scholarly journals First Report of Frankliniella fusca as a Vector of Impatiens necrotic spot tospovirus

Plant Disease ◽  
2001 ◽  
Vol 85 (11) ◽  
pp. 1211-1211 ◽  
Author(s):  
R. A. Naidu ◽  
C. M. Deom ◽  
J. L. Sherwood
Keyword(s):  
New York ◽  
Frankliniella Occidentalis ◽  
Western Flower Thrips ◽  
Adult Emergence ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Flower Thrips ◽  
Access Period ◽  
Thrips Species ◽  
Transmission Studies

Of more than a dozen members of the genus Tospovirus, Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) are among the most damaging viruses found in North America (3). TSWV is a major problem in vegetable and field crops, whereas INSV is commonly encountered in the floriculture and nursery industries. TSWV is transmitted by several thrips species, of which the western flower thrips (WFT, Frankliniella occidentalis Pergande) is the most predominant vector. INSV has been reported to be transmitted only by WFT (1). To determine if tobacco thrips (TT, F. fusca Hinds) can transmit INSV, a virus-free culture of TT was reared on detached peanut cv. Florunner leaves in 0.5-liter polypropylene cups with closed lids at 25 ± 2°C with constant light. Fresh peanut leaves were exchanged every 2 to 3 days to maintain the thrips colony. For transmission studies, adult thrips were confined on peanut leaves for 24 h for oviposition and then the peanut leaves, sans adults thrips, were transferred to a new cup. Leaves were examined daily for larval emergence, and similarly aged first instar larvae (<12 h old) were given an acquisition access period of 24 to 48 h on INSV-infected detached leaves of Emilia sonchifolia. The larvae were subsequently transferred to healthy peanut leaves and reared until adult emergence. Groups of 10 adults per plant were given a 48-h inoculation access period on 10-day-old healthy E. sonchifolia seedlings. Thrips were subsequently killed, and the plants were maintained in a growth chamber at 28 ± 2°C, and with a 16/8 light/dark photoperiod. Transmission studies were repeated 10 times with different sources of infected plants and different batches of larvae following acquisition access periods. Seven to ten days after inoculation, plants developed symptoms consisting of chlorotic spots, mosaic, and mottling. The presence of INSV in these symptomatic plants was confirmed by ELISA using INSV ImmunoStrip Test (Agdia, Inc., Elkhart, IN) and by reverse transcription-polymerase chain reaction assay with primers specific to the INSV-NSs gene. Our results demonstrate that TT can serve as a vector of INSV. INSV has been reported in peanut in the southeastern United States (2). WFT and TT transmit TSWV in peanuts, with the latter being the predominant vector species in Georgia and other parts of the region. TT transmission of INSV is of concern because of the increased incidence in recent years of INSV in peanuts and the potential for synergistic or gene exchange between TSWV and INSV, since mixed infections with both viruses have been observed (4). References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) S. S. Pappu et al. Plant Dis. 83:966, 1999. (3). J. L. Sherwood et al. Pages 1034–1040 in: Encyclopedia of Plant Pathology. C. Maloy and T. D. Murray, eds. John Wiley and Sons, Inc., New York, 2001. (4) L. Wells et al. Phytopathology (Abstr.) 94:S94, 2001.

scholarly journals First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

Plant Disease ◽  
2010 ◽  
Vol 94 (12) ◽  
pp. 1507-1507 ◽  
Author(s):  
J. M. Crosslin ◽  
L. L. Hamlin
Keyword(s):  
Frankliniella Occidentalis ◽  
Solanum Tuberosum L ◽  
Consensus Sequence ◽  
Western Flower Thrips ◽  
Alternaria Solani ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Feeding Damage ◽  
Rt Pcr ◽  
Spot Virus

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5′ TAACACAACACAAAGCAAACC 3′ and reverse: 5′ CCAAATACTACTTTAACCGCA 3′) (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.

Population Distribution of Flower Thrips and the Western Flower Thrips (Thysanoptera: Thripidae) in Nectarines and their Relative Association with Injury to Fruit in the Southeastern United States2

1990 ◽  
Vol 25 (3) ◽  
pp. 427-438 ◽  
Author(s):  
C. E. Yonce ◽  
R. J. Beshear ◽  
J. A. Payne ◽  
D. L. Horton
Keyword(s):  
Relative Abundance ◽  
Frankliniella Occidentalis ◽  
Population Distribution ◽  
Western Flower Thrips ◽  
Grass Species ◽  
Flower Thrips ◽  
Thrips Species ◽  
Neohydatothrips Variabilis ◽  
Soybean Thrips

Thrips populations and injury attributed to thrips feeding on fruit surfaces was monitored in unsprayed middle Georgia nectarines during 1986 – 1988. The flower thrips, Frankliniella tritici (Fitch), the western flower thrips, Frankliniella occidentalis (Pergande), and the soybean thrips, Neohydatothrips variabilis (Beach), were the most abundant thrips species recovered from the orchard. Their relative abundance changed each year. The western flower thrips particularly appears to be most damaging in causing russeting on fruit surfaces. Silvering injury was caused by either or both of the flower thrips and coincided with peak populations of adults at or near final fruit swell. Soybean thrips caused little or no injury to fruit. None of the above mentioned flower thrips species were recovered from various weed and grass species in and near the nectarine orchard during two years of overwintering studies.

scholarly journals Complexity and local specificity of the virome associated with tospovirus-transmitting thrips species.

2021 ◽  
Author(s):  
M. Chiapello ◽  
Lara Bosco ◽  
M. Ciuffo ◽  
S. Ottati ◽  
N. Salem ◽  
...  
Keyword(s):  
Frankliniella Occidentalis ◽  
High Throughput Sequencing ◽  
Western Flower Thrips ◽  
Thrips Tabaci ◽  
Model Systems ◽  
Horticultural Crops ◽  
Flower Thrips ◽  
Thrips Species ◽  
Repeated Sampling ◽  
Neohydatothrips Variabilis

Frankliniella occidentalis (western flower thrips=WFT) and Thrips tabaci (onion thrips=OT) are insect species that greatly impact horticultural crops through direct damage and their efficient vectoring of tomato spotted wilt virus and iris yellow spot virus. In this study we collected thrips of these species from 12 field populations in various regions in Italy. We also included one field population of Neohydatothrips variabilis (soybean thrips=ST) from the U.S.A. Total RNAseq from high-throughput sequencing (HTS) was used to assemble the virome and then we assigned putative viral contigs to each thrips sample by qRT-PCR. Excluding plant and fungal viruses, we were able to identify 61 viral segments, corresponding to 41 viruses: 14 were assigned to WFT, 17 to OT, one from ST and 9 viruses could not be assigned to any species based on our stringent criteria. All these viruses are putative representative of new species (with only the exception of a sobemo-like virus that is 100% identical to a virus recently characterized in ST) and some belong to new higher-ranking taxa. These additions to the viral phylogeny suggest previously undescribed evolutionary niches. Most of the Baltimore’s classes of RNA viruses were present (positive- and minus- strand and dsRNA viruses), but only one DNA virus was identified in our collection. Repeated sampling in a subset of locations in 2019 and 2020 and further virus characterization in a subset of four thrips populations maintained in laboratory allowed us to provide evidence of a locally persistent thrips core virome that characterizes each population. IMPORTANCE Harnessing the insect microbiome can result in new approaches to contain their populations or the damage they cause vectoring viruses of medical, veterinary, or agricultural importance. Persistent insect viruses are a neglected component of their microbiota. Here for the first time, we characterize the virome associated with the two model systems for tospovirus-transmitting thrips species, of utmost importance for the direct and indirect damage they cause to a number of different crops. The thrips virome here characterized includes several novel viruses, that in some cases reveal previously undescribed clades. More importantly, some of the viruses we describe are part of a core virome that is specific and consistently present in distinct geographical locations monitored over the years, hinting at a possible mutualistic symbiotic relationship with their host.

Expansion of the Host Range of Impatiens necrotic spot virus to Peppers

2005 ◽  
Vol 6 (1) ◽  
pp. 28 ◽  
Author(s):  
Rayapati A. Naidu ◽  
Carl M. Deom ◽  
John L. Sherwood
Keyword(s):  
Host Range ◽  
Western Flower Thrips ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Weed Species ◽  
Spot Virus ◽  
Horticultural Crops ◽  
Flower Thrips ◽  
Tobacco Thrips ◽  
The U.S

This study reports the occurrence of Impatiens necrotic spot virus (INSV) on pepper under greenhouse conditions. In recent years, INSV has been detected in crops like peanut, tobacco, and potato as well as several weed species. Because INSV is vectored by western flower thrips and tobacco thrips, its expanding host range could make it an economically important problem in agricultural and horticultural crops in the U.S. Accepted for publication 11 July 2005. Published 27 July 2005.

scholarly journals Effect of Plastic Mulch Color and Insecticides on Thrips Populations and Damage to Tomato

1992 ◽  
Vol 2 (2) ◽  
pp. 208-211 ◽  
Author(s):  
Steve L. Brown ◽  
James E. Brown
Keyword(s):  
Frankliniella Occidentalis ◽  
Western Flower Thrips ◽  
Common Species ◽  
Plastic Mulch ◽  
Disease Epidemiology ◽  
Flower Thrips ◽  
Tomato Spotted Wilt ◽  
Thrips Species ◽  
Tobacco Thrips ◽  
Black Plastic

In each of 3 years, the average number of thrips in tomato (Lycopersicon esculentum L. cv. Mountain Pride) blooms was greater on tomatoes grown on white plastic mulch than on tomatoes grown on black plastic mulch, aluminum plastic mulch, or bare ground. Early season differences, however, diminished with time as plants grew and shaded a larger portion of plastic mulch. Weekly applications of 12 insecticide treatments failed to reduce thrips populations below that found in the control. No significant differences were found among treatments in the quantity, quality, or earliness of tomato yields. Incidence of tomato spotted wilt (vectored by some thrips species) was too low to detect statistical differences or determine the importance of thrips population in disease epidemiology. Western flower thrips (Frankliniella occidentalis) was the most common species found, followed by eastern flower thrips (F. tritici) and tobacco thrips (F. fusca). Thrips control, in the absence of tomato spotted wilt, is not justified for the thrips populations encountered in this study.

scholarly journals Variation in tospovirus transmission between populations of Frankliniella occidentalis (Thysanoptera: Thripidae)

1999 ◽  
Vol 89 (6) ◽  
pp. 579-588 ◽  
Author(s):  
F. van de Wetering ◽  
M. van der Hoek ◽  
R. Goldbach ◽  
C. Mollema ◽  
D. Peters
Keyword(s):  
Tomato Spotted Wilt Virus ◽  
Frankliniella Occidentalis ◽  
Western Flower Thrips ◽  
Impatiens Necrotic Spot Virus ◽  
Larval Stages ◽  
Flower Thrips ◽  
Tomato Spotted Wilt ◽  
The Usa ◽  
Tospovirus Species ◽  
Wilt Virus

AbstractFourteen populations of the western flower thrips Frankliniella occidentalis Pergande, originating from different hosts and countries in Asia, Europe, North America and New Zealand, were analysed for their competency and efficiency to transmit tomato spotted wilt virus (TSWV). All populations acquired and subsequently transmitted the virus, and were thus competent to transmit. They show marked differences in their efficiency, expressed as the percentage of transmitting adults. Efficiencies varied from 18% for a F. occidentalis population from the USA (US2) to 75% for a population from Israel (IS2). The differences between populations were not affected by the amount of virus ingested or by the host plant used. However, the tospovirus species studied and age at which the larvae acquired the virus affected the efficiency to transmit. First instar larvae of the NL3 population from The Netherlands were able to acquire tomato spotted wilt virus, whereas second instar larvae failed to do so. However, both instars of this population acquired impatiens necrotic spot virus (INSV), another tospovirus. This and tomato spotted wilt virus were both acquired by both larval stages of the populations IS2 and US2, although their ability to acquire virus decreased with their age. Hence, it is likely that, in general, both instar larvae of most F. occidentalis populations are competent to acquire both tospoviruses. These results show that large differences exist in the efficiency by which tomato spotted wilt is transmitted by the various F. occidentalis populations and that the ability to acquire tospovirus decreases with the age of the larvae

scholarly journals First Report of Impatiens necrotic spot virus in Ornamental Plants in Hungary

Plant Disease ◽  
2007 ◽  
Vol 91 (3) ◽  
pp. 331-331 ◽  
Author(s):  
E. K. Tóth ◽  
É. Kriston ◽  
A. Takács ◽  
M. Bajtek ◽  
G. Kazinczi ◽  
...  
Keyword(s):  
Frankliniella Occidentalis ◽  
Sandwich Elisa ◽  
Ornamental Plant ◽  
Thrips Tabaci ◽  
Plant Production ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Eustoma Grandiflorum ◽  
Thrips Species

Economically important viruses such as Tomato spotted wilt virus, genus Tospovirus, are transmissible mechanically and mainly by two thrips species (Thrips tabaci and Frankliniella occidentalis) in Hungary (1). Samples (31) of eight ornamental plant species (Catharanthus roseus, Cyclamen persicum, Dendranthema × grandiflorum, Eustoma grandiflorum, Gerbera sp., Impatiens walleriana, Ocimum basilicum, and Verbena hybrida) were studied. Symptoms including color breaking on flowers and necrotic symptoms on leaves were observed on four samples (C. persicum, I. walleriana, O. basilicum, and E. grandiflorum). Infection by Impatiens necrotic spot virus (INSV) was determined by double-antibody sandwich-ELISA and triple-antibody sandwich-ELISA using antisera obtained from Loewe (Sauerlach, Germany) and the DSMZ. Back inoculation with the F. occidentalis vector was also carried out to Lycopersicon esculentum as indicator plants. Back inoculation was also positive for INSV by symptoms and ELISA. The high amount of ornamental plant production together with the use of virus-infected propagation material and the increasing thrips vector populations may result in significantly increased establishment and distribution of INSV in Hungary. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997.

A Survey of Thrips (Thysanoptera) Species Infesting Cotton Seedlings in Alabama, Arkansas, Georgia, Louisiana, Mississippi, and Tennessee

2003 ◽  
Vol 38 (4) ◽  
pp. 669-681 ◽  
Author(s):  
Donald R. Cook ◽  
Charles T. Allen ◽  
Eugene Burris ◽  
Barry L. Freeman ◽  
Gary A. Herzog ◽  
...  
Keyword(s):  
Frankliniella Occidentalis ◽  
Western Flower Thrips ◽  
Common Species ◽  
Thrips Tabaci ◽  
Flower Thrips ◽  
Thrips Species ◽  
Tobacco Thrips ◽  
Plant Emergence ◽  
Neohydatothrips Variabilis ◽  
Soybean Thrips

The common species of thrips that are considered pests of cotton, Gossypium hirsutum (L.), include flower thrips, Frankliniella tritici (Fitch); tobacco thrips, Frankliniella fusca (Hinds); western flower thrips, Frankliniella occidentalis (Pergande); onion thrips, Thrips tabaci (Lindeman); and soybean thrips, Neohydatothrips variabilis (Beach). Thrips feeding on cotton seedlings can inhibit plant growth, reduce plant stand, delay crop maturity, and reduce seed-cotton yield. Surveys were conducted in Alabama, Arkansas, Georgia, Louisiana, Mississippi, and Tennessee to determine the thrips species infesting cotton seedlings during 1996 to 1999. Cotton seedlings were sampled weekly between 7 and 48 days after plant emergence at one to four field sites in each state. Over 12,000 thrips adults were collected using plant washing procedures with 9,005 individuals mounted on slides, and identified to species. The tobacco thrips was the most common species collected in all states, except Georgia, and comprised at least 63% of the thrips adults in all instances, except four. The occurrence of flower thrips and soybean thrips was variable; however, neither species accounted for more than 21% of thrips identified in each state. Western flower thrips accounted for less than 15% of adults collected in all instances except two (28% and 30%) in Louisiana. Also, individual specimens of Thrips nigropilosus Uzel and Anophothrips obscurus Müller were collected in Alabama, and several specimens of Microcephalothrips abdominalis (Crawford) were collected in Arkansas and Louisiana.

Sign in / Sign up

Export Citation Format

Share Document