First Report of Powdery Mildew of Platanus occidentalis caused by Microsphaera platani (Erysiphe platani) in Washington State

2003 ◽  
Vol 4 (1) ◽  
pp. 33 ◽  
Author(s):  
Dean A. Glawe
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
Native Species ◽  
Washington State ◽  
Eastern North America ◽  
First Report ◽  
Platanus Occidentalis

American sycamore (Platanus occidentalis L.) is a common native species in eastern North America and is planted widely as a landscape tree in other regions. During a survey of powdery mildew diseases in Washington State, the fungus Microsphaera platani Howe was found on American sycamore trees in Madison Park, Seattle. This report documents the presence of M. platani in Washington State and presents information on the fungus. Accepted for publication 30 July 2003. Published 18 August 2003.

scholarly journals First Report of Powdery Mildew of Platanus occidentalis Caused by Erysiphe platani in Korea

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 843-843 ◽  
Author(s):  
Y. J. La ◽  
S. E. Cho ◽  
H. D. Shin
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
Its Region ◽  
The United States ◽  
Control Measures ◽  
Base Substitution ◽  
Width Ratio ◽  
First Report ◽  
Platanus Occidentalis ◽  
Young Leaves

Platanus occidentalis L., called American sycamore or American plane, is native to North America. The trees are commonly planted throughout the world on the sides of roads and in parks. In June 2012, diseased leaves exhibiting signs of powdery mildew from a park in Daegu City of Korea were sent to Plant Clinic of Seoul National University for diagnosis. Our observations in Daegu City during September and October 2012 showed that nearly 99% of the approximately 1,000 trees surveyed were infected with a powdery mildew. Voucher specimens (n = 6) were deposited at the Korea University Herbarium (KUS). Symptoms were characterized by chlorosis, distortion, or cupping of young leaves. White superficial colonies developed amphigenously on leaves. Hyphae were flexuous to straight, branched, septate, 4 to 7 μm wide, and had lobed appressoria. Conidiophores were 120 to 350 × 5 to 7.5 μm and produced conidia singly. Foot-cells of conidiophores were straight, cylindric, and 115 to 200 μm long. Conidia were hyaline, ellipsoid-ovoid, measured 33 to 47.5 × 17.5 to 29 μm with a length/width ratio of 1.5 to 2.0, lacked distinct fibrosin bodies, and showed reticulate wrinkling of the outer walls. Germ tubes were produced on the subterminal position of conidia. No chasmothecia were observed. The structures and measurements were compatible with those of the anamorphic state of Erysiphe platani (Howe) U. Braun & S. Takam. (1). To confirm the identification, the complete internal transcribed spacer (ITS) region of the rDNA from isolate KUS-F26959 was amplified with nested PCR and sequenced. The resulting sequence of 625 bp was deposited in GenBank (Accession No. JX997805). A GenBank BLAST search of this sequence showed only one base substitution with the four sequences (JQ365940 to JQ365943) of E. platani on Platanus spp. Pathogenicity was confirmed through inoculation tests by gently pressing diseased leaves onto young leaves of three 2-year-old disease-free seedlings. Three non-inoculated plants were used as control. Plants were maintained in a greenhouse at 24 to 30°C. Inoculated leaves developed symptoms after 7 days, whereas the control plants remained symptomless. The fungus present on the inoculated leaves was morphologically identical to that observed on the original diseased leaves, fulfilling Koch's postulates. Since E. platani first was recorded in the United States in 1874, it has been regarded as endemic in North America. From the second half of the 20th century, introduction and expansion of the range of this fungus to South America, South Africa, Australia and New Zealand, Europe, and Asia have been reported (1,2). To our knowledge, this is the first report of E. platani infections of P. occidentalis in Korea. This species was recorded on P.× hispanica from Japan in 1999 (4) and on P. orientalis from China in 2006 (3), suggesting invasive spread of the sycamore powdery mildew in East Asia. Since American sycamores are widely planted in Korea, control measures should be made to prevent further spread of the disease. References: (1) U. Braun and R. T. A. Cook. Taxonomic Manual of the Erysiphales (Powdery Mildews), CBS Biodiversity Series No.11. CBS, Utrecht, 2012. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication, ARS, USDA, Retrieved October 22, 2012. (3) C. Liang et al. Plant Pathol. 57:375, 2008. (4) S, Tanda. J. Agric. Sci., Tokyo Univ. Agric. 43:253, 1999.

First Report of Powdery Mildew of Lycium chinense (Chinese Matrimony Vine) Caused by Arthrocladiella mougeotii in the Pacific Northwest

2004 ◽  
Vol 5 (1) ◽  
pp. 16
Author(s):  
Dean A. Glawe
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
Medicinal Plant ◽  
Pacific Northwest ◽  
Morphological Features ◽  
Lycium Chinense ◽  
First Report ◽  
Landscape Plant ◽  
The Pacific ◽  
Plant Grown

Chinese matrimony-vine (Lycium chinense Mill.) is a traditional medicinal plant grown in China and used as a perennial landscape plant in North America. This report documents the presence of powdery mildew on L. chinense in the Pacific Northwest and describes and illustrates morphological features of the causal agent. It appears to be the first report of a powdery mildew caused by Arthrocladiella in the Pacific Northwest. Accepted for publication 10 November 2004. Published 8 December 2004.

Revalidation of the milliped genus Amplaria Chamberlin 1941 (Diplopoda,  Chordeumatida, Striariidae), and description of two new species from caves in Sequoia and Kings Canyon National Parks, California

Zootaxa ◽  
2007 ◽  
Vol 1532 (1) ◽  
pp. 23-39 ◽  
Author(s):  
WILLIAM A. SHEAR ◽  
JEAN K. KREJCA
Keyword(s):  
New Species ◽  
North America ◽  
National Parks ◽  
Type Species ◽  
Washington State ◽  
Eastern North America ◽  
The Pacific ◽  
Two New Species ◽  
Phyletic Line

The milliped genus Amplaria Chamberlin 1941 was synonymized with Striaria Bollman 1888 by Hoffman (1980). Examination of a much wider range of materials of nominal Striaria species both from eastern North America and the Pacific coastal states shows that some species occurring from California to Washington (state) represent a distinct phyletic line, for which Amplaria Chamberlin 1941 is the oldest available generic name. Speostriaria Causey 1960 is a synonym of Amplaria. Amplaria muiri n. sp. and A. adamsi n. sp. are two new, recently discovered species from caves in Sequoia and Kings Canyon National Parks, California. Illustrations are provided of a specimen that may represent the type species, Amplaria eutypa (Chamberlin) 1953.

First Report of Powdery Mildew on Dipsacus sylvestris Caused by Sphaerotheca dipsacearum in North America

2006 ◽  
Vol 7 (1) ◽  
pp. 54
Author(s):  
Frank M. Dugan ◽  
Dean A. Glawe
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
Causal Agent ◽  
European Species ◽  
First Report ◽  
Dipsacus Sylvestris ◽  
Noxious Weed

Common teasel (Dipsacus sylvestris) is a European species introduced into North America, and is now widely established and regarded as a noxious weed. In October 2005, a powdery mildew was observed on D. sylvestris in two locations in Pullman, Whitman Co., WA. Examination of diseased material confirmed that the causal agent was S. dipsacearum. This report provides the first documentation of S. dipsacearum on D. sylvestris in North America. Accepted for publication 20 April 2006. Published 7 June 2006.

First Report of Powdery Mildew on Corylus avellana caused by Phyllactinia guttata in Washington State

2005 ◽  
Vol 6 (1) ◽  
pp. 22 ◽  
Author(s):  
Sierra Hartney ◽  
Dean A. Glawe ◽  
Frank Dugan ◽  
Joseph Ammirati
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
Corylus Avellana ◽  
Washington State ◽  
State University ◽  
Washington State University ◽  
Ornamental Tree ◽  
Western Washington ◽  
The University ◽  
First Time

Contorted hazelnut is an ornamental tree introduced to North America from Europe. In the fall of 2004 and 2005, powdery mildew caused by Phyllactinia guttata (Wallr.:Fr.) Lév. was observed on contorted hazelnut (‘contorta’) located on the campus of Washington State University, Pullman, and on several C. avellana trees (unknown cultivar) on the campus of the University of Washington, Seattle. This report documents for the first time the occurrence of P. guttata on C. avellana in both eastern and western Washington. Accepted for publication 18 October 2005. Published 21 November 2005.

First Report of Powdery Mildew of Mahonia aquifolium Caused by Microsphaera berberidis (Erysiphe berberidis) in North America

2003 ◽  
Vol 4 (1) ◽  
pp. 41
Author(s):  
Dean A. Glawe
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
Pacific Northwest ◽  
First Report ◽  
Mahonia Aquifolium ◽  
First Time ◽  
Grown Plant

Mahonia aquifolium is a widely-grown plant in the coastal Pacific Northwest. This report documents for the first time a powdery mildew on M. aquifolium in North America caused by a fungus fitting the description of Microsphaera berberidis. Accepted for publication 14 January 2003. Published 6 February 2003.

scholarly journals First Report of Powdery Mildew Caused by Erysiphe platani on Sycamore (Platanus occidentalis) in South Korea

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 841-841
Author(s):  
H. B. Lee ◽  
H. W. Lee ◽  
H. Y. Mun
Keyword(s):  
United States ◽  
Powdery Mildew ◽  
South Korea ◽  
Sequence Data ◽  
Average Rate ◽  
Nationwide Survey ◽  
The United States ◽  
High Sequence Identity ◽  
First Report ◽  
Platanus Occidentalis

Platanus occidentalis L. (sycamore) is an important shade tree distributed throughout the Northern Hemisphere and in South Korea. It has been widely used as an ornamental tree, especially in urban regions and by roadsides. The average rate of roadside planting throughout South Korea covers about 5.7% (up to 38% in Seoul), equivalent to 0.36 million trees. In early July 2012, after a rainy spell in summer, an outbreak of powdery mildew on sycamore was first observed on roadside trees in Gwangju, a southern province of South Korea. A more extensive nationwide survey revealed no powdery mildew in northern or central regions of South Korea. The disease has spread rapidly within Gwangju, even though fungicide applications were carried out after the rainy spell. Major symptoms included white, superficial mycelia, grey to brown lesions on the surface of the leaves due to the presence of a hyperparasite (tentatively identified as Ampelomyces sp.), a slight chlorosis, and severe leaf distortion followed by defoliation. Conidiophores were produced singly, straight, and unbranched, with lengths of 35.2 to 315.2 μm (average 170.4 μm). Conidia were ellipsoid or doliiform, ranging in size from 34.9 to 47.4 μm (average 38.2 μm) long × 16.5 to 26.8 μm (average 23.9 μm) wide. Primary conidia had a truncate base and rounded apex; secondary conidia had both a truncate base and apex. The conidial outer surface had a reticulated wrinkling. Cleistothecia (i.e., sexual spore structures) were not found during the survey, which extended from July to October. These characteristics and the host species match those of Microsphaera platani (syn. Erysiphe platani), which was described on P. occidentalis in Washington State (2). Fungal rDNA was amplified using primers ITS1 and LR5F (4) for one sample (EML-PLA1, GenBank JX485651). BLASTn searches of GenBank revealed high sequence identity to E. platani (99.5% to JQ365943 and 99.3% to JQ365940). Recently, Liang et al. (3) reported the first occurrence of powdery mildew by E. platani on P. orientalis in China based only on its morphology. Thus, in this study, author could only use ITS sequence data from the United States and Europe to characterize the isolate. To date, nine records of powdery mildews of Platanus spp. have been reported worldwide: on P. hispanica from Brazil, Japan, Hungary, and Slovakia; P. orientalis from Israel; P. racemosa from the United States; P. × acerifolia from the United Kingdom and Germany; and Platanus sp. from Argentina and Australia (1). Interestingly, the hyperparasite, Ampelomyces sp., was found with E. platani, suggesting that there may be some level of biocontrol in nature. Pathogenicity was confirmed by gently pressing diseased leaves onto six leaves of healthy sycamore plants in the field in September. The treated leaves were sealed in sterilized vinyl pack to maintain humid condition for 2 days. Similar symptoms were observed on the inoculated leaves 10 days after inoculation. Koch's postulates were fulfilled by re-observing the fungal pathogen. To our knowledge, this is the first report of powdery mildew caused by E. platani on sycamore in South Korea. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. http://nt.ars-grin.gov/fungaldatabases/ , 2012. (2) D. A. Glawe. Plant Health Progress, doi:10.1094/PHP-2003-0818-01-HN, 2003. (3) C. Liang et al. Plant Pathol. 57:375, 2008. (4) T. J White et al., pp. 315-322 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., ed. Academic Press, New York, 1990.

scholarly journals First Report of Powdery Mildew (Microsphaera palczewskii) on Siberian Pea Tree (Caragana arborescens) in North America

Plant Disease ◽  
2003 ◽  
Vol 87 (4) ◽  
pp. 451-451 ◽  
Author(s):  
C. Nischwitz ◽  
G. Newcombe
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
First Report ◽  
Powdery Mildews ◽  
Leaf Surfaces ◽  
Mean Diameter ◽  
Caragana Arborescens ◽  
The Mean ◽  
Northern United States ◽  
The U.S

Caragana arborescens Lam. is an exotic ornamental that can also be somewhat invasive. In July 2002, powdery mildew was observed on C. arborescens along the Idaho-Washington border in Moscow and Pullman, respectively. Leaves were colonized as soon as they emerged, and entire plants were affected. The fungus covered both leaf surfaces, but cleistothecia were more abundant on abaxial surfaces. The mean diameter of the cleistothecia was 91 (± 9.8) μm. Short-stalked asci averaged 67 (± 7.1) μm × 37 (± 5.2) μm, and the ascospores were 21 (± 2.0) μm × 13 (± 0.8) μm. There are records of four species of Microsphaera on C. arborescens in Europe and Asia. The measurements fit the description of Microsphaera palczewskii Jacz. (1), and the identification was confirmed by comparison with specimens of this fungus on C. arborescens from Sweden (U.S. National Fungus Collections: BPI 749057 and 749058). Specimens of M. grossulariae (Wallr. ex Fr.) Lev. on Ribes divaricatum Dougl. from California (BPI 558266) were also examined, but the cleistothecial appendages were distinctly different from those of the Idaho specimens. To our knowledge, this is the first reported occurrence in North America of powdery mildew on C. arborescens and the first report of M. palczewskii. The latter may have been introduced recently into North America because there are areas in southern Canada and the northern United States in which C. arborescens is unaffected by powdery mildew. Interestingly, it is only in recent decades that M. palczewskii has spread from Asia into Europe (2). Now, host and parasite have been reunited in North America as well. Specimens have been deposited in the U.S. National Fungus Collections (BPI). References: (1) U. Braun. A monograph of the Erysiphales (powdery mildews) J. Cramer, Berlin-Stuttgarg, 1987. (2) S. Huhtinen et al. Karstenia 41:31, 2001.

scholarly journals First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America

Plant Disease ◽  
2010 ◽  
Vol 94 (2) ◽  
pp. 279-279 ◽  
Author(s):  
A. M. Minnis ◽  
A. Y. Rossman ◽  
D. L. Clement ◽  
M. K. Malinoski ◽  
K. K. Rane
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
Dna Sequence ◽  
Sequence Data ◽  
Its Region ◽  
Podosphaera Leucotricha ◽  
First Report ◽  
Pyrus Calleryana ◽  
Dna Sequence Data ◽  
Callery Pear

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana ‘Cleveland Select’ showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5′-3′ ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana ‘Chanticleer’, in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.

First Report of Powdery Mildew of Myosotis sylvatica (Wood Forget-me-not) Caused by Golovinomyces cynoglossi (Erysiphe cynoglossi) in Washington State

2004 ◽  
Vol 5 (1) ◽  
pp. 18
Author(s):  
Dean A. Glawe
Keyword(s):  
Powdery Mildew ◽  
Pacific Northwest ◽  
Washington State ◽  
Causal Organism ◽  
First Report ◽  
The Pacific ◽  
Western Washington ◽  
Symptoms And Signs

Wood forget-me-not cultivars are popular ornamentals in the Pacific Northwest. In western Washington, this species frequently displays symptoms and signs of powdery mildew after anthesis. This report records the disease from King, Pierce, Snohomish, and Skagit counties and describes and illustrates symptoms of the disease as well as taxonomically important features of the causal organism. Accepted for publication 29 October 2004. Published 24 November 2004.

Sign in / Sign up

Export Citation Format

Share Document