scholarly journals First Report of Sinaloa Tomato Leaf Curl Geminivirus in Costa Rica

Plant Disease ◽  
1999 ◽  
Vol 83 (3) ◽  
pp. 303-303 ◽  
Author(s):  
A. M. Idris ◽  
G. Rivas-Platero ◽  
I. Torres-Jerez ◽  
J. K. Brown
Keyword(s):  
Costa Rica ◽  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Costa Rican ◽  
Tomato Leaf ◽  
First Report ◽  
The Core ◽  
Sequence Identity ◽  
Tomato Leaf Curl

In October 1998, geminivirus-like symptoms were widespread in tomato plantings near Turrialba, Costa Rica. Isolates from several fields were experimentally transmitted to tomato seedlings with whiteflies from a Bemisia tabaci (Genn.) colony maintained at CATIE, which resulted in interveinal chlorosis and leaf curling symptoms indistinguishable from those observed in the field. Total DNA was extracted from leaves of 16 of these experimentally inoculated plants and assayed by polymerase chain reaction (PCR) for the presence of begomovirus DNA with the degenerate primers AV324 and AC889 (2) to amplify the core region of the coat protein gene (core Cp). PCR yielded the expected size core Cp fragment (576 bp) from 16 of 16 samples. The core Cp fragments of six samples were cloned and sequenced. A comparison of the core Cp sequences with reference begomovirus sequences indicated all Costa Rican isolates were >95% identical to Sinaloa tomato leaf curl geminivirus reported in 1994 from Sinaloa, Mexico (STLCV-SINALOA). Virus identity was confirmed by multiple sequence alignments of the viral coat protein gene (Cp) and the common region (CR) sequences of A and B components (CR-A and CR-B), respectively, with analogous reference begomovirus sequences. Cp and CRs were obtained by PCR, and amplicons were cloned and sequenced as described (1). The Cp open reading frame (ORF; 756 nucleotides) (AF110515) identified within the A component amplicon shared 92.9% sequence identity with STLCV-SINALOA Cp (AF040635). The CR sequences of the A (AF1150516) and B (AF110517) components (163 nucleotides) shared 98.2% sequence identity with each other, suggesting that they were amplified from the cognate A and B components of the same virus. Further, the CR-A and CR-B components contained the same putative Rep binding site, TGGGGT-AA-TGGGGT, which was also identical to that of STLCV-SINALOA. The mean percent divergences between viral Cp and CR amplicons (n = 6+) ranged from 98 to 100%. Collectively, STLCV-like symptoms in tomato, >92% identity between viral Cp sequences, and identical CR iterons indicate that the Costa Rican tomato virus is STLCV, or a closely related strain. This is the first report of an STLCV-like begomovirus in tomato in Costa Rica (STLCV-CR). References: (1) A. M. Idris and J. K. Brown. Phytopathology 88:648, 1998. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals Cloning and Expression of Tomato Leaf Curl Virus Coat Protein Gene in E. coli

2018 ◽  
Vol 7 (04) ◽  
pp. 141-151
Author(s):  
S.H. Honnesh ◽  
M.S. Patil ◽  
Narayan Moger ◽  
V.P. Savalgi ◽  
L.S. Rashmi ◽  
...  
Keyword(s):  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Tomato Leaf ◽  
Cloning And Expression ◽  
E Coli ◽  
Tomato Leaf Curl Virus ◽  
Virus Coat ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus

scholarly journals First Report of Beet pseudo-yellows virus on Cucurbita moschata and C. pepo in Costa Rica

Plant Disease ◽  
2005 ◽  
Vol 89 (10) ◽  
pp. 1130-1130 ◽  
Author(s):  
R. W. Hammond ◽  
E. Hernandez ◽  
F. Mora ◽  
P. Ramirez
Keyword(s):  
Costa Rica ◽  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Nucleotide Sequence Analysis ◽  
Cucurbita Moschata ◽  
Rt Pcr ◽  
Greenhouse Whitefly ◽  
First Report ◽  
Two Samples

In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies were observed in the fields and on symptomatic plants. Although the identity of the whiteflies on the curcurbits was not determined, the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) is known to be present in the region from where the samples were obtained. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried with silica gel. Total RNA was extracted from leaf tissue of eight representative samples (two from healthy plants and six from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription-polymerase chain reactions (RT-PCR) containing one primer set at a time were performed using the Titan One-Tube RT-PCR kit (Roche Diagnostics Corp., Chicago IL) and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus (3) and the minor coat protein gene (CPm) of Beet pseudoyellows virus (BPYV) (4). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5′ GAGCGCCGCACAAGTCATC 3′ and CYHSPR 5′ TACCGCCACCAAAGTCATACATTA 3′) of Cucumber yellows virus (CYV, a strain of BPYV) (1) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows virus (2) and melon yellowing-associated flexivirus (MYVF 5′ GGCTGGCAACATGGAAACTGA 3′ and MYVR 5′ CTGAAAAGGCGATGAACTA TTGTG 3′) were used in RT-PCR reactions. Amplified DNA fragments of 333 and 452 bp were obtained in each of two samples obtained from symptomatic plants and only in separate reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of all purified PCR products verified their identity as variants of BPYV, with 97 and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples from Cucurbita moschata Duch. (ayote or squash) and Cucurbita pepo L.(escalopini or sunburst squash) were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica. References: (1) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (2) M. Juarez et al. Plant Dis. 88:907, 2004. (3) L. Rubio et al. J. Gen. Virol. 82:929, 2001. (4) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003.

Expression of the Full-length Coat Protein Gene of Tomato leaf curl Taiwan virus is Not Necessary for Recovery Phenotype in Transgenic Tomato

2012 ◽  
Vol 160 (5) ◽  
pp. 213-219 ◽  
Author(s):  
Venkatesan G. Sengoda ◽  
Wen-Shi Tsai ◽  
Robert C. De La Peña ◽  
Sylvia K. Green ◽  
Lawrence Kenyon ◽  
...  
Keyword(s):  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Tomato Leaf ◽  
Transgenic Tomato ◽  
Full Length ◽  
Tomato Leaf Curl ◽  
Leaf Curl

scholarly journals First Report of Raspberry bushy dwarf virus in Rubus multibracteatus from China

Plant Disease ◽  
2003 ◽  
Vol 87 (5) ◽  
pp. 603-603 ◽  
Author(s):  
C. J. Chamberlain ◽  
J. Kraus ◽  
P. D. Kohnen ◽  
C. E. Finn ◽  
R. R. Martin
Keyword(s):  
Amino Acid ◽  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Dwarf Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Black Raspberry ◽  
First Report ◽  
Raspberry Bushy Dwarf Virus ◽  
Plant Pathol

Raspberry bushy dwarf virus (RBDV), genus Idaeovirus, has been reported in commercial Rubus spp. from North and South America, Europe, Australia, New Zealand, and South Africa. Infection can cause reduced vigor and drupelet abortion leading to crumbly fruit and reduced yields (3,4). In recent years, Rubus germplasm in the form of seed, was obtained on several collection trips to The People's Republic of China to increase the diversity of Rubus spp. in the USDA-ARS National Clonal Germplasm Repository, (Corvallis, OR). Before planting in the field, seedlings were tested for the presence of RBDV, Tomato ringspot virus, and Tobacco streak virus using triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) (antiserum produced by R. R. Martin). One symptomless plant of R. multibracteatus H. Lev. & Vaniot (PI 618457 in USDA-ARS GRIN database), from Guizhou province in China, tested positive for RBDV (RBDV-China). After mechanical transmission on Chenopodium quinoa Willd., this isolate produced typical symptoms of RBDV (3). To determine if RBDV-China was a contaminant during the handling of the plants, or if the source was a seedborne virus, the coat protein gene was sequenced and compared to published sequences of RBDV. RNA was extracted from leaves of R. multibracteatus and subjected to reverse transcription-polymerase chain reaction (RT-PCR) using primers that flank the coat protein gene. Products from four separate PCR reactions were sequenced directly or were cloned into the plasmid vector pCR 2.1 (Invitrogen, Carlsbad, CA) and then sequenced. The coding sequence of the coat protein gene of RBDV-China was 87.5% (722/825) identical to that isolated from black raspberry (Genbank Accession No. s55890). The predicted amino acid sequences were 91.6% (251/274) identical. Previously, a maximum of five amino acid differences had been observed in the coat proteins of different RBDV strains (1). The 23 differences observed between RBDV-China and the isolate from black raspberry (s55890) confirm that the RBDV in R. multibracteatus is not a greenhouse contaminant but is indeed a unique strain of RBDV. In addition, monoclonal antibodies (MAbs) to RBDV (2) were tested against RBDV-China. In these tests, MAb D1 did not detect RBDV-China, whereas MAb R2 and R5 were able to detect the strain. This is the first strain of RBDV that has been clearly differentiated by MAbs using standard TAS-ELISA tests. Although RBDV is common in commercial Rubus spp. worldwide, to our knowledge, this is the first report of RBDV in R. multibracteatus, and the first report of RBDV from China. The effects of this new strain of RBDV could be more or less severe, or have a different host range than previously studied strains. It is more divergent from the type isolate than any other strain that has been studied to date. Phylogenetic analysis of coat protein genes of RBDV may be useful in understanding the evolution and spread of this virus. References: (1) A. T. Jones et al. Eur. J. Plant Pathol. 106:623, 2000. (2) R. R. Martin. Can. J. Plant. Pathol. 6:264, 1984. (3) A. F. Murant. Raspberry Bushy Dwarf. Page 229 in: Virus Diseases of Small Fruits. R. H. Converse, ed. U.S. Dep. Agric. Agric. Handb. 631, 1987. (4) B. Strik and R. R. Martin. Plant Dis. 87:294, 2003.

scholarly journals First Report of Cherry virus A and Little cherry virus-1 in Poland

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 909-909 ◽  
Author(s):  
B. Komorowska ◽  
M. Cieślińska
Keyword(s):  
Nucleotide Sequence ◽  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Germplasm Collection ◽  
Mottle Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
First Report ◽  
Primer Sets

Cherry virus A (CVA), a member of the genus Capillovirus, has been reported in sweet cherry in Germany, Canada, and Great Britain. No data are available on the effects of CVA on fruit quality and yield of infected trees. Little cherry disease (LChD) occurs in most cherry growing areas of the world. Symptoms on sensitive cultivars include discolored fruit that remain small, pointed in shape, and tasteless. Three Closterovirus spp. associated with LChD have been described (Little cherry virus-1 [LChV-1], LChV-2, and LChV-3). Diseased local and commercial cultivars of sour cherry trees were found in a Prunus sp. germplasm collection and orchards in Poland during the 2003 growing season. The foliar symptoms included irregular, chlorotic mottling, distortion, and premature falling of leaves. Some of the diseased trees developed rosette as a result of decreased growth and shortened internodes. Severely infected branches exhibited dieback symptoms. Because the symptoms were suggestive of a possible virus infection, leaf samples were collected from 38 trees and assayed for Prune dwarf virus and Prunus necrotic ringspot virus using double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). RNA extracted from leaves was used in a reverse transcription-polymerase chain reaction (RT-PCR) with the One-Step RT-PCR with Platinum Taq (Invitrogen Life Technologies) and primer sets specific for CVA (1), LChV-1 (3), and LChV-2 (3). The RNA samples were also tested using RT-PCR for detection of Cherry mottle leaf virus (CMLV), Cherry necrotic rusty mottle virus (CNRMV), and Cherry green ring mottle virus (CGRMV) with specific primer sets (2). Amplification of a 397-bp coat protein gene product confirmed infection of 15 trees with CVA. A 419-bp fragment corresponding to the coat protein gene of LChV-1 was amplified from cv. Gisela rootstock and local cv. WVIII/1. To confirm RT-PCR results, CVA amplification products from local cv. WX/5 and LChV-1 from cvs. Gisela and WVIII/1 were cloned in bacterial vector pCR 2.1-TOPO and then sequenced. The sequences were analyzed with the Lasergene (DNASTAR, Madison, WI) computer program. The alignment indicated that the nucleotide sequence of cv. WX/5 was closely related to the published sequences of CVA (Genbank Accession No. NC_003689) and had an 89% homology to the corresponding region. The nucleotide sequence similarity between the 419-bp fragment obtained from cvs. Gisela and WVIII/1 was 87% and 91%, respectively, compared with the reference isolate of LChV-1 (Genbank Accession No. NC_001836). The sampled trees tested negative for LChV-2, CGRMV, CMLV, and CNRMV using RT-PCR. Some trees tested positive for PNRSV and PDV. To our knowledge, this is the first report of CVA and LChV-1 in Poland. References: (1) D. James and W. Jelkmann. Acta Hortic. 472:299, 1998. (2) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411,2001. (3) M. E. Rott and W. Jelkmann. Phytopathology. 91:61, 2001.

scholarly journals Biological, Pathological, and Molecular Characteristics of a New Potyvirus, Dendrobium Chlorotic Mosaic Virus, Infecting Dendrobium Orchid

Plant Disease ◽  
2019 ◽  
Vol 103 (7) ◽  
pp. 1605-1612 ◽  
Author(s):  
Chih-Hung Huang ◽  
Chia-Hsing Tai ◽  
Ruey-Song Lin ◽  
Chung-Jan Chang ◽  
Fuh-Jyh Jan
Keyword(s):  
Amino Acid ◽  
Nucleotide Sequence ◽  
Coat Protein ◽  
Amino Acid Sequence ◽  
Mosaic Virus ◽  
Coat Protein Gene ◽  
Nucleotide Sequence Identity ◽  
Amino Acid Sequence Identity ◽  
Protein Gene ◽  
Sequence Identity

Dendrobium smillieae is one of the popular orchids in Taiwan. This report describes a new potyvirus tentatively named Dendrobium chlorotic mosaic virus (DeCMV) causing chlorotic and mosaic symptoms in D. smillieae. Enzyme-linked immunosorbent assay (ELISA) tests using six antisera against orchid-infecting viruses revealed that only a monoclonal antibody against the potyvirus group reacted positively with crude saps prepared from a symptomatic dendrobium orchid. Potyvirus-like, flexuous, filamentous particles were observed under an electron microscope, measuring approximately 700 to 800 nm in length and 11 to 12 nm in diameter. Sequence analyses revealed that DeCMV coat protein gene shared 59.6 to 66.0% nucleotide sequence identity and 57.6 to 66.0% amino acid sequence identity, whereas the DeCMV complete genome shared 54.1 to 57.3% nucleotide sequence identity and 43.7 to 49.5% amino acid sequence identity with those other known potyviruses. These similarity levels were much lower than the criteria set for species demarcation in potyviruses. Thus, DeCMV can be considered a new potyvirus. The whole DeCMV genome contains 10,041 nucleotides (GenBank accession no. MK241979) and encodes a polyprotein that is predicted to produce 10 proteins by proteolytic cleavage. In a pathogenicity test, results of inoculation assays demonstrated that DeCMV can be transmitted to dendrobium orchids by grafting and mechanical inoculation, as verified by ELISA and western blot analyses using the DeCMV polyclonal antiserum and by reverse transcription polymerase chain reaction using the coat protein gene-specific primers. The inoculated orchids developed similar chlorotic and mosaic symptoms. In conclusion, DeCMV is a novel orchid-infecting potyvirus, and this is the first report of a new potyvirus that infects dendrobium orchids in Taiwan.

scholarly journals Sequence diversity in the coat protein gene of Lettuce big-vein associated virus and Mirafiori lettuce big-vein virus infecting lettuce in Brazil

2008 ◽  
Vol 34 (2) ◽  
pp. 175-177 ◽  
Author(s):  
Márcio Martinello Sanches ◽  
Renate Krause-Sakate ◽  
Marcelo Agenor Pavan
Keyword(s):  
Amino Acid ◽  
Coat Protein ◽  
Amino Acid Sequence ◽  
Coat Protein Gene ◽  
Amino Acid Sequence Identity ◽  
Restriction Site ◽  
Protein Gene ◽  
Sequence Identity ◽  
Disease Analysis ◽  
Vein Disease

Lettuce big vein associated virus (LBVaV) and Mirafiori lettuce big vein virus (MLBVV) have been found in mixed infection in Brazil causing the lettuce big vein disease. Analysis of part of the coat protein (CP) gene of Brazilian isolates of LBVaV collected from lettuce, showed at least 93% amino acid sequence identity with other LBVaV isolates. Genetic diversity among MLBVV CP sequences was higher when compared to LBVaV CP sequences, with amino acid sequence identity ranging between 91% to 100%. Brazilian isolates of MLBVV belong to subgroup A, with one RsaI restriction site on the coat protein gene. There is no indication for a possible geografical origin for the Brazilian isolates of LBVaV and MLBVV.

scholarly journals First Report of Cucurbit yellow stunting disorder virus on Melon in China

Plant Disease ◽  
2010 ◽  
Vol 94 (4) ◽  
pp. 485-485 ◽  
Author(s):  
L. Z. Liu ◽  
Y. Y. Chen ◽  
W. M. Zhu
Keyword(s):  
Coat Protein ◽  
Coat Protein Gene ◽  
Fragment Length ◽  
Protein Gene ◽  
Disease Incidence ◽  
Rt Pcr ◽  
First Report ◽  
Genes Encoding ◽  
Pcr Products ◽  
Symptomatic Leaf

Melon (Cucumis melo L.) plants in commercial fields in Shanghai, Jiangsu, and Zhejiang exhibited stunting, deformation, interveinal chlorosis, and leaf mottling in the spring of 2008. In addition, adult and immature whiteflies (Bemisia tabaci biotype B) were present in these melon fields. Thirty-two symptomatic leaf samples were collected from these fields for further analysis (9 from Nanhui County in Shanghai, 11 from Fengxian County in Shanghai, 6 from Kunshan County of Jiangsu, and 6 from Jiashan County of Zhejiang). Total RNA was extracted from these samples along with asymptomatic control plants and screened for the presence of Cucurbit yellow stunting disorder virus (CYSDV) by using primers specific to genes encoding coat protein (2) and HSP70h (1) of CYSDV through reverse transcription (RT)-PCR methods. RNA was successfully extracted from 31 of 32 symptomatic samples. All 31 symptomatic leaf samples tested with coat protein primers were positive for CYSDV and yielded the expected fragment length of 394 bp. The RT-PCR products of the coat protein gene from all 31 isolates were cloned and found to be identical in sequence. Thus, only one was deposited in GenBank (No. GU189240). The submitted sequence of the amplified part of the coat protein gene was 99% identical to the sequence of coat protein gene of CYSDV from Jordan, France, and Florida (GenBank Accession Nos. DQ903107, AY204220, and EU596528, respectively) and 98% identical to that of an isolate from Spain (GenBank Accession No. AJ243000). Similarly, all 31 samples were also positive for CYSDV with the primers specific to HSP70h and yielded the expected fragment length of 175 bp. The RT-PCR products of the HSP70h gene from these isolates were also cloned and found to be identical in sequence. The sequence of the amplified portion of the HSP70h gene was found to be identical to the sequence of HSP70h of CYSDV deposited in GenBank (No. AJ439690.2). CYSDV was noticed in all three surveyed regions and the percentage of disease incidence was approximately 68% in all these regions. The occurrence of CYSDV has been previously reported in Europe (Spain and France), southern Asia (Iran and Jordan), North America (United States and Mexico), and other countries (1). To our knowledge, this is first report of CYSDV in China. References: (1) Y.-W. Kuo et al. Plant Dis. 91:330, 2007. (2) J. E. Polston et al. Plant Dis. 92:1251, 2008.

scholarly journals First Report of Turnip mosaic virus in Rhubarb in Alaska

Plant Disease ◽  
2005 ◽  
Vol 89 (4) ◽  
pp. 430-430 ◽  
Author(s):  
N. L. Robertson ◽  
D. C. Ianson
Keyword(s):  
Coat Protein ◽  
Host Range ◽  
Mosaic Virus ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Turnip Mosaic Virus ◽  
The Arctic ◽  
Enzyme Linked Immunosorbent Assay ◽  
Mechanical Transmission ◽  
First Report

In July 2003, noticeable red lesions were observed on rhubarb leaves (Rheum rhababarum cv. Kerwin) from a plant at the Arctic Plant Germplasm Research and Introduction Project in Palmer, AK. Extracts of leaf tissue tested positive for a potyvirus using indirect enzyme-linked immunosorbent assay (ELISA) and western blots with a monoclonal antibody specific to the potyvirus group (Agdia, Inc., Elkhart, IN). During the following growing season (June 2004), obvious chlorotic ringspots developed into red lesions on the same plant and an adjacent plant of the same cultivar. Partially purified particles that were isolated from the infected rhubarb plants were mechanically inoculated to an experimental host range (number of infected plants per total number of plants), resulting in lesions on leaves of Rheum palmatum (1 of 2) and Chenopodium amaranticolor (3 of 5) but none on C. quinoa (0 of 4). The leaves with local lesions from C. amaranticolor were ground in phosphate buffer (1 g of tissue per 10 ml of buffer), and the extract rubbed onto a set of plants resulting in lesions on R. hybridum (raponticum) (1 of 2), C. amaranticolor (1 of 4), and C. quinoa (1 of 4). The original diseased rhubarb plants and experimental symptomatic plants were confirmed to have a potyvirus using ELISA. Subsequent compound direct ELISA and western blot assays revealed that the virus reacted strongly to monoclonal or polyclonal antibodies to Turnip mosaic virus (TuMV) (Agdia, Inc.). Total RNA was extracted from leaves of the naturally infected rhubarb plants with an RNeasy Plant Mini Kit (Qiagen Sciences, Germantown, Maryland), and used in reverse-transcription-polymerase chain reaction (RT-PCR) with specific primers for TuMV (1) predicted to amplify a 1,134-bp 3′-terminal cDNA fragment encompassing the 3′-end of the nuclear inclusion protein gene (NIb), the coat protein gene, and the 3′-nontranslated region. A PCR product of approximately the expected size was obtained and then sequenced. Sequences (1,077 nt) that corresponded to the TuMV coat protein gene and 3′-terminal noncoding region were submitted to Genbank (Accession No. AY744930). Blast searches against NCBI (National Center for Biotechnology Information) contained high identities to many TuMV isolates with up to 96% (1,043 of 1,077) nucleotide identity (i.e., GenBank Accession No. AF169561). Similar high identities of up to 97% at the amino acid level occurred within the coat protein coding region (i.e., GenBank Accession No. BAC02892.1). Infected rhubarb plants were removed from the site and none of the remaining 109 plants tested positive for TuMV using ELISA. On the basis of the mechanical transmission to plant hosts, the definitive TuMV serology, and the consensus of sequenced regions with TuMV, we concluded that the causal agent of the diseased rhubarb plants was TuMV. Although TuMV has a wide plant host range occurring worldwide (2), to our knowledge, this is the first report of TuMV in rhubarb in Alaska and the first time that TuMV has been detected in Alaska. References: (1) P. Lehmann et al. Physiol. Mol. Plant Pathol. 51:195, 1997. (2) R. Provvidenti. Page 1340 in: Viruses of Plants. A. A. Brunt et al., eds. CAB International, Wallingford, UK, 1996.

Sign in / Sign up

Export Citation Format

Share Document