First Report of Rhizoctonia spp. Causing a Root Rot of the Invasive Rangeland Weed Lepidium draba in North America

The exotic, invasive perennial rangeland weed Lepidium draba spreads rapidly and reduces native species diversity. The extensive root system of L. draba constitutes 76% of its biomass (4). Thus, searches have been done for biocontrol agents that target root tissue or that may interact with a weevil, Ceutorhynchus assimilis, that causes galls in the crown area of L. draba. An association of Rhizoctonia spp. with root tissue of plants galled by the weevil has been documented in Europe (3). The possible presence of soilborne pathogens similar to those found in the native range has been the subject of L. draba surveys in the United States. One such survey in 2008 detected a few plants with reddened and chlorotic foliage in a stand near Shepherd, MT. Such symptoms typically indicate the occurrence of soilborne diseases on L. draba in the native range of the weed (2). The site had shown a gradual increase in the range of detectable pathogens beginning with foliar pathogens in 1997. In 2010, at the Shepherd site, L. draba plants with similar (but more severe) symptoms to those seen in 2008 were noted in a different area of the stand. Excavation of the roots in both years revealed brown, sunken crown and root cankers. Pieces of root tissue were excised from the lesions and plated on acidified PDA and Ko and Hora medium. A non-sporulating fungus was isolated from three plants. Colonies of the isolates on PDA were typical of known Rhizoctonia spp. The 2010 isolates were determined to be multinucleate using DAPI and were paired with 14 tester (including subgroups) isolates of AG-1 to AG-4 on water agar. Anastomosis was observed between the multinucleate isolates and the AG-2-1 tester isolate. Sequence analysis of ITS of the rDNA of a multinucleate isolate (GenBank KJ545577) indicated 99% similarity with an accession of R. solani AG 2-1 (AB547381). The 2008 isolates were binucleate. A binucleate isolate, KJ545578, had 100% similarity with an isolate of Rhizoctonia spp. AG-A (AY927356). Pathogenicity tests consisted of planting 6-week-old seedlings of L. draba, one per pot, in ten 85-cm-diameter pots of pasteurized soil mix infested with Rhizoctonia-colonized barley grain that had been dried and milled. An inoculum level of ~8 CFU/g (1) of air-dried soil was established by most probable number calculations from fourfold dilutions of infested soil. Controls were the same number of plants in pasteurized potting mix. Results were recorded after 3 months in a greenhouse at 20–25°C. The test was repeated. Typically, R. solani caused mortality of six to eight plants, from which it was re-isolated, whereas binuclate isolates caused stunting and lower dry weight of L. draba. Control plants remained asymptomatic. This is the first report of R. solani and binucleate Rhizoctonia spp. on L. draba in North America. References: (1) A. J. Caesar et al. Plant Dis. 93:1350, 2009. (2) A. J. Caesar et al. Biol. Control 52:140, 2010. (3) A. J. Caesar et al. Plant Dis. 96:145, 2011. (4) R. F. Miller et al. Agronomy J. 86:487, 1994.

Download Full-text

First Report of a Root and Crown Disease Caused by Rhizoctonia solani on Centaurea stoebe in Russia

Plant Disease ◽

10.1094/pdis-93-12-1350a ◽

2009 ◽

Vol 93 (12) ◽

pp. 1350-1350

Author(s):

A. J. Caesar ◽

R. T. Lartey ◽

T. Caesar-TonThat

Keyword(s):

Rhizoctonia Solani ◽

Plant Pathogens ◽

The United States ◽

Economic Losses ◽

Most Probable Number ◽

Infested Soil ◽

Spotted Knapweed ◽

Centaurea Stoebe ◽

Probable Number ◽

First Report

Spotted knapweed (SKW), Centaurea stoebe L., is a nonindigenous species that is invasive over large areas in the United States, especially in the west. It has been estimated that infestations of SKW cause $42 million in direct and indirect economic losses annually (2), and the weed could potentially invade 13.6 million ha of rangeland in Montana alone. Extensive efforts toward the control of SKW have included the release of 12 insects for biological control, four of which attack the crowns and roots of this short-lived perennial. To focus efforts to select potential soilborne pathogens, which could be applied in combination with insects, we conducted a survey for plant pathogens in the native range of SKW associated with damage caused by any root-attacking insects. Stunted and chlorotic SKW plants, which were colonized by larvae of Cyphocleonus spp., were found in June 1994 near the Novomar'evskaya Botanical Sanctuary (45°08′49.87″N, 41°51′02.05″E) in the Caucasus Region of Russia. A nonsporulating multinucleate fungus was isolated from the lower stem, crown, and upper root tissue of one such plant. Colonies growing on potato dextrose agar and Ko and Hora media were examined microscopically and identified as Rhizoctonia solani by the occurrence of robust, thick-walled, golden hyphae with right-angled branching and constrictions at the branch points. The anastomosis grouping of the one isolate was determined to be AG 2-2 IIIB after pairing it on water agar with 11 AG tester isolates representing all subgroups of AG 1 to AG 5. The hyphal diameter at the obvious point of anastomosis was reduced and cell death of adjacent cells was observed. In 2007, pathogenicity was determined by planting 12-week-old seedlings of SKW, one per pot, into 20 15-cm-diameter pots of a steamed greenhouse soil mix composed of sphagnum peat, sand, and Bozeman silt loam (1:1:1, vol/vol), pH 6.6, infested with R. solani-colonized barley grain that had been dried and milled. An inoculum level of 8 CFU/g of air-dried soil was determined by most probable number calculations from fourfold dilutions of infested soil. Controls were planted into noninfested soil. In both greenhouse tests, the isolate caused either mortality or a 93% mean fresh weight reduction of surviving plants, relative to the controls, after 8 months. R. solani was reisolated from necrotic root and crown tissue of dead and stunted plants but not from the controls. To our knowledge, this is the first report of R. solani occurring on SKW in Europe. The characterization and pathogenicity of Fusarium spp. isolated from insect-colonized roots of SKW in Europe was reported previously (1). References: (1) A. J. Caesar et al. BioControl 47:217. (2) S. A. Hirsch and J. A. Leitch, North Dakota Agricultural Economics Report No. 355. NDSU, Fargo. 1996.

Download Full-text

First Report of a Leaf Spot Caused by Alternaria brassicae on the Invasive Weed Lepidium draba in North America

Plant Disease ◽

10.1094/pdis-93-8-0846a ◽

2009 ◽

Vol 93 (8) ◽

pp. 846-846 ◽

Cited By ~ 1

Author(s):

A. J. Caesar ◽

R. T. Lartey

Keyword(s):

North America ◽

Chinese Cabbage ◽

Leaf Spot ◽

The United States ◽

Alternaria Brassicae ◽

Voucher Specimen ◽

First Report ◽

Leaf Spots ◽

Black Spots ◽

Lepidium Draba

The exotic, rangeland weed Lepidium draba L., a brassicaceous perennial, is widely distributed in the United States. For example, Oregon contains 100,000 ha of land infested with L. draba (2). Because it is capable of aggressive spread and has the potential to reduce the value of wheat-growing land (4), it is the target of biological control research. The application of multiple pathogens has been advocated for control of other brassicaceous weeds, including the simultaneous application of biotrophic and necrotrophic pathogens (3). In pursuit of this approach, in 2007, we discovered the occurrence of leaf spots on approximately 90% of L. draba plants near Shepherd, MT, which were distinct from leaf lesions caused by Cercospora bizzozeriana (1). The lesions were initially tiny, black spots enlarging over time to become circular to irregular and cream-colored around the initial black spots and sometimes with dark brown borders or chlorotic halos. Conidia from the lesions were light brown, elongate and obclavate, produced singly from short conidia, with 8 to 12 transverse septa, and 2 to 6 longitudinal septa. The spore body measured 25 to 35 × 200 to 250 μm with a beak cell 42 to 100 μm long. On the basis of conidial and cultural characteristics, the fungus was identified as Alternaria brassicae (Berk.) Sacc. Leaf tissues bordering lesions were plated on acidified potato dextrose agar. Colonies on V8 and alfalfa seed agar were black with concentric rings, eventually appearing uniformly black after 10 to 14 days. The internal transcribed spacer region of rDNA was amplified using primers ITS1 and ITS4 and sequenced. BLAST analysis of the 575-bp fragment showed a 100% homology with a sequence of A. brassicae Strain B from mustard (GenBank Accession No. DQ156344). The nucleotide sequence has been assigned GenBank Accession No. FJ869872. For pathogenicity tests, aqueous spore suspensions approximately 105/ml were prepared from cultures grown at 20 to 25°C for 10 to 14 days on V8 agar and sprayed on leaves of three L. draba plants. Inoculated plants were enclosed in plastic bags and incubated at 20 to 22°C for 72 to 80 h. In addition, three plants of the following reported hosts of A. brassicae were inoculated: broccoli, canola, Chinese cabbage, collards, broccoli raab, kale, mustard greens, radish, rape kale, and turnip. Within 10 days, leaf spots similar to those described above developed on plants of radish, canola, Chinese cabbage, and turnip and A. brassicae was reisolated and identified. Control plants sprayed with distilled water remained symptomless. These inoculations were repeated and results were the same. To our knowledge, this is the first report of a leaf spot disease caused by A. brassicae on L. draba in North America. A voucher specimen has been deposited with the U.S. National Fungus Collections (BPI No. 878750A). References: (1) A. J. Caesar et al. Plant Dis. 93:108, 2009. (2) G. L. Kiemnec and M. L. McInnis. Weed Technol. 16:231, 2002. (3) A. Maxwell and J. K. Scott. Adv. Bot. Res. 43:143, 2005. (4) G. A. Mulligan and J. N. Findlay. Can. J. Plant Sci. 54:149, 1974.

Download Full-text

First Report of Leaf Spot Caused by Cercospora bizzozeriana on Lepidium draba in the United States

Plant Disease ◽

10.1094/pdis-93-1-0108b ◽

2009 ◽

Vol 93 (1) ◽

pp. 108-108 ◽

Cited By ~ 1

Author(s):

A. J. Caesar ◽

R. T. Lartey ◽

D. K. Berner ◽

T. Souissi

Keyword(s):

United States ◽

North America ◽

Sugar Beet ◽

Leaf Spot ◽

The United States ◽

Initial Report ◽

Voucher Specimen ◽

First Report ◽

Leaf Spots ◽

Lepidium Draba

The herbaceous perennial Lepidium draba L. is an invasive weed of rangelands and riparian areas in North America and Australia. As of 2002, it had infested 40,500 ha of rangeland in Oregon and large areas in Wyoming and Utah. Little is known of plant pathogens occurring on L. draba, especially in the United States, that could be useful for biological control of the weed. Leaf spots were first noted on a stand of L. draba near Shepherd, MT in 1997. The spots were mostly circular but sometimes irregularly shaped and whitish to pale yellow. The pathogen was erroneously assumed to be Cercospora beticola since its morphological traits closely resembled that species and the area had large fields of sugar beet with heavy Cercospora leaf spot incidence. Diseased leaves of L. draba were collected in 1997 and 2007. Conidia, borne singly on dark gray, unbranched conidiophores produced on dark stromata late in the season, were elongate, hyaline, multiseptate, 38 to 120 × 2 to 6 μm (mostly 38 to 50 × 2 to 5 μm) and had bluntly rounded tips and wider, truncate bases. These characteristics were consistent with the description of C. bizzozeriana Saccardo & Berlese (2). To isolate the fungus, spores were picked from fascicles of conidiophores with a fine-tipped glass rod, suspended in sterile water, and spread on plates of water agar. Germinated spores were transferred to potato dextrose agar (PDA). The ITS1, 5.8S, and ITS2 sequences of this fungus (GenBank Accession No. EU887131) were identical to sequences of an isolate of C. bizzozeriana from Tunisia (GenBank Accession No. DQ370428). However, these sequences were also identical to those of a number of Cercospora spp. in GenBank, including C. beticola. We also compared the actin gene sequences of the Montana isolate of C. bizzozeriana (GenBank Accession No. FJ205397) and an isolate of C. beticola from Montana (GenBank Accession No. AF443281); the sequences were 94.6% similar, an appreciable difference. For pathogenicity tests, cultures were grown on carrot leaf decoction agar. Aqueous suspensions of 104 spores per ml from cultures were sprayed on 6-week-old L. draba plants. Plants were covered with plastic bags and placed on the greenhouse bench at 20 to 25°C for 96 h. Koch's postulates were completed by reisolating the fungus from the circular leaf spots that appeared within 10 days, usually on lower leaves. Spores of C. bizzozeriana were also sprayed on seedlings of sugar beet, collard, mustard, radish, cabbage, and kale under conditions identical to those above. No symptoms occurred. After the discovery of the disease in 1997, plants of L. draba in eastern Montana, Wyoming, and Utah were surveyed from 1998 to 2003 for similar symptoms and signs, but none were found. This, to our knowledge, is the first report of C. bizzozeriana in the United States. The initial report of the fungus in North America was from Manitoba in 1938 (1). It has recently been reported as occurring on L. draba in Tunisia (4) and Russia (3) and is reported as common in Europe (2). A voucher specimen has been deposited with the U.S. National Fungus Collections (BPI No. 878750A). References: (1) G. R. Bisby. The Fungi of Manitoba and Saskatchewan. Natl. Res. Council of Canada, Ottawa, 1938. (2) C. Chupp. A Monograph of the Fungus Genus Cercospora. C. Chupp, Ithaca, NY, 1953. (3) Z. Mukhina et al. Plant Dis. 92:316, 2008. (4) T. Souissi et al. Plant Dis. 89:206, 2005.

Download Full-text

First Report of a Root and Crown Disease of the Invasive Weed Lepidium draba Caused by Phoma macrostoma

Plant Disease ◽

10.1094/pdis-02-11-0107 ◽

2012 ◽

Vol 96 (1) ◽

pp. 145-145 ◽

Cited By ~ 1

Author(s):

A. J. Caesar ◽

R. T. Lartey ◽

T.-C. Caesar-Ton-That

Keyword(s):

United States ◽

Biological Control ◽

Patent Application ◽

The United States ◽

Root Tissue ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

First Report ◽

South Central ◽

Lepidium Draba

The exotic rangeland perennial Lepidium draba occurs as a noxious weed in 22 states, mostly in the western United States. Because chemical control measures against this invasive perennial, a member of the Brassicaceae, have not achieved adequate results, biological control is being pursued. While inventories of arthropods that feed on L. draba have been established, little is known of soilborne pathogens for possible use as biological control agents. To address this deficiency, we have surveyed for diseases of L. draba in the United States and Eurasia to identify and test potential biocontrol agents. In intensive surveys for soilborne diseases in a single infestation that is >20 years old in a cattle pasture in south-central Montana, several chlorotic, stunted plants were noted. Roots of chlorotic plants that exhibited elongated fissures from which other soilborne fungi were isolated also had numerous prominent pycnidia embedded in the crown tissue above the lesions. Examination with a dissecting microscope revealed large ostioles made evident by the wide concave inversions in the short necks of the pycnidia. Culture of root tissue on potato dextrose agar resulted in whitish, becoming pale gray colonies, with a dull peach-to-reddish tinge at the margins, with abundant single pycnidia. Conidia in vitro were mainly unicellular, variable shape, subglobose to ellipsoidal, with several guttules averaging 6 × 2.5 μm. These morphological traits are characteristic of Phoma macrostoma, which is regarded as a weak or wound pathogen. The internal transcribed spacer region of rDNA was amplified using primers ITS1 and ITS4 and sequenced. BLAST analysis of the 575-bp fragment showed a 100% homology with the sequence of an isolate of P. macrostoma that has been investigated extensively for commercialization as a biological control agent of various agricultural weeds (1), including wild mustard (GenBank No. DQ474091). The nucleotide sequence has been assigned GenBank No. HM755951. Pathogenicity tests consisted of making four 1.4-mm-diameter holes in five NaOCl (0.1%)-sterilized root sections of L. draba and pipetting ~50 to 100 μl of a 106 CFU/ml conidial suspension into the incisions, incubating the inoculated roots at 20 to 25°C overnight and planting the root sections, one per pot, in an artificial greenhouse potting mix and placing the pots in the greenhouse at 20 to 25°C. Controls were five root sections that were treated similarly except that sterile water was injected. The experiment was repeated. After 10 days, shoots that grew from inoculated roots were chlorotic and shorter than those produced from control roots. P. macrostoma was isolated from tissue of inoculated roots that became blackened distal to the inoculation points. To examine the host range of P. macrostoma on other brassica species, crowns of 2-week-old seedlings of radish, broccoli, cauliflower, broccoli raab, turnip, kohlrabi, cabbage, Chinese cabbage, mustard greens, and canola were injected with 0.5 ml of a 106 CFU/ml conidial suspension. Plants were grown in the greenhouse at 20 to 25°C for 4 weeks after inoculation and examined for symptoms. The experiment was repeated twice. Blackened root tissue with slight chlorosis occurred only on roots of radish and crowns of broccoli, from which P. macrostoma was reisolated. To our knowledge, this the first report of a disease of L. draba caused by P. macrostoma. Reference: (1) K. L. Bailey et al. U.S. Patent Application Serial No. 60/294,475, Filed May 20, 2001.

Download Full-text

First Report of Southern tomato virus on Tomatoes in Southwest France

Plant Disease ◽

10.1094/pdis-01-13-0017-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1124-1124 ◽

Cited By ~ 9

Author(s):

T. Candresse ◽

A. Marais ◽

C. Faure

Keyword(s):

North America ◽

Seed Transmission ◽

The United States ◽

High Rate ◽

Reference Sequence ◽

Tomato Mosaic Virus ◽

Potential Contribution ◽

First Report ◽

Tomato Sample ◽

Potential Pathogenicity

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5′ CTGGAGATGAAGTGCTCGAAGA 3′ and STV-rev 5′ TGGCTCGTCTCGCATCCTTCG 3′) was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.

Download Full-text

First Report of Guignardia citricarpa Associated with Citrus Black Spot on Sweet Orange (Citrus sinensis) in North America

Plant Disease ◽

10.1094/pdis-01-12-0101-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1225-1225 ◽

Cited By ~ 31

Author(s):

T. S. Schubert ◽

M. M. Dewdney ◽

N. A. Peres ◽

M. E. Palm ◽

A. Jeyaprakash ◽

...

Keyword(s):

North America ◽

Sweet Orange ◽

Black Spot ◽

The United States ◽

Yield Reduction ◽

Rrna Gene ◽

Specific Primers ◽

Oatmeal Agar ◽

First Report ◽

Citrus Black Spot

In March 2010, citrus black spot symptoms were observed on sweet orange trees in a grove near Immokalee, FL. Symptoms observed on fruit included hard spot, cracked spot, and early virulent spot. Hard spot lesions were up to 5 mm, depressed with a chocolate margin and a necrotic, tan center, often with black pycnidia (140 to 200 μm) present. Cracked spot lesions were large (15 mm), dark brown, with diffuse margins and raised cracks. In some cases, hard spots formed in the center of lesions. Early virulent spot lesions were small (up to 7 mm long), bright red, irregular, indented, and often with many pycnidia. In addition, small (2 to 3 mm), elliptical, reddish brown leaf lesions with depressed tan centers were observed on some trees with symptomatic fruit. Chlorotic halos appeared as they aged. Most leaves had single lesions, occasionally up to four per leaf. Tissue pieces from hard spots and early virulent spots were placed aseptically on potato dextrose agar (PDA), oatmeal agar, or carrot agar and incubated with 12 h of light and dark at 24°C. Cultures that grew colonies within a week were discarded. Fourteen single-spore cultures were obtained from the isolates that grew slower than the Guignardia mangiferae reference cultures, although pycnidia formed more rapidly in the G. mangiferae cultures (1). No sexual structures were observed. Cultures on half-PDA were black and cordlike with irregular margins with numerous pycnidia, often bearing white cirrhi after 14 days. Conidia (7.1 to 7.8 × 10.3 to 11.8 μm) were hyaline, aseptate, multiguttulate, ovoid with a flattened base surrounded by a hyaline matrix (0.4 to 0.6 μm) and a hyaline appendage on the rounded apex, corresponding to published descriptions of G. citricarpa (anomorph Phyllosticta citricarpa) (1). A yellow pigment was seen in oatmeal agar surrounding G. citricarpa, but not G. mangiferae colonies as previously reported (1,2). DNA was extracted from lesions and cultures and amplified with species-specific primers (2). DNA was also extracted from G. mangiferae and healthy citrus fruit. The G. citricarpa-specific primers produced a 300-bp band from fruit lesions and pure cultures. G. mangiferae-specific primers produced 290-bp bands with DNA from G. mangiferae cultures. The internally transcribed spacer (ITS) of the rRNA gene, translation-elongation factor (TEF), and actin gene regions were sequenced from G. citricarpa isolates and deposited in GenBank. These sequences had 100% homology with G. citricarpa ITS sequences from South Africa and Brazil, 100% homology with TEF, and 99% homology with actin of a Brazilian isolate. Pathogenicity tests with G. citricarpa were not done because the organism infects immature fruit and has an incubation period of at least 6 months (3). In addition, quarantine restrictions limit work with the organism outside a contained facility. To our knowledge, this is the first report of black spot in North America. The initial infested area was ~57 km2. The disease is of great importance to the Florida citrus industry because it causes serious blemishes and significant yield reduction, especially on the most commonly grown ‘Valencia’ sweet orange. Also, the presence of the disease in Florida may affect market access because G. citricarpa is considered a quarantine pathogen by the United States and internationally. References: (1) R. P. Baayen et al. Phytopathology 92:464, 2002. (2) N. A. Peres et al. Plant Dis. 91:525, 2007 (3) R. F. Reis et al. Fitopath Bras. 31:29, 2006.

Download Full-text

First Report of Powdery Mildew of Platanus occidentalis caused by Microsphaera platani (Erysiphe platani) in Washington State

Plant Health Progress ◽

10.1094/php-2003-0818-01-hn ◽

2003 ◽

Vol 4 (1) ◽

pp. 33 ◽

Cited By ~ 2

Author(s):

Dean A. Glawe

Keyword(s):

North America ◽

Powdery Mildew ◽

Native Species ◽

Washington State ◽

Eastern North America ◽

First Report ◽

Platanus Occidentalis

American sycamore (Platanus occidentalis L.) is a common native species in eastern North America and is planted widely as a landscape tree in other regions. During a survey of powdery mildew diseases in Washington State, the fungus Microsphaera platani Howe was found on American sycamore trees in Madison Park, Seattle. This report documents the presence of M. platani in Washington State and presents information on the fungus. Accepted for publication 30 July 2003. Published 18 August 2003.

Download Full-text

Fecal Coliform Methods for Examination of Sea Water: Interlaboratory Evaluation of Split Sample Analysis

Journal of AOAC INTERNATIONAL ◽

10.1093/jaoac/61.4.772 ◽

1978 ◽

Vol 61 (4) ◽

pp. 772-778

Author(s):

John J Miescier ◽

Virgil E Carr ◽

John F Musselman ◽

Santo A Furfari

Keyword(s):

Elevated Temperature ◽

Sea Water ◽

The United States ◽

Most Probable Number ◽

Test Procedures ◽

Probable Number ◽

E Coli ◽

Split Sample ◽

Elevated Temperature Test ◽

Temperature Test

Abstract An interlaboratory study was conducted to compare the effectiveness of the following 3 multiple-tube fermentation methods for determining the most probable number (MPN) of Escherichia coli in a split artificial sea water sample: ( 1 ) the 72-hr standard methods procedure of the American Public Health Association, (2) a 24-hr elevated-temperature test using A-l medium, and (3) a 24-hr elevated temperature test modified to include an initial 3-hr resuscitation period using A-l medium. The capability of the laboratories to perform the 3 test procedures was also compared. Split sample replicates with low, medium, and high levels of E. coli were examined in 18 laboratories in the United States and Canada. Data indicate that the laboratories performed each test with equal capability, and all 3 procedures were equally effective in enumerating the strain of E. coli used in this investigation. By virtue of its homogeneity and stability, the split sample served as an appropriate specimen for this study and could probably be used as a proficiency test specimen for evaluating laboratory analyst performance in the bacteriological examination of sea water.

Download Full-text

Differences in seed properties and germination between native and introduced populations of Triadica sebifera

Journal of Plant Ecology ◽

10.1093/jpe/rtz048 ◽

2019 ◽

Vol 13 (1) ◽

pp. 70-77 ◽

Cited By ~ 1

Author(s):

Jialiang Zhang ◽

Evan Siemann ◽

Baoliang Tian ◽

Wei Huang ◽

Jianqing Ding

Keyword(s):

United States ◽

Seed Germination ◽

Soluble Protein ◽

Native Species ◽

Seed Mass ◽

The United States ◽

Invasion Success ◽

Native Range ◽

Triadica Sebifera ◽

Introduced Range

Abstract Aims Seeds of many invasive plants germinate more quickly than those of native species, likely facilitating invasion success. Assessing the germination traits and seed properties simultaneously for introduced and native populations of an invasive plant is essential to understanding biological invasions. Here, we used Triadica sebifera as a study organism to examine intraspecific differences in seed germination together with seed characteristics. Methods We measured physical (volume, mass, coat hardness and coat thickness of seeds) and chemical (crude fat, soluble protein, sugar, gibberellins [GA] and abscisic acid [ABA] of kernels) properties of T. sebifera seeds collected in 2017 from 12 introduced (United States) populations and 12 native (China) populations and tested their germination rates and timing in a greenhouse experiment in China. Furthermore, we conducted an extra experiment in the United States using seeds collected in 2016 and 2017 to compare the effects of study sites (China vs. United States) and seed collection time (2016 vs. 2017) on seed germination. Important Findings Seeds from the introduced range germinated faster than those from the native range. Physical and chemical measurements showed that seeds from the introduced range were larger, had higher GA concentrations and GA:ABA ratio, but lower crude fat concentrations compared to those from the native range. There were no significant differences in seed mass, coat hardness and coat thickness or kernel ABA, soluble protein or sugar concentrations between seeds from introduced vs. native ranges. Germination rates were correlated between United States and China greenhouses but germination rates for populations varied between collection years. Our results suggest that larger seeds and higher GA likely contribute to faster germination, potentially facilitating T. sebifera invasion in the introduced range.

Download Full-text

Survey of Postharvest-Processed Oysters in the United States for Levels of Vibrio vulnificus and Vibrio parahaemolyticus

Journal of Food Protection ◽

10.4315/0362-028x-72.10.2110 ◽

2009 ◽

Vol 72 (10) ◽

pp. 2110-2113 ◽

Cited By ~ 25

Author(s):

ANGELO DePAOLA ◽

JESSICA L. JONES ◽

KATHY E. NOE ◽

ROBIN H. BYARS ◽

JOHN C. BOWERS

Keyword(s):

Vibrio Vulnificus ◽

Gulf Coast ◽

Virulence Gene ◽

Selective Advantage ◽

The United States ◽

Most Probable Number ◽

Probable Number ◽

Mild Heat ◽

Thermostable Direct Hemolysin ◽

The Mean

From June through October 2004, the U.S. Food and Drug Administration collected oysters (61 samples) that had been subjected to postharvest processing (PHP) methods, including mild heat treatment, freezing, and high hydrostatic pressure, from processors and retail markets in various states to determine Vibrio vulnificus and V. parahaemolyticus levels. Presence in a 25-g sample and most probable number (MPN) using standard enrichment and selective isolation procedures were utilized. Suspect colonies were isolated and identified using DNA probe colony hybridization. Neither species of vibrio was detected in 25-g portions of most samples regardless of the PHP. The lowest frequency of isolation of either pathogen (<10%) was observed with the mild heat process. Few (12 to 13%) frozen samples collected at the processor but not at retail contained >30 MPN/g of either pathogen. The mean levels of either organism in PHP oysters observed in the present study were 5 to 6 log less than in unprocessed raw Gulf Coast oysters. Of the 70 V. vulnificus isolates examined, only 5 possessed the putative virulence marker, type B 16S rRNA. Neither the thermostable direct hemolysin (tdh) nor the tdh-related hemolysin (trh) virulence gene was detected in any of the 40 V. parahaemolyticus isolates examined in the present study. These data suggest that if there is any selective advantage to pathogenic strains of V. vulnificus and V. parahaemolyticus, these differences are minimal. These results indicate that all PHP treatments greatly reduce exposure of V. vulnificus and V. parahaemolyticus to raw-oyster consumers. Consequently, these PHP oysters pose a much lower risk of illness to consumers due to these pathogens.

Download Full-text