Distribution Pattern of Thrips (Thysanoptera: Thripidae) and Tomato Chlorotic Spot Virus in South Florida Tomato Fields

2020 ◽  
Vol 49 (1) ◽  
pp. 73-87 ◽  
Author(s):  
Rafia A Khan ◽  
Dakshina R Seal ◽  
Shouan Zhang ◽  
Oscar E Liburd ◽  
Rajagopalbabu Srinivasan ◽  
...  
Keyword(s):  
Frankliniella Occidentalis ◽  
Crop Protection ◽  
Western Flower Thrips ◽  
Management Program ◽  
South Florida ◽  
Dade County ◽  
Spot Virus ◽  
Chlorotic Spot ◽  
Tomato Field ◽  
Thrips Species

Abstract Tomato chlorotic spot virus (TCSV) is an orthotospovirus that causes a devastating disease in tomato (Lycopersicon esculentum Miller). TCSV emerged recently in South Florida. Studies were conducted in three commercial tomato fields in Miami-Dade County, Florida during the vegetable-growing seasons from October to April in 2015 through 2017. Each year, data were collected at 3, 6, and 9 wk after transplanting at various distances from the edges of each fields. Based on 3 yr total samples, three species of thrips were commonly observed melon thrips, Thrips palmi Karny (62.16 ± 0.79%), being the most abundant species followed by common blossom thrips, Frankliniella schultzei Trybom (21.55 ± 0.66%), and western flower thrips, Frankliniella occidentalis (Pergande) (16.26 ± 0.61%). Abundance of all thrips and TCSV infected plants was high at the edge of a tomato field 3 wk after transplanting with significantly fewer infected plants toward the center of the field. The distribution patterns of thrips and TCSV in various fields were mostly regular and aggregated across the sampling dates during the study period. Abundance of TCSV symptomatic plants and thrips species was high at the edge of the field and increased over time. The number of samples required to accurately determine population density of thrips was calculated by using three precision levels (0.10, 0.20, 0.30) at three predetermined densities of thrips (0.10, 0.20, and 0.40 per sample). This information will provide guidelines to growers, crop protection personnel, agricultural scouts, and researchers to develop a sustainable thrips and tospovirus management program.

scholarly journals Progression of Watermelon Bud Necrosis Virus Infection in Its Vector, Thrips palmi

Cells ◽  
2021 ◽  
Vol 10 (2) ◽  
pp. 392
Author(s):  
Amalendu Ghosh ◽  
Priti ◽  
Bikash Mandal ◽  
Ralf G. Dietzgen
Keyword(s):  
Virus Infection ◽  
Salivary Glands ◽  
Frankliniella Occidentalis ◽  
Western Flower Thrips ◽  
Malpighian Tubules ◽  
Necrosis Virus ◽  
Posterior Portion ◽  
Thrips Palmi ◽  
Thrips Species ◽  
Anterior Midgut

Thrips are important pests of agricultural, horticultural, and forest crops worldwide. In addition to direct damages caused by feeding, several thrips species can transmit diverse tospoviruses. The present understanding of thrips–tospovirus relationships is largely based on studies of tomato spotted wilt virus (TSWV) and Western flower thrips (Frankliniella occidentalis). Little is known about other predominant tospoviruses and their thrips vectors. In this study, we report the progression of watermelon bud necrosis virus (WBNV) infection in its vector, melon thrips (Thrips palmi). Virus infection was visualized in different life stages of thrips using WBNV-nucleocapsid protein antibodies detected with FITC-conjugated secondary antibodies. The anterior midgut was the first to be infected with WBNV in the first instar larvae. The midgut of T. palmi was connected to the principal salivary glands (PSG) via ligaments and the tubular salivary glands (TSG). The infection progressed to the PSG primarily through the connecting ligaments during early larval instars. The TSG may also have an ancillary role in disseminating WBNV from the midgut to PSG in older instars of T. palmi. Infection of WBNV was also spread to the Malpighian tubules, hindgut, and posterior portion of the foregut during the adult stage. Maximum virus-specific fluorescence in the anterior midgut and PSG indicated the primary sites for WBNV replication. These findings will help to better understand the thrips–tospovirus molecular relationships and identify novel potential targets for their management. To our knowledge, this is the first report of the WBNV dissemination path in its vector, T. palmi.

scholarly journals First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

Plant Disease ◽  
2010 ◽  
Vol 94 (12) ◽  
pp. 1507-1507 ◽  
Author(s):  
J. M. Crosslin ◽  
L. L. Hamlin
Keyword(s):  
Frankliniella Occidentalis ◽  
Solanum Tuberosum L ◽  
Consensus Sequence ◽  
Western Flower Thrips ◽  
Alternaria Solani ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Feeding Damage ◽  
Rt Pcr ◽  
Spot Virus

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5′ TAACACAACACAAAGCAAACC 3′ and reverse: 5′ CCAAATACTACTTTAACCGCA 3′) (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.

Population Distribution of Flower Thrips and the Western Flower Thrips (Thysanoptera: Thripidae) in Nectarines and their Relative Association with Injury to Fruit in the Southeastern United States2

1990 ◽  
Vol 25 (3) ◽  
pp. 427-438 ◽  
Author(s):  
C. E. Yonce ◽  
R. J. Beshear ◽  
J. A. Payne ◽  
D. L. Horton
Keyword(s):  
Relative Abundance ◽  
Frankliniella Occidentalis ◽  
Population Distribution ◽  
Western Flower Thrips ◽  
Grass Species ◽  
Flower Thrips ◽  
Thrips Species ◽  
Neohydatothrips Variabilis ◽  
Soybean Thrips

Thrips populations and injury attributed to thrips feeding on fruit surfaces was monitored in unsprayed middle Georgia nectarines during 1986 – 1988. The flower thrips, Frankliniella tritici (Fitch), the western flower thrips, Frankliniella occidentalis (Pergande), and the soybean thrips, Neohydatothrips variabilis (Beach), were the most abundant thrips species recovered from the orchard. Their relative abundance changed each year. The western flower thrips particularly appears to be most damaging in causing russeting on fruit surfaces. Silvering injury was caused by either or both of the flower thrips and coincided with peak populations of adults at or near final fruit swell. Soybean thrips caused little or no injury to fruit. None of the above mentioned flower thrips species were recovered from various weed and grass species in and near the nectarine orchard during two years of overwintering studies.

scholarly journals Distribution and Transmission of Iris yellow spot virus

Plant Disease ◽  
2001 ◽  
Vol 85 (8) ◽  
pp. 838-842 ◽  
Author(s):  
A. Kritzman ◽  
M. Lampel ◽  
B. Raccah ◽  
A. Gera
Keyword(s):  
Frankliniella Occidentalis ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Onion Thrips ◽  
Spot Virus ◽  
Nucleocapsid Gene ◽  
Thrips Species ◽  
Mother Plants ◽  
Thrips Population

Iris yellow spot virus (IYSV), a new tospovirus associated with a disease in onion (Allium cepa) that is known to growers in Israel as “straw bleaching,” was identified and further characterized by host range, serology, electron microscopy, and molecular analysis of the nucleocapsid gene. The transmissibility of IYSV by Thrips tabaci and Frankliniella occidentalis was studied. IYSV was efficiently transmitted by T. tabaci from infected to healthy onion seedlings and leaf pieces. Two biotypes of F. occidentalis, collected from two different locations in Israel, failed to transmit the virus. Surveys to relate the incidence of thrips populations to that of IYSV were conducted in onion fields. They revealed that the onion thrips T. tabaci was the predominant thrips species, and that its incidence was strongly related to that of IYSV. Forty-five percent of the thrips population collected from IYSV-infected onion and garlic fields in Israel transmitted the virus. IYSV was not transmitted to onion seedlings from infected mother plants through the seed, and was not located in bulbs of infected plants.

scholarly journals Complexity and local specificity of the virome associated with tospovirus-transmitting thrips species.

2021 ◽  
Author(s):  
M. Chiapello ◽  
Lara Bosco ◽  
M. Ciuffo ◽  
S. Ottati ◽  
N. Salem ◽  
...  
Keyword(s):  
Frankliniella Occidentalis ◽  
High Throughput Sequencing ◽  
Western Flower Thrips ◽  
Thrips Tabaci ◽  
Model Systems ◽  
Horticultural Crops ◽  
Flower Thrips ◽  
Thrips Species ◽  
Repeated Sampling ◽  
Neohydatothrips Variabilis

Frankliniella occidentalis (western flower thrips=WFT) and Thrips tabaci (onion thrips=OT) are insect species that greatly impact horticultural crops through direct damage and their efficient vectoring of tomato spotted wilt virus and iris yellow spot virus. In this study we collected thrips of these species from 12 field populations in various regions in Italy. We also included one field population of Neohydatothrips variabilis (soybean thrips=ST) from the U.S.A. Total RNAseq from high-throughput sequencing (HTS) was used to assemble the virome and then we assigned putative viral contigs to each thrips sample by qRT-PCR. Excluding plant and fungal viruses, we were able to identify 61 viral segments, corresponding to 41 viruses: 14 were assigned to WFT, 17 to OT, one from ST and 9 viruses could not be assigned to any species based on our stringent criteria. All these viruses are putative representative of new species (with only the exception of a sobemo-like virus that is 100% identical to a virus recently characterized in ST) and some belong to new higher-ranking taxa. These additions to the viral phylogeny suggest previously undescribed evolutionary niches. Most of the Baltimore’s classes of RNA viruses were present (positive- and minus- strand and dsRNA viruses), but only one DNA virus was identified in our collection. Repeated sampling in a subset of locations in 2019 and 2020 and further virus characterization in a subset of four thrips populations maintained in laboratory allowed us to provide evidence of a locally persistent thrips core virome that characterizes each population. IMPORTANCE Harnessing the insect microbiome can result in new approaches to contain their populations or the damage they cause vectoring viruses of medical, veterinary, or agricultural importance. Persistent insect viruses are a neglected component of their microbiota. Here for the first time, we characterize the virome associated with the two model systems for tospovirus-transmitting thrips species, of utmost importance for the direct and indirect damage they cause to a number of different crops. The thrips virome here characterized includes several novel viruses, that in some cases reveal previously undescribed clades. More importantly, some of the viruses we describe are part of a core virome that is specific and consistently present in distinct geographical locations monitored over the years, hinting at a possible mutualistic symbiotic relationship with their host.

scholarly journals Replication of Tomato spotted wilt virus After Ingestion by Adult Thrips setosus is Restricted to Midgut Epithelial Cells

2001 ◽  
Vol 91 (12) ◽  
pp. 1149-1155 ◽  
Author(s):  
Jun Ohnishi ◽  
Leandra M. Knight ◽  
Daijirou Hosokawa ◽  
Ichiro Fujisawa ◽  
Shinya Tsuda
Keyword(s):  
Salivary Glands ◽  
Tomato Spotted Wilt Virus ◽  
Frankliniella Occidentalis ◽  
Western Flower Thrips ◽  
Enzyme Linked Immunosorbent Assay ◽  
Electron Microscopic ◽  
N Protein ◽  
Tomato Spotted Wilt ◽  
Thrips Species ◽  
Wilt Virus

If acquisition access feeding (AAF) is first given after adult eclosion, none of the nine thrips species able to serve as tospovirus vectors can become infective. The previous cellular investigations of this phenomenon, carried out only in Frankliniella occidentalis, suggested that infectivity was prevented because the type member of the tospoviruses, Tomato spotted wilt virus (TSWV), was unable to enter the midgut of adult thrips. The present study extends a cellular view of tospovirus—thrips interactions to a species other than the western flower thrips, F. occidentalis. Our findings show that TSWV enters and replicates within the midgut of adult Thrips setosus, but does not infect cells beyond the midgut epithelia. After AAF as adult, TSWV replicated in T. setosus midgut cells as indicated by significant increases in nucleocapsid (N) protein detected by double-antibody sandwich enzyme-linked immunosorbent assay, and the presence of inclusions containing the S RNA-encoded nonstructural and N proteins revealed by microscopic observations. Electron microscopic observations of adult insects showed that no infection occurred in cells beyond the midgut epithelia, and insects subsampled from the same cohorts could not transmit TSWV. In contrast, electron microscopy observations of larval T. setosus revealed that TSWV infected the midgut and muscle cells, and adult insects developing from these cohorts had infected salivary glands and were able to transmit TSWV. Mature virions were observed only in the salivary glands of adults developing from infected larvae. Our findings suggest that the barrier to infectivity in T. setosus adults differs from that shown for F. occidentalis adults.

scholarly journals First Report of Frankliniella fusca as a Vector of Impatiens necrotic spot tospovirus

Plant Disease ◽  
2001 ◽  
Vol 85 (11) ◽  
pp. 1211-1211 ◽  
Author(s):  
R. A. Naidu ◽  
C. M. Deom ◽  
J. L. Sherwood
Keyword(s):  
New York ◽  
Frankliniella Occidentalis ◽  
Western Flower Thrips ◽  
Adult Emergence ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Flower Thrips ◽  
Access Period ◽  
Thrips Species ◽  
Transmission Studies

Of more than a dozen members of the genus Tospovirus, Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) are among the most damaging viruses found in North America (3). TSWV is a major problem in vegetable and field crops, whereas INSV is commonly encountered in the floriculture and nursery industries. TSWV is transmitted by several thrips species, of which the western flower thrips (WFT, Frankliniella occidentalis Pergande) is the most predominant vector. INSV has been reported to be transmitted only by WFT (1). To determine if tobacco thrips (TT, F. fusca Hinds) can transmit INSV, a virus-free culture of TT was reared on detached peanut cv. Florunner leaves in 0.5-liter polypropylene cups with closed lids at 25 ± 2°C with constant light. Fresh peanut leaves were exchanged every 2 to 3 days to maintain the thrips colony. For transmission studies, adult thrips were confined on peanut leaves for 24 h for oviposition and then the peanut leaves, sans adults thrips, were transferred to a new cup. Leaves were examined daily for larval emergence, and similarly aged first instar larvae (<12 h old) were given an acquisition access period of 24 to 48 h on INSV-infected detached leaves of Emilia sonchifolia. The larvae were subsequently transferred to healthy peanut leaves and reared until adult emergence. Groups of 10 adults per plant were given a 48-h inoculation access period on 10-day-old healthy E. sonchifolia seedlings. Thrips were subsequently killed, and the plants were maintained in a growth chamber at 28 ± 2°C, and with a 16/8 light/dark photoperiod. Transmission studies were repeated 10 times with different sources of infected plants and different batches of larvae following acquisition access periods. Seven to ten days after inoculation, plants developed symptoms consisting of chlorotic spots, mosaic, and mottling. The presence of INSV in these symptomatic plants was confirmed by ELISA using INSV ImmunoStrip Test (Agdia, Inc., Elkhart, IN) and by reverse transcription-polymerase chain reaction assay with primers specific to the INSV-NSs gene. Our results demonstrate that TT can serve as a vector of INSV. INSV has been reported in peanut in the southeastern United States (2). WFT and TT transmit TSWV in peanuts, with the latter being the predominant vector species in Georgia and other parts of the region. TT transmission of INSV is of concern because of the increased incidence in recent years of INSV in peanuts and the potential for synergistic or gene exchange between TSWV and INSV, since mixed infections with both viruses have been observed (4). References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) S. S. Pappu et al. Plant Dis. 83:966, 1999. (3). J. L. Sherwood et al. Pages 1034–1040 in: Encyclopedia of Plant Pathology. C. Maloy and T. D. Murray, eds. John Wiley and Sons, Inc., New York, 2001. (4) L. Wells et al. Phytopathology (Abstr.) 94:S94, 2001.

scholarly journals Effect of Plastic Mulch Color and Insecticides on Thrips Populations and Damage to Tomato

1992 ◽  
Vol 2 (2) ◽  
pp. 208-211 ◽  
Author(s):  
Steve L. Brown ◽  
James E. Brown
Keyword(s):  
Frankliniella Occidentalis ◽  
Western Flower Thrips ◽  
Common Species ◽  
Plastic Mulch ◽  
Disease Epidemiology ◽  
Flower Thrips ◽  
Tomato Spotted Wilt ◽  
Thrips Species ◽  
Tobacco Thrips ◽  
Black Plastic

In each of 3 years, the average number of thrips in tomato (Lycopersicon esculentum L. cv. Mountain Pride) blooms was greater on tomatoes grown on white plastic mulch than on tomatoes grown on black plastic mulch, aluminum plastic mulch, or bare ground. Early season differences, however, diminished with time as plants grew and shaded a larger portion of plastic mulch. Weekly applications of 12 insecticide treatments failed to reduce thrips populations below that found in the control. No significant differences were found among treatments in the quantity, quality, or earliness of tomato yields. Incidence of tomato spotted wilt (vectored by some thrips species) was too low to detect statistical differences or determine the importance of thrips population in disease epidemiology. Western flower thrips (Frankliniella occidentalis) was the most common species found, followed by eastern flower thrips (F. tritici) and tobacco thrips (F. fusca). Thrips control, in the absence of tomato spotted wilt, is not justified for the thrips populations encountered in this study.

scholarly journals Insect Management in Floriculture: How Important Is Sanitation in Avoiding Insect Problems?

2006 ◽  
Vol 16 (4) ◽  
pp. 633-636 ◽  
Author(s):  
Brian K. Hogendorp ◽  
Raymond A. Cloyd
Keyword(s):  
Frankliniella Occidentalis ◽  
Insect Pests ◽  
Western Flower Thrips ◽  
Quantitative Information ◽  
Management Program ◽  
Insect Management ◽  
Flower Thrips ◽  
Growing Medium ◽  
Pot Marigold ◽  
Central Illinois

Sanitation, which includes removing plant and growing medium debris, is an important component of any greenhouse or nursery pest management program. However, there is minimal quantitative information on how sanitation practices can reduce pest problems. In this study, conducted from May through Nov. 2005, we evaluated plant and growing medium debris as a source of insect pests from four greenhouses located in central Illinois. Two 32-gal refuse containers were placed in each greenhouse with a 3 × 5-inch yellow sticky card attached to the underside of each refuse container lid. Each week, yellow sticky cards and plastic refuse bags were collected from the containers and insects captured on the yellow sticky cards were identified. Insects captured on the yellow sticky cards were consistent across the four greenhouses with western flower thrips (Frankliniella occidentalis), fungus gnats (Bradysia spp.), and whiteflies (Bemisia spp.) the primary insects present each week. Insect numbers, in order of prevalence on the yellow sticky cards, varied across the four locations, which may be related to the type of plant debris discarded. For example, extremely high numbers of adult whiteflies (range = 702 to 1930) were captured on yellow sticky cards in one greenhouse each month from August through November. This was due to the presence of yellow sage (Lantana camera), bee balm (Monarda didyma), garden verbena (Verbena × hybrida), common zinnia (Zinnia elegans), sage (Salvia spp.) and fuchsia (Fuschia spp.) debris that was heavily-infested with the egg, nymph, pupa, and adult stages of whiteflies. High western flower thrips adult numbers in the greenhouses were generally associated with plant types such as marguerite daisy (Dendranthema frutescens) and pot marigold (Calendula officinalis) disposed while in bloom with opened yellow flowers, which contained adult western flower thrips. Based on the results of this study, it is important that greenhouse producers timely remove plant and growing medium debris from greenhouses or place debris into refuse containers with tight-sealing lids to prevent insect pests from escaping.

scholarly journals Field Evaluation of Tomato Cultivars for Tolerance to Tomato Chlorotic Spot Tospovirus

2019 ◽  
Vol 20 (2) ◽  
pp. 77-82 ◽  
Author(s):  
Shouan Zhang ◽  
Xiaohui Fan ◽  
Yuqing Fu ◽  
Qingren Wang ◽  
Eugene McAvoy ◽  
...  
Keyword(s):  
Frankliniella Occidentalis ◽  
Disease Incidence ◽  
Total Yield ◽  
Genetic Resistance ◽  
Field Evaluation ◽  
South Florida ◽  
Fruit Yield ◽  
Field Conditions ◽  
Chlorotic Spot ◽  
Tomato Cultivars

Fourteen tomato cultivars resistant to tomato spotted wilt tospovirus (TSWV) were evaluated for their tolerance against tomato chlorotic spot tospovirus (TCSV) under field conditions during the 2014–2015 and 2015–2016 growing seasons in Homestead, FL. All TSWV-resistant tomato cultivars had significantly (P < 0.05) lower disease incidence of TCSV, compared with the commercial standard cultivars ‘FL 47’ or ‘Sanibel’, exhibiting intermediate to high levels of tolerance to TCSV. There was no significant effect of tomato genotype on the thrips vectors, western flower thrips (Frankliniella occidentalis) and common blossom thrips (F. schultzei). All tested tomato cultivars had equivalent or greater yields of total marketable fruit compared with the standard cultivar Sanibel. Particularly, in the third trial with disease incidence of 25% on Sanibel, ‘BHN 1064’ had significantly greater total yield and yields of extra-large and large fruit compared with Sanibel. ‘SV 7631TD’ and ‘Brickyard’ had significantly greater extra-large fruit yield and medium fruit yield, respectively, compared with Sanibel. Results from this study show that TSWV-resistant tomato cultivars were tolerant to TCSV under field conditions of south Florida, indicating that the use of genetic resistance in commercial tomato cultivars is an effective strategy to manage TCSV.

Sign in / Sign up

Export Citation Format

Share Document