain forest region which is a habitat for mosquito growth. Aedes aegypti L. mosquito control is carried out by chemical means of fogging and using abate but this control actually causes Aedes aegypti L. mosquitoes to become resistant or immune to chemical drugs so that a new breakthrough is created by making bioinsecticides biologically to eradicate the Aedes aegypti L. mosquito. with characteristics that are environmentally friendly and do not kill non-target animals and cause the Aedes aegypti L. mosquito not to become resistant. To be able to realize this desire so that the sugar cane granules extract of Annona squamosa L. containing active compounds in the form of annonain and squamosin so that they are toxic to Aedes aegypti L. mosquito larvae. Further research is to test the heating temperature level of the granules of Annona squamosa L. extract temperature of 40 ° C and 60 ° C which is more deadly of Aedes aegypti L. mosquito larvae. This research method uses a completely randomized design with four repetitions. The temperature of 60 ° C uses concentrations of 1 ppm, 6 ppm, 12 ppm, 18 ppm, 24 ppm and 30 ppm. As for the temperature of 40 ° C using concentrations of 1 ppm, 7 ppm, 14 ppm, 21 ppm, 28 ppm, and 35 ppm, each temperature compared with aquadest and abate. Data analyzed using probit analysis to determine the LC50, then followed by a statistical test paired sample T-test with SPSS to find out a significant difference between heating temperatures of 40 ° C to 60 ° C. These results then show that a higher temperature of 60 ° C has a higher level of toxicity compared to a lower temperature of 40 ° C.

Identification of Bacteria on Seblak Food around University of Jember Based on Microbiological Criteria of Processed Food

The quality of food that is good in bacteriological, chemical and physical must always be maintained in order to avoid diseases or health problems. Healthy and safe food is an important factor to improve the standard of public health. Seblak is a ready-to-eat Indonesian food which until now has never been carried out research about what kinds of bacteria in it. Seblak is a food made from raw crackers which is then deliberately soaked using hot water to have a chewy texture. This study aims to determine what types of bacteria are contained in seblak, through the process of isolation and identification in the macroscopic, microscopic and biochemical way. This study used 5 samples, which was repeated 5 times for each sample. Bacteria were isolated from the sample using spread plate techniques and observed by growing colonies on the plate. Each different colonies was observed microscopically through gram staining and endospore staining. To strengthen the data, biochemical tests were also carried out, biochemical tests that have been done in this study were the oxidase test, catalase test, and indole test. The results of the study showed that the bacteria that were found from the samples are in the genus of Bacillus sp. because they show the morphological characteristics of the colonies that form concentric circles, meanwhile, microscopic observations show morphological characteristics of cells in the form of gram-negative bacilli and have the endospores.

Crabs in Bandealit Estuary Resort of Meru Betiri National Park

Crabs are macrobenthos with characters that are attached to or resting on a base or live on basic sediments. The role of crabs in the ecosystem includes converting nutrients and enhancing mineralization, increasing the distribution of oxygen in the soil, helping carbon life cycles, and providing natural food for various types of aquatic biota. This research was conducted in the estuary area of ​​the Meru Betiri National Park (TNMB) Resort Bandealit. Identification results from 37 individual crabs at the Estuary Resort Bandealit Meru Betiri National Park (TNMB) obtained 5 species from 2 families (Portunidae and Sesarmidae). In the family Portunidae, there are 3 types, namely Scylla tranquebarica, Scylla paramamosain, and Scylla olivacea. Whereas in the family Sesarmidae found 2 types, namely Parasesarma pictum and Parasesarma cognatum. Keywords: Crab, Bandealit Resort, Identification

Ordo Anura in Jember University

Some types of Anura have a narrow range of environmental parameters, so they can’t survive in environments where natural conditions change dramatically. Therefore, Anura has the potential to be a good environmental bioindicator. The purpose of this research is to identify the types of Anura found at University of Jember. This research is included in the survey research using direct observation method VES (Visual Encounter Survey). Observations were made of adult members of the Anura Order. Data taken includes species characteristics, abiotic factors such as temperature and humidity, and activity when found. The results showed at Jember University there were 4 species from 3 family members of the Anura order, namely Duttaphrynus melanostictus Schneider, 1799 (Bufonidae), Polypedates leucomystax Gravenhorst, 1829 (Rhacophoridae), Fejervarya limnocharis Gravenhorst, 1829 (Dicroglossidae), and Occidozyga sumatrana Peters, 1877 (Dicroglossidae). The species most commonly found is Duttaphrynus melanostictus which is found in almost every observation location. Environmental factors that support the existence of Anura members in that location are temperature and humidity, and environmental conditions.

In-Silico Analysis for cryI Gene Amplification from Bacillus thuringiensis

Bacillus thuringiensis is one type of bacteria that has been used as a microbiological control agent for pests and a vector of plant disease. The presence of Cry proteins inside the B. thuringiensis can be acted as a specific insect repellent that only toxic to certain insects. The CryI protein is toxic to Lepidoptera insects which can attack various types of plants. Polymerase Chain Reaction (PCR) is a common method that can be used to amplify the gene encoding CryI proteins from B. thuringiensis. This research aimed to design a good primer candidate for cryI gene amplification from B. thuringiensis. In silico analysis for designing cryI primer was carried out using some software, such as BLAST for searching cryI gene sequence, Bioedit for sequences alignment, and DINAmelt for analyzing dimer structure of primers. Ten primer candidates were successfully obtained based on the result of the primer3 software. A pair of primer was selected to amplify the cryI gene, with forward primer 5’- CGGTGAATGCCCTGTTTACT -3’ and reverse primer 5’-CGGTCTGGTTGCCTATTGAT -3’. Amplification of the cryI gene by PCR method using selected primer resulting in a PCR product with a length of approximately 200 bp.

Effect of Variations in Sugar Addition to the Quality of Bamboo Shoot Syrup (Dendrocalamus asper)

Bambu betung (Dendrocalamus asper) merupakan tumbuhan berumpun yang memiliki fase tumbuh melalui tunas (rebung). Rebung memiliki kandungan fosfor, vitamin A, vitamin C, serat mineral dan protein yang baik untuk tubuh. Tujuan dari penelitian ini adalah untuk mengetahui pengaruh variasi penambahan gula terhadap kualitas sirup rebung betung. Metode yang digunakan dalam penelitian ini adalah metode eksperimen dengan rancangan acak lengkap (RAL) untuk uji sifat organoleptik. Variasi penambahan gula yang digunakan dalam penelitian ini adalah 50%, 55%, 60% dan 65%. Hasil uji vitamin C secara berturut - turut adalah 2,112%, 3,256%, 4,136%, dan 5,016%. Hasil uji protein secara berturut – turut untuk setiap perlakuan adalah 0,25%, 0,15%, 0,24% dan 0,17%. Hasil uji kadar air menunjukkan 0,073%, 0,063%, 0,056% dan 0,056%. Serta hasil uji oganoleptik (kekentalan, rasa dan kesukaan) menunjukkan perlakuan terbaik terdapat pada kosentrasi gula 65% dengan nilai 3.8000, 3.4667 dan 3.6000. Hasil penelitian ini menunjukkan terdapat pengaruh variasi gula terhadap vitamin C, kadar air dan organoleptik, akan tetapi tidak memiliki pengaruh terhadap kadar protein. Perlu adanya penelitian lanjutan untuk mengetahui nilai gizi lemak, Karbohidrat, Vitamin A, vitamin B1 (Thiamin), Vitamin B2 (Ribovlavin), Fe, K, Ca, P, Na dan uji mikrooganisme.

Microbiological Quality of Coriander in Malang Traditional Market

Coriander is commonly used by people as a food flavour. Actually, people does not separate the intact and damaged coriander for food processing. The aim of this study is to examine the microbiological quality of the intact and damaged coriander based on the Total Plate Count (TPC) of mold colonies and identification of the mold contaminants. Identification of contaminants mold based on the colony and microscopic character description. Then, the fungi characters refers to the identification key book for fungi identification. The research results is: 1) the intact coriander TPC is 1.6 x 103 colonies/g and the damaged coriander TPC 1.4 x 107 colonies/g. 2) There are 10 species of molds contaminant isolated from the intact coriander and damaged coriander.

Learning Motivation: Based on Gender and Academic Abilities

Student learning outcomes are influenced by several factors. One of them is learning motivation. This research is a descriptive and correlation study that aims to describe and analyze students' learning motivation based on gender and academic ability. The sample of this study was grade 10th students of senior high school in Kupang City, namely: SMAN 5, SMAN 4, and SMAN 1. The determination of school samples and class samples is done by random sampling. The research instrument used the MSLQ motivation questionnaire that was developed and validated by Duncan and McKeachie (2005), while the data of learning outcomes obtained from summative test scores . The results obtained that the average motivation (intrinsic and extrinsic) of students: 1) women are higher than male students, and 2) academic ability is higher than students with lower academic ability, and 3) Extrinsic motivation has a very significant correlation with intrinsic motivation and results learning, for gender and academic ability.The results of this study indicate that an appropriate learning strategy is needed in order to minimize gender differences and academic ability to foster student learning motivation which ultimately impacts on learning outcomes. Keywords: Learning motivation; academic ability; gender; students.

The Development of Collaborative Learning Cell Based on Brain-Based Learning (BBL)Model for The Junior High School Science Learning in The Agroecosystem Area

Agroecosystem plays an important role in the national economy. However, the role of agroecosystem in education in the form of teaching and learning has not been used optimally. It is less in providing opportunities for students to develop their mindset based on their abilities so that the students do not understand the potential requiring the surrounding area. Learning models that can provide opportunities for students to develop are suitable with the 2013 curriculum. Modification of collaborative learning Cells with Brain-Based Learning (BBL LC) model makes the learning appropriate for the 2013 curriculum. The purpose is to obtain a valid, effective, and practical model which is suitable for the junior high school science learning in the agroecosystem area. The research type is development research (R & D) by using the 4-D model but, only use three stages; Define, Design, and Develop stages without using Disseminate stage. This research was conducted at Junior High School 7 Jember. The data collection techniques were filling out the validation sheet, interview, observation, test, and documentation. The data analysis techniques include data analysis from the validation results, model analysis, and model effectiveness analysis. The model validity was the average results of the product validation (85.81%) in a very valid category. The model effectiveness was the average of¬N-gain learning outcomes (0.53) and students' problem-solving skill questionnaires (75.87% ) in a good category. The model practicality was from the teacher and student response questionnaires with an average of about 92.94% and 94% which belongs to a very practical category.

The Improvement Critical Thinking Ability of Students Through Reciprocal Learning (Reciprocal Teaching) and Jigsaw Models in Biological Lesson in Parlaungan Islamic High School and Al-Muslim High School

Reciprocal teaching is one of learning model which is consist of four strategies: summarizing, questioning, claryfying the knowladge, and predicting. Another type of cooperative learning is jigsaw models. Jigsaw is a cooperative learing model which create some expert learning groups to stimulate critical thinking of the student abilities. Jigsaw is a learning model that triggers student to have active role in group learning. This study was to know the effect of Reciprocal Teaching with Jigsaw learning model on student critical learning ability is important to be exposure because its study shows that the 10th grade high school students had a low critical thinking abilities. As pre-test and post-test statistical data showed the influence of prior knowledge on learning result has significance points of 0,443 > 0,05., so it can be conclude that the data is significant. Based on the data, there are influence between the prior knowledge to the crtitical thinking ability result. According to the statistical data, the influence of learning models on learning results has significance points of 0,060 > 0,05., so it can be conclude that there are diffrence effect in critical thinking ability by using Reciprocal teaching vs Jigsaw models. Based on the data, the significance points are 0,126 > 0,05., it indicates that the students learning results data is valid or significant and it can be conclude that there are some interaction between Reciprocal teaching with Jigsaw model learning method and aperception knowledge on the learning result of 10th grade student critical thinking ability at Islam Parlaungan High School Waru and Al-Muslim High School Waru.