scholarly journals Molecular Characterization of a Distinct Tomato-Infecting Begomovirus Associated with Yellow Leaf Curl Diseased Tomato in Lembang, Java Island of Indonesia

Plant Disease ◽  
2006 ◽  
Vol 90 (6) ◽  
pp. 831-831 ◽  
Author(s):  
W. S. Tsai ◽  
S. L. Shih ◽  
S. K. Green ◽  
D. Akkermans ◽  
F.-J. Jan
Keyword(s):  
Nucleotide Sequence ◽  
Satellite Dna ◽  
Pairwise Comparison ◽  
International Committee ◽  
Tomato Yellow Leaf ◽  
Full Length ◽  
Open Reading Frames ◽  
Yellow Leaf ◽  
Tomato Leaf Curl ◽  
Leaf Curl

Three distinct tomato-infecting begomoviruses have been identified from Indonesia (GenBank Accessions Nos. AB100304, AB100305, and DQ083765). Severe yellow leaf curl epidemics have been observed on tomato on Java Island since the late 1990s. Viral DNA was extracted (2) from one such sample collected in Lembang, West Java in 1998. Polymerase chain reaction with previously described primers was used to detect the presence of geminiviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). The predicted 1.4-kb DNA-A fragment was amplified with the general primer pair PAL1v1978/PAR1c715 and then cloned and sequenced. DNA-B and satellite DNA were not detected in the sample. On the basis of the partial DNA-A sequences, specific primers were designed to amplify and sequence the complete DNA-A component (2,762 nucleotides, GenBank Accession No. AF189018). The DNA-A sequence contained the geminivirus-conserved nanosequence TAATATTAC in the loop of the hairpin structure of the intergenic region and six open reading frames including two in the virus sense and four in the complementary sense. Pairwise comparison of the full-length DNA-A sequence with those of other begomoviruses available in the GenBank database was done by the MegAlign software (DNASTAR, Inc, Madison, WI). Highest nucleotide sequence identity (74.1%) was with Tomato leaf curl Mayotte virus-[Kahani] (GenBank Accession No. AJ865340). Comparison of the full-length DNA-A sequence with the three above mentioned tomato-infecting begomoviruses from Indonesia also showed less than 71% nucleotide sequence identities. Because the DNA-A sequence had less than 89% identity with other begomoviruses, it should be classified as a distinct virus according to the International Committee on Taxonomy of Viruses. The name Tomato yellow leaf curl Indonesia virus-[Lembang] (TYLCIDV-[Lem]) is proposed. The presence of at least four distinct tomato-infecting begeminiviruses on Java Island needs to be considered when developing tomato cultivars with stable resistance to tomato (yellow) leaf curl disease. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals Molecular Characterization of Pepper yellow leaf curl Indonesia virus in Leaf Curl and Yellowing Diseased Tomato and Pepper in Indonesia

Plant Disease ◽  
2006 ◽  
Vol 90 (2) ◽  
pp. 247-247 ◽  
Author(s):  
W. S. Tsai ◽  
S. L. Shih ◽  
S. K. Green ◽  
A. Rauf ◽  
S. H. Hidayat ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Dna Sequences ◽  
Satellite Dna ◽  
Full Length ◽  
Open Reading Frames ◽  
Natural Occurrence ◽  
Yellow Leaf ◽  
Sequence Comparisons ◽  
Sequence Identities ◽  
Leaf Curl

Yellowing and leaf curl symptoms were observed in tomato and pepper fields near Bogor, Java, Indonesia in 2000. Samples were collected from one diseased tomato (Lycopersicum esculentum) and three diseased chili pepper (Capsicum annuum) plants. Viral DNA was extracted (2) and tested for the presence of geminiviral DNA-A, DNA-B, and associated satellite DNA using polymerase chain reaction (PCR) with previously described primers (1,3,4). The begomovirus DNA-A general primer pair PAL1v1978/PAR1c715 amplified the predicted 1.4-kb DNA fragment from the tomato and two of the chili samples. DNA-B and satellite DNA were not detected using PCR with DNA-B general primer pairs (DNABLC1/DNABLV2 and DNABLC2/DNABLV2) and satellite detection primer pair (Beta01/Beta02). The amplicons from the tomato and from one of the chili samples were cloned and sequenced. On the basis of the 1.4-kb DNA sequences, specific primers were designed to complete the DNA-A sequences. Following sequence assembly, the full-length DNA-A nucleotide sequences were determined as 2,744 nt (GenBank Accession No. DQ083765) for the tomato- and 2,743 nt (GenBank Accession No. DQ083764) for the chili-infecting begomoviruses. Sequence comparisons and analyses were conducted using the DNAMAN sequence analysis software (Lynnon Corporation, Quebec, Canada). The DNA-A of both begomoviruses contained six open reading frames, including two in the virus sense and four in the complementary sense, and the geminivirus conserved nanosequence-TAATATTAC in the loop of the hairpin structure of the intergenic region. Because of their high nucleotide sequence identities of 99%, the tomato- and chili-infecting begomovirus are considered the same virus. When compared by using BLAST with available gem-iniviral sequences in the GenBank database, the DNA-A sequences of the tomato and the chili isolates showed highest nucleotide sequence identity (95%) with the partially sequenced Pepper yellow leaf curl Indonesia virus (GenBank Accession No. AB189849) in the 1,842 nt to 660 nt region and in the 1,841 nt to 659 nt region, respectively. Comparisons with full-length DNA-A sequences of begomoviruses available in the GenBank database indicated high sequence identities of 76 and 77% for the tomato and chili isolates, respectively, with an eggplant isolate of Tomato yellow leaf curl Kanchanaburi virus (GenBank Accession No. AF511530) from Thailand. According to our knowledge, this is the first report of full-length DNA-A sequence of the Pepper yellow leaf curl Indonesia virus and its natural occurrence in tomato and pepper in the Bogor area of Indonesia. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals First Report of Tomato yellow leaf curl Thailand virus in Taiwan

Plant Disease ◽  
2007 ◽  
Vol 91 (10) ◽  
pp. 1363-1363 ◽  
Author(s):  
F.-J. Jan ◽  
S. K. Green ◽  
S. L. Shih ◽  
L. M. Lee ◽  
H. Ito ◽  
...  
Keyword(s):  
Satellite Dna ◽  
Positive Sample ◽  
Tomato Yellow Leaf ◽  
Tomato Leaf ◽  
Nucleotide Identity ◽  
Yellow Leaf ◽  
Viral Dna ◽  
First Report ◽  
Tomato Leaf Curl ◽  
Leaf Curl

During the 2006 winter and 2007 spring seasons, tomato lines carrying the Ty2 gene, which confers resistance to the Tomato leaf curl Taiwan virus (GenBank Accession No. U88692), showed severe yellowing, leaf curl, and stunting symptoms in several locations in Tainan County, Taiwan. Whiteflies were found to be associated with symptomatic plants, and disease incidences of almost 100% were observed. The presence of a new resistance breaking begomovirus was suspected. Six symptomatic leaf samples of three different tomato plants from each infected field were collected in Liouying (LY3, 7, and 8) and Sigang (SG9, 13, and 18) townships in Tainan County. Viral DNAs were extracted (2), and PCR with previously described primers was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in all tested samples. The PCR-amplified 1.5-kb viral DNA-A from one positive sample from each location (LY3 and SG18) was cloned and sequenced. On the basis of the 1.5 kb DNA-A sequences, specific primers were designed for cloning and sequencing the complete viral DNA-A, which was 2,744 bp for both the Liouying (GenBank Accession No. EF577266) and Sigang (GenBank Accession No. EF577264) isolates. Sequence analyses were conducted with DNAMAN sequence analysis software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of both isolates contained the conserved nanonucleotides-TAATATTAC and six open reading frames, including two in the virus sense (AV1 and AV2) and four in the complementary sense (AC1 to AC4). On the basis of their 99.5% nucleotide identity, they are considered isolates of the same species. BLASTn analysis and sequence comparison with those available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the two isolates had the highest nucleotide identity (more than 98.4%) with the DNA-A of the Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Accession No. AY514631). Virus-associated satellite DNA was not found in any of the samples. However, DNA-B was detected in all six samples, providing further evidence that the two isolates were the same as the bipartite TYLCTHV. All samples, except the LY3, were also found to be infected with Tomato leaf curl Taiwan virus (ToLCTWV), as indicated by a positive PCR reaction using the ToLCTWV-specific primer pair KD-PAV1 (5′ATCGTGTTGGGAAGAGGTTT3′) and KD-PAC1 (5′GGAGAAAGCTCCCAAAGATT3′). A pure TYLCTHV isolate of LY3 was obtained in Lycopersicum esculentum TK70 by transmission with Bemisia tabaci Biotype B. The isolated TYLCTHV was found to infect L. esculentum H24 (resistant to ToLCTWV) and induce typical yellow leaf curl symptoms. To our knowledge, this is the first report of the presence of TYLCTHV in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Tomato yellow leaf curl disease in Guangdong is caused by Tomato leaf curl Taiwan virus

2007 ◽  
Vol 4 (2) ◽  
pp. 127-131 ◽  
Author(s):  
He Zi-Fu ◽  
Yu Hao ◽  
Mao Ming-Jie ◽  
Luo Fang-Fang ◽  
Lin Yi-Han ◽  
...  
Keyword(s):  
Intergenic Region ◽  
Virus Isolate ◽  
Tomato Yellow Leaf ◽  
Tomato Leaf ◽  
Yellow Leaf ◽  
Sequence Identity ◽  
Begomovirus Genome ◽  
Tomato Leaf Curl ◽  
Leaf Curl Disease ◽  
Leaf Curl

AbstractA yellow leaf curl disease with chlorotic and yellowish leaves, upward leaf curling and stunting symptoms was observed on tomato in Shantou city of Guangdong province. A virus isolate BS was obtained from a diseased tomato plant. The complete DNA-A sequence of the virus isolate BS was determined to be 2740 nucleotides long, with all the characteristic features of begomovirus genome organization. BS DNA-A encoded six potential open reading frames (ORFs), with two (AV1 and AV2) in virus sense and four (AC1, AC2, AC3 and AC4) in complementary sense, and contained an intergenic region of 269 nucleotides. The results of BLAST searches showed that BS DNA-A had higher sequence identity with reported begomoviruses in Asia than with those in America and Africa. Further sequence comparisons indicated that BS was most closely related to the isolate of Tomato leaf curl Taiwan virus (ToLCTWV-[Taiwan]) with a sequence identity of 97.7%. Nucleotide sequence identities of AV1, AV2, AC1, AC2, AC3, AC4 and intergenic region (IR) between BS and ToLCTWV-[Taiwan] were 98.6, 98.0, 98.0, 97.5, 96.3, 98.6 and 96.6%, respectively, while that of the six ORF-encoded proteins between BS and ToLCTWV-[Taiwan] were 97.7, 99.1, 97.5, 95.6, 91.8 and 99.0%, respectively. Phylogenetic analysis based on the DNA-A sequences has also indicated that BS is most closely related to ToLCTWV-[Taiwan], forming a branch with ToLCTWV-[Taiwan], Tomato leaf curl Guangdong virus and Tomato yellow leaf curl Guangdong virus. The above results demonstrate that BS is an isolate of ToLCTWV.

scholarly journals Tomato Yellow Leaf Curl Sardinia Virus, a Begomovirus Species Evolving by Mutation and Recombination: A Challenge for Virus Control

Viruses ◽  
2019 ◽  
Vol 11 (1) ◽  
pp. 45 ◽  
Author(s):  
Juan A. Díaz-Pendón ◽  
Sonia Sánchez-Campos ◽  
Isabel María Fortes ◽  
Enrique Moriones
Keyword(s):  
Tomato Yellow Leaf ◽  
Sequence Information ◽  
Yellow Leaf ◽  
Biological Behaviour ◽  
Tomato Production ◽  
Tropical Regions ◽  
Tomato Leaf Curl Disease ◽  
Genotype Interaction ◽  
Tomato Leaf Curl ◽  
Leaf Curl

The tomato leaf curl disease (TYLCD) is associated with infections of several species of begomoviruses (genus Begomovirus, family Geminiviridae) and causes severe damage to tomatoes throughout tropical and sub-tropical regions of the world. Among others, the Tomato yellow leaf curl Sardinia virus (TYLCSV) species causes damage in the Mediterranean Basin since early outbreaks occurred. Nevertheless, scarce information is available about the diversity of TYLCSV. Here, we study this aspect based on the sequence information accessible in databases. Isolates of two taxonomically differentiated TYLCSV strains can be found in natural epidemics. Their evolution is mostly associated with mutation combined with selection and random genetic drift and also with inter-species recombination which is frequent in begomoviruses. Moreover, a novel putative inter-strain recombinant is reported. Although no significantly new biological behaviour was observed for this latter recombinant, its occurrence supports that as shown for other related begomoviruses, recombination continues to play a central role in the evolution of TYLCD-associated viruses and the dynamism of their populations. The confrontation of resistant tomatoes with isolates of different TYLCD-associated viruses including the novel recombinant demonstrates the existence of a variable virus x plant genotype interaction. This has already been observed for other TYLCD-associated viruses and is a challenge for the control of their impact on tomato production.

scholarly journals Molecular Characterization of a Distinct Begomovirus Associated with Tomato Leaf Curl Disease in Arusha of Tanzania

Plant Disease ◽  
2006 ◽  
Vol 90 (12) ◽  
pp. 1550-1550 ◽  
Author(s):  
S. L. Shih ◽  
W. S. Tsai ◽  
S. K. Green ◽  
L. M. Lee
Keyword(s):  
International Committee ◽  
Tomato Leaf ◽  
Open Reading Frames ◽  
Specific Primers ◽  
Sequence Comparisons ◽  
Tomato Leaf Curl Disease ◽  
Sequence Identity ◽  
Two Samples ◽  
Tomato Leaf Curl ◽  
Leaf Curl

Mild leaf curling and yellowing symptoms were observed in approximately 5% of 1-month-old tomato plants (Solanum lycopersicum) in a farmer's field in Tengeru, Arusha, Tanzania in January 2006. DNA was extracted from four symptomatic and five asymptomatic plants and tested for the presence of begomovirus by polymerase chain reaction (PCR) using primer pair PAL1v1978/PAR1c715 (4). All asymptomatic samples were negative. Two of four symptomatic samples yielded the expected 1.4-kb DNA-A fragment for begomovirus. DNA-B was not detected in these two samples by PCR using the DNA-B degenerate primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2), and PBL1v2040/PCRc1 and PBL1v2040/PCRc154 (4). DNA-beta was also not detectable using DNA-beta specific primers (1). The 1.4-kb PCR product from one sample was cloned and sequenced. On the basis of the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,766 nucleotides (Genbank Accession No. DQ519575) and was found to contain the geminiviral conserved nanosequence-TAATATTAC in the intergenic region and the six predicted open reading frames (V1, V2, C1, C2, C3, and C4). BLAST analysis was conducted with geminivirus sequences available in GenBank, and MegAlign software (DNASTAR, Inc, Madison, WI) was used for further comparisons. Highest sequence identity (84%) was with the partially sequenced Tomato leaf curl Tanzania virus found in Makutupora, Tanzania in 1994 (1,523 nucleotides, Genbank Accession No. U73498) in the 1,919 nt to 679 nt region. Low sequence identity (78%) was noted with Tomato yellow leaf curl Sardinia virus (Genbank Accession No. X61153) that is reportedly prevalent in Arusha, Morogoro, Dodoma, Iringa, Kilimanjaro, and Dar es Salaam of Tanzania (3). Comparison of the nucleotide sequence of this new virus with those of full-length begomoviral DNA-A available in GenBank indicated highest sequence identity (81%) with Tomato leaf curl Mayotte virus (EMBL Accession No. AJ865341). On the basis of the DNA-A sequence comparisons and the International Committee on Taxonomy of Viruses proposed species demarcation of 89% sequence identity, the tomato leaf curl virus from Arusha, Tanzania constitutes a distinct begomovirus and the name Tomato leaf curl Arusha virus is proposed. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) B. D. Kashina et al. Arch. Phytopathol. Plant Prot. 35:255, 2002 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Sign in / Sign up

Export Citation Format

Share Document