First Report of Neofabraea alba Causing Fruit Spot on Olive in North America

Olive (Olea europaea) is a widely planted evergreen tree primarily grown for its oil, fruit for pickling, and landscape appeal in Mediterranean and temperate climates. California produces most of the olives grown in the United States; its industry was valued at $53 million in 2011 (4). In 2005 and 2008, fruit spotting occurred on coratina and picholine cultivars in two commercial orchards in Sonoma County. The spots were scattered, slightly sunken and brown, and surrounded by a green halo. Many of the spots were associated with lenticels. A slow to moderate growing, cream to rose-colored fungus was isolated from the spots onto potato dextrose agar (PDA) amended with 0.01% tetracycline hydrochloride. Sporulation was observed in vitro on PDA after 40 days under near-UV light. Macroconidia, produced from conidiomata, were hyaline, aseptate, cylindrical to fusiform-allantoid, slightly curved, and 17 to 27 × 2.5 to 3.5 μm (average 21.1 × 2.9 μm). Microconidia were aseptate, strongly curved, hyaline, and 14 to 18 × 0.75 to 1 μm (average 16.1 × 0.9 μm). rDNA sequences of the internal transcribed spacer (ITS) region of the isolate (GenBank KC751540), amplified using primers ITS1 and ITS4, were 99.8% identical to Neofabraea alba (E.J. Guthrie) Verkley (anamorph Phlyctema vagabunda) (=Gloeosporium olivae) (AF141190). Pathogenicity was tested on detached, green fruit (cv. frantoio). Olives were surface sterilized in 10% sodium hypochlorite for 5 min and air dried. Five olives were wounded with a needle and 10 μl spore suspension (105 spores/ml) was placed on each wound. An equal amount of spore suspension was placed on five unwounded olives. Water was also placed on wounded and unwounded olives to serve as a control. The olives were placed on racks in 22.5 × 30 cm crispers lined with wet paper towels and incubated at 23°C. After 21 days, the olives began to turn red. Olives wounded and inoculated with N. alba had a distinct green ring around the inoculation point where maturity was inhibited. Control olives uniformly turned red. After 35 days, wound-inoculated olives began to form a sunken, brown lesion at the inoculation point where aerial mycelium was visible. After 51 days, lesions were visibly sunken and immature conidiomata began to form in concentric rings giving a bull's eye-like appearance. Unwounded fruit exhibited uneven maturity and green spots associated with the lenticels throughout the experiment but did not develop sunken lesions. Control fruit showed no symptoms and ripened normally. After 56 days, fruit was surface sterilized in 10% sodium hypochlorite for 5 min and plated onto PDA. N. alba was isolated from the sunken and green areas of all of the wounded and unwounded fruit. No fungi grew from the control fruit. The experiment was repeated once with similar results. N. alba has been reported to cause an anthracnose disease on fruit and leaves of olives in Spain and Italy (1,2). In North America, N. alba causes a bull's eye rot on fruit of Malus and Pyrus spp. in the Pacific Northwest and coin canker of Fraxinus spp. in Michigan and Canada (3). To our knowledge, this is the first report of N. alba causing disease on olive in North America. References: (1) J. Del Maral de la Vega et al. Bol. San Veg. Plagas. 12:9. 1986. (2) S. Foschi. Annali. Sper. Agr., n.s. 9:911. 1955. (3) T. D. Gariepy et al. Can. J. Plant Pathol. 27:118. 2005. (4) United States Department of Agriculture, National Agricultural Statistics Service, California Field Office, California Agriculture Statistics, Crop Year 2011.

Download Full-text

First Report of a 16SrI (Aster Yellows) Group Phytoplasma in Phlox in the United States

Plant Health Progress ◽

10.1094/php-br-16-0021 ◽

2016 ◽

Vol 17 (3) ◽

pp. 198-199

Author(s):

Andrew E. Sathoff ◽

Deepak Rajendran ◽

Seth D. Wannemuehler ◽

Katarina Sweeney ◽

Fazal Manan ◽

...

Keyword(s):

United States ◽

North America ◽

Flowering Time ◽

Flower Color ◽

The United States ◽

Aster Yellows ◽

First Report ◽

Color Range ◽

Small Grains ◽

Herbaceous Perennial

Phlox are herbaceous perennial ornamentals native to North America grown for their flower color, range in flowering time, scent, and differing forms. Candidatus Phytoplasma asteris, first found to occur in Chinese asters, is spread by aster leafhoppers and in 2001 was reported to be a serious threat to phlox. There have been several reports of Ca. P. asteris in garlic and small grains in Minnesota. This is the first report of Candidatus Phytoplasma asteris in phlox in Minnesota and the United States. Accepted for publication 28 June 2016. Published 6 September 2016.

Download Full-text

First Report of Leaf Spot Caused by Cercospora bizzozeriana on Lepidium draba in the United States

Plant Disease ◽

10.1094/pdis-93-1-0108b ◽

2009 ◽

Vol 93 (1) ◽

pp. 108-108 ◽

Cited By ~ 1

Author(s):

A. J. Caesar ◽

R. T. Lartey ◽

D. K. Berner ◽

T. Souissi

Keyword(s):

United States ◽

North America ◽

Sugar Beet ◽

Leaf Spot ◽

The United States ◽

Initial Report ◽

Voucher Specimen ◽

First Report ◽

Leaf Spots ◽

Lepidium Draba

The herbaceous perennial Lepidium draba L. is an invasive weed of rangelands and riparian areas in North America and Australia. As of 2002, it had infested 40,500 ha of rangeland in Oregon and large areas in Wyoming and Utah. Little is known of plant pathogens occurring on L. draba, especially in the United States, that could be useful for biological control of the weed. Leaf spots were first noted on a stand of L. draba near Shepherd, MT in 1997. The spots were mostly circular but sometimes irregularly shaped and whitish to pale yellow. The pathogen was erroneously assumed to be Cercospora beticola since its morphological traits closely resembled that species and the area had large fields of sugar beet with heavy Cercospora leaf spot incidence. Diseased leaves of L. draba were collected in 1997 and 2007. Conidia, borne singly on dark gray, unbranched conidiophores produced on dark stromata late in the season, were elongate, hyaline, multiseptate, 38 to 120 × 2 to 6 μm (mostly 38 to 50 × 2 to 5 μm) and had bluntly rounded tips and wider, truncate bases. These characteristics were consistent with the description of C. bizzozeriana Saccardo & Berlese (2). To isolate the fungus, spores were picked from fascicles of conidiophores with a fine-tipped glass rod, suspended in sterile water, and spread on plates of water agar. Germinated spores were transferred to potato dextrose agar (PDA). The ITS1, 5.8S, and ITS2 sequences of this fungus (GenBank Accession No. EU887131) were identical to sequences of an isolate of C. bizzozeriana from Tunisia (GenBank Accession No. DQ370428). However, these sequences were also identical to those of a number of Cercospora spp. in GenBank, including C. beticola. We also compared the actin gene sequences of the Montana isolate of C. bizzozeriana (GenBank Accession No. FJ205397) and an isolate of C. beticola from Montana (GenBank Accession No. AF443281); the sequences were 94.6% similar, an appreciable difference. For pathogenicity tests, cultures were grown on carrot leaf decoction agar. Aqueous suspensions of 104 spores per ml from cultures were sprayed on 6-week-old L. draba plants. Plants were covered with plastic bags and placed on the greenhouse bench at 20 to 25°C for 96 h. Koch's postulates were completed by reisolating the fungus from the circular leaf spots that appeared within 10 days, usually on lower leaves. Spores of C. bizzozeriana were also sprayed on seedlings of sugar beet, collard, mustard, radish, cabbage, and kale under conditions identical to those above. No symptoms occurred. After the discovery of the disease in 1997, plants of L. draba in eastern Montana, Wyoming, and Utah were surveyed from 1998 to 2003 for similar symptoms and signs, but none were found. This, to our knowledge, is the first report of C. bizzozeriana in the United States. The initial report of the fungus in North America was from Manitoba in 1938 (1). It has recently been reported as occurring on L. draba in Tunisia (4) and Russia (3) and is reported as common in Europe (2). A voucher specimen has been deposited with the U.S. National Fungus Collections (BPI No. 878750A). References: (1) G. R. Bisby. The Fungi of Manitoba and Saskatchewan. Natl. Res. Council of Canada, Ottawa, 1938. (2) C. Chupp. A Monograph of the Fungus Genus Cercospora. C. Chupp, Ithaca, NY, 1953. (3) Z. Mukhina et al. Plant Dis. 92:316, 2008. (4) T. Souissi et al. Plant Dis. 89:206, 2005.

Download Full-text

First Report of Puccinia coronata var. coronata sensu stricto Infecting Alder Buckthorn in the United States

Plant Health Progress ◽

10.1094/php-01-17-0003-br ◽

2017 ◽

Vol 18 (2) ◽

pp. 84-86

Author(s):

Shawn C. Kenaley ◽

Geoffrey Ecker ◽

Gary C. Bergstrom

Keyword(s):

United States ◽

North America ◽

Host Range ◽

Geographic Distribution ◽

Phylogenetic Analyses ◽

Rust Fungus ◽

The United States ◽

Sensu Stricto ◽

Puccinia Coronata ◽

First Report

Field symptoms, host distribution, pathogen morphology, and phylogenetic analyses clearly demonstrated that the rust fungus infecting alder buckthorn in Connecticut is Puccinia coronata var. coronata sensu stricto. To our knowledge, this is the first report and confirmation of P. coronata var. coronata s.s. in the United States. Additional collections from purported aecial and telial hosts of P. coronata var. coronata s.s. are necessary to determine its host range, geographic distribution, and incidence within the United States and elsewhere in North America.

Download Full-text

bla VIM-7, an Evolutionarily Distinct Metallo-β-Lactamase Gene in a Pseudomonas aeruginosa Isolate from the United States

Antimicrobial Agents and Chemotherapy ◽

10.1128/aac.48.1.329-332.2004 ◽

2004 ◽

Vol 48 (1) ◽

pp. 329-332 ◽

Cited By ~ 93

Author(s):

Mark A. Toleman ◽

Kenneth Rolston ◽

Ronald N. Jones ◽

Timothy R. Walsh

Keyword(s):

United States ◽

Pseudomonas Aeruginosa ◽

North America ◽

The United States ◽

Surveillance Program ◽

First Report ◽

Antimicrobial Surveillance ◽

Lactamase Gene

ABSTRACT As part of the CANCER Antimicrobial Surveillance Program in North America, a Pseudomonas aeruginosa isolate, strain 07-406, was shown to possess a metallo-β-lactamase, designated VIM-7. bla VIM-7 is located on a 24-kb plasmid which can be readily transferred into Enterobacteriaceae and other pseudomonads. This is the first report of a mobile metallo-β-lactamase gene, bla VIM-7, being detected within the United States.

Download Full-text

First Report of Stemphylium globuliferum Causing Stemphylium Leaf Spot on Alfalfa (Medicago sativa) in the United States

Plant Disease ◽

10.1094/pdis-08-13-0828-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 993-993 ◽

Cited By ~ 2

Author(s):

D. A. Samac ◽

J. Willbur ◽

L. Behnken ◽

F. Brietenbach ◽

G. Blonde ◽

...

Keyword(s):

United States ◽

Medicago Sativa ◽

Leaf Spot ◽

Uv Light ◽

The United States ◽

Tween 20 ◽

Species Discrimination ◽

Cool Temperature ◽

First Report ◽

Initial Symptoms

Stemphylium leaf spot occurs in most areas where alfalfa (Medicago sativa) is grown. In the United States, Stemphylium botryosum is reported to be the predominant pathogen (1), although S. vesicarium and S. herbarum are also observed. S. alfalfae was isolated on alfalfa in Australia (4) and S. globuliferum was reported in Egypt and Korea. In April and May 2012, alfalfa plants with leaf spot symptoms were observed in Rosemount and Waseca, MN, and in Arlington, Tomah, and Waupaca, WI. Initial symptoms consisted of white to tan spots with a brown border, 2 to 3 mm in diameter, circular to oval, enlarging to 5 to 8 mm in diameter. Large lesions often coalesced. Small, narrow, brown lesions occurred on petioles. Lower killed leaves remained attached to the primary stem. Spots were larger than those caused by the cool temperature biotype of S. botryosum. Conidia formed on lesions after 48 h in a moist chamber. Conidia were removed with a fine glass rod, germinated on 1% water agar, and single hyphae transferred to V8 agar (V8A). After 2 weeks under room light, plates were placed under UV light to stimulate spore production. Conidia on host material were borne singly on straight, unbranched, smooth conidiophores, medium brown at the apex. Conidia were medium to dark brown with small papillae, subspherical with 3 to 4 transverse and 3 to 4 complete or near complete longitudinal septa, with a distinct constriction at the median transverse septum. Conidia were 27.5 to 32.5 μm long × 20 to 22.5 μm wide with a length/width (L/W) ratio of 1.2 to 1.5. Conidia on V8A were smaller, 25 to 30 μm long × 12.5 to 19 μm wide with a L/W of 1.6 to 1.8. Ascostromata 300 μm in diameter formed on leaves held at 4°C for 2 months as well as on culture plates after 1 month. Ascospores from leaves were golden brown to reddish, 40 to 42.5 × 20 μm, slightly broader in the upper half of the spore, with 7 to 8 transverse septa and one complete longitudinal septum with several incomplete septa. Ascospores from culture were smaller, 27.5 to 30 × 12.5 to 15 μm wide. These morphological features are consistent with the description for S. globuliferum (3). DNA was extracted from pure cultures of SAr301 and SWp202, isolated from plants grown in Arlington and Waupaca, respectively, and used to amplify ITS1-5.8S-ITS2 rDNA using primers ITS1 and ITS4, GPD with primers GPD1 and GPD2, EF-1α with EF446f and EF1473R, and the intergenic spacer between vmaA and vpsA with primers ATPF2 and GTP604R (2). In sequence comparisons made by BLASTn searches of GenBank, the ITS (KF479193), GPD (KF479194), and EF-1α (KF479195) sequences from S. globuliferum were different from the gene sequences of S. botryosum but identical to those from S. vesicarium, S. herbarum, and S. alfalfae. The vmaA-vpsA spacer sequence (KF479196) of S. globuliferum had 3 nucleotide differences from S. vesicarium and S. herbarum and 4 nucleotide differences from S. alfalfae, demonstrating that this sequence is useful for species discrimination. Conidia from strains SAr301 and SWp 202 were suspended at 104/ml in sterile water with 0.01% Tween 20 and used to inoculate 12 alfalfa plants using a handheld sprayer. Plants were kept at 100% RH for 48 h, then grown at 20°C with a 16-h photoperiod. After 2 weeks, lesions similar to those seen in the field were observed on leaves of all plants. Symptomatic leaves placed in moist chambers produced conidia with the size and morphology of S. globuliferum within 48 h. This is the first report to our knowledge of S. globuliferum causing disease on alfalfa in the United States. Cultures were deposited in the University of Minnesota Mycological Culture Collection. References: (1) W. A. Cowling et al. Phytopathology 71:679, 1981. (2) P. Inderbitzin et al. Mycologia 101:320, 2009. (3) E. G. Simmons. Mycologia 61:1, 1969. (4) E. G. Simmons. Sydowia 38:284, 1985.

Download Full-text

First Report of the Telial Stage of Japanese Apple Rust on Juniperus chinensis in North America and the Aecial Stage on Malus domestica

Plant Disease ◽

10.1094/pdis-94-9-1169b ◽

2010 ◽

Vol 94 (9) ◽

pp. 1169-1169

Author(s):

N. F. Gregory ◽

J. F. Bischoff ◽

L. J. Dixon ◽

R. Ciurlino

Keyword(s):

United States ◽

North America ◽

Malus Domestica ◽

Large Subunit ◽

The United States ◽

Causal Agent ◽

University Of Delaware ◽

First Report ◽

Telial Stage ◽

Juniperus Chinensis

Following a report in April 2009 of the presence of Gymnosporangium yamadae Miyabae ex G. Yamada on crabapple (Malus toringo Siebold) in Wilmington, DE (2), University of Delaware, State of Delaware, and USDA/APHIS PPQ personnel collaborated to confirm and document the pathogen. G. yamadae is the causal agent of Japanese apple rust. The fungus is known from Asia with an aecial state on economically important Malus species and telial state on Juniperus chinensis. During the April 2009 site visit, ornamental J. chinensis were observed near the original crabapples. On May 7, 2009, telial galls were collected from the ornamental J. chinensis at the Wilmington site. The telia were confirmed to be G. yamadae by morphometric analysis and molecular data. The rDNA large subunit (LSU) sequence derived from the collected telial galls (GenBank Accession No. GU058012) was identical to the eight G. yamadae LSU sequences (GenBank Accession Nos. FJ848760–FJ848765, FJ559373, and FJ559375) reported from Korea by Yun et al. (3). Teliospores were 45 to 54 μm long with pedicels that were wide (7.0 to 8.4 μm) along the full length. The G. yamadae telial gall collected from Wilmington, DE was deposited into the U.S. National Fungus Collection (BPI 879273). Leaves of M. domestica on the University of Delaware farm in Newark were confirmed to have Japanese apple rust on Aug 4, 2009. Identification was made on the morphological presence of unique roestelioid aecia with long cornulated peridia that lacerate along the sides. The aecia differ from those of G. juniperi-virginianae, the causal agent of cedar apple rust, which has aecial peridia that fimbriate to the base and are strongly recurved (1). Following release of a USDA Pest Alert, subsequent samples submitted to USDA/APHIS PPQ indicated widespread incidence of the G. yamadae aecial state in the northeast, including Maryland, Maine, New Hampshire, New Jersey, New York, Pennsylvania, and Rhode Island. Japanese apple rust likely went undetected for several years because of similar symptomatology to cedar apple rust. To our knowledge, this is the first report of the telial stage of G. yamadae in North America and the first report of this pathogen on Malus domestica in the United States. Knowledge of the geographic distribution of G. yamadae is of significance because of the actionable regulatory status of the pathogen and its potential impact on ornamental and fruit growers of Malus spp. in the United States. References: (1) F. D. Kern. A Revised Taxonomic Account of Gymnosporangium. Pennsylvania State University Press, University Park, PA, 1973. (2) H. Y. Yun et al. Plant Dis. 93:430, 2009. (3) H. Y. Yun et al. Mycologia 101:790, 2009.

Download Full-text

First Report of Powdery Mildew Caused by Podosphaera (Sphaerotheca) fusca on Euryops pectinatus in North America

Plant Disease ◽

10.1094/pdis.2000.84.9.1048a ◽

2000 ◽

Vol 84 (9) ◽

pp. 1048-1048 ◽

Cited By ~ 1

Author(s):

G. S. Saenz ◽

S. T. Koike ◽

N. Shishkoff

Keyword(s):

United States ◽

New York ◽

North America ◽

Powdery Mildew ◽

Fungal Growth ◽

The United States ◽

Voucher Specimen ◽

First Report ◽

Humidity Chamber ◽

Powdery Mildew Pathogen

Gray-leaved Euryops (Euryops pectinatus Cass., Asteraceae) is an evergreen shrub that is widely planted in landscapes in the United States. In the fall of 1999, powdery mildew was observed on E. pectinatus planted in landscapes in Redlands (San Bernardino County), CA. Symptoms consisted only of slight cupping of leaves. Fungal growth was observed on stems, leaves, petioles, and pedicels and was ectophytic and amphigenous. The white mycelium was patchy to effuse. Hyphal appressoria were indistinct (1). Conidiophore foot cells were cylindric and sometimes were tapered toward or constricted at the base. Foot cells measured 30 to 50 by 10 to 12 μm and were followed by one to two shorter cells. Conidia were cylindric to slightly doliform, borne in chains of two to three, and measured 26 to 38 by 14 to 18 μm. Conidial length to width ratios ranged from 1.7 to 2.4. Catenate conidia had crenate edge lines (3). Conidia possessed conspicuous fibrosin bodies and from their sides produced short germ tubes without appressoria. Cleistothecia were not observed. Based on these characters, the fungus was identified as Podosphaera fusca (Fr.) U. Braun & N. Shishkoff (Podosphaera sect. Sphaerotheca) (1,2). Pathogenicity was confirmed by gently pressing diseased leaves onto leaves of healthy E. pectinatus plants. Plants were incubated in a humidity chamber at 22 to 24°C and after 12 to 14 days powdery mildew colonies developed. E. pectinatus cv. Viridis, a cultivar that lacks the extensive pubescence of E. pectinatus, also developed disease when inoculated. This appears to be the first report of powdery mildew on E. pectinatus in North America. A voucher specimen has been deposited into the University of California Herbarium (accession # UC1738635). P. fusca was also observed on cv. Viridis in a nursery in New York in 1999. It is unclear where this pathogen originated. P. fusca parasitizes a large number of asteraceous species including dandelion (Taraxacum officinalis) and sowthistle (Sonchus spp.) weeds, which occur in the area and sometimes are infected with powdery mildew. The Euryops powdery mildew pathogen may be a race that is different than those found on other composites in the United States. The fungus was observed on plants in shaded areas but not on plants in full sun. References: (1) U. Braun. Nova Hedwigia 89:1, 1987. (2) U. Braun and S. Takamatsu. Schlechtendalia 4:1, 2000. (3) H. D. Shin and Y. J. La. Mycotaxon 46:445, 1993.

Download Full-text

First Report of Strawberry latent ringspot virus in a Mentha sp. from North America

Plant Disease ◽

10.1094/pdis.2004.88.8.907b ◽

2004 ◽

Vol 88 (8) ◽

pp. 907-907 ◽

Cited By ~ 18

Author(s):

J. D. Postman ◽

I. E. Tzanetakis ◽

R. R. Martin

Keyword(s):

United States ◽

North America ◽

Consensus Sequence ◽

The United States ◽

Ringspot Virus ◽

Yellow Vein ◽

Cdna Clones ◽

Meristem Culture ◽

Rt Pcr ◽

First Report

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

Download Full-text

First Report of Pyrenophora tritici-repentis Race 5 from North America

Plant Disease ◽

10.1094/pdis.1999.83.6.591a ◽

1999 ◽

Vol 83 (6) ◽

pp. 591-591 ◽

Cited By ~ 25

Author(s):

S. Ali ◽

L. J. Francl ◽

E. D. De Wolf

Keyword(s):

United States ◽

North America ◽

North Africa ◽

The United States ◽

Tan Spot ◽

Research Station ◽

First Report ◽

Pyrenophora Tritici Repentis ◽

Virulence Pattern ◽

Plant Pathol

Tan spot, caused by Pyrenophora tritici-repentis, is an important foliar disease of wheat worldwide. The fungus produces two distinct symptoms, necrosis (nec) and chlorosis (chl), on susceptible wheat genotypes. Fungal isolates have been grouped into five races based on their ability to induce necrosis and/or chlorosis on differentials Glenlea, Katepwa, 6B365, and Salamouni (1). Moreover, the isolates were designated on their ability to induce necrosis and chlorosis as follows: nec+chl+ (necrosis and chlorosis), nec+chl- (necrosis only), nec-chl+ (chlorosis only), and nec-chl- (neither symptom). Races 3 and 5 induce extensive chlorosis (nec-chl+) on 6B365 and Katepwa, respectively. Race 5 was reported on durum from North Africa. Races 1 to 4 were described from North America (1,2). During 1998, a survey of durum fields was conducted in the primary durum-growing area of North Dakota to assess the virulence pattern of P. tritici-repentis. Fifty-two single-spore isolates were obtained from diseased leaves. The isolates were evaluated for their virulence by inoculating them individually onto 15 seedlings of each wheat differential in the greenhouse. Forty-nine of 52 isolates were grouped as race 1 (nec+chl+) and three isolates, obtained from the Langdon Experiment Research Station, were grouped as race 5 (nec-chl+). Race 5 isolates were evaluated three times and consistently induced extensive chlorosis on Katepwa. This is the first report of the occurrence of race 5 outside of North Africa. This race may threaten wheat in the United States, so cultivars and germplasm should be evaluated for resistance. More isolates are under investigation to obtain a comprehensive virulence pattern of the pathogen population in the United States. References: L. Lamari and C. C. Bernier. Can. J. Plant Pathol. 11:49, 1989; (2) L. Lamari et al. Can. J. Plant Pathol. 17:312, 1995

Download Full-text

Surveillance and Molecular Epidemiology of Klebsiella pneumoniae Isolates That Produce Carbapenemases: First Report of OXA-48-Like Enzymes in North America

Antimicrobial Agents and Chemotherapy ◽

10.1128/aac.01686-12 ◽

2012 ◽

Vol 57 (1) ◽

pp. 130-136 ◽

Cited By ~ 123

Author(s):

Christine Lascols ◽

Gisele Peirano ◽

Meredith Hackel ◽

Kevin B. Laupland ◽

Johann D. D. Pitout

Keyword(s):

United States ◽

North America ◽

Genetic Relatedness ◽

The United States ◽

The Philippines ◽

Molecular Techniques ◽

Surveillance Program ◽

Content Type ◽

First Report ◽

Sequence Types

ABSTRACTA study was designed to characterize nonrepeat isolates of carbapenemase-producingK. pneumoniaeobtained from the SMART worldwide surveillance program during 2008 and 2009. Characterization was done by PCR and sequencing forblaVIM,blaIMP,blaNDM,blaOXA,blaKPC, and plasmid-mediated quinolone resistance and virulence factors (VFs). Genetic relatedness was determined with pulsed-field gel electrophoresis (PFGE) using XbaI and multilocus sequence typing. A total of 110 isolates were included; 47 possess genes that encodeK. pneumoniaecarbapenemases (KPCs), 26 NDMs, 19 VIMs, 13 OXA-48-like, and 5 imipenems (IMPs). We identified 3 different major sequence types (STs) among 65% of the isolates (i.e., ST11 [n= 11], ST147 [n= 23], and ST258 [n= 38]). ST11 and ST147, producing OXA-48-like and NDMs, were found in Argentina, Turkey, Greece, Italy, and India; ST258, producing KPCs, was present in the United States, Israel, Greece, and Puerto Rico. The major STs consisted of up to 4 different pulsotypes, and each pulsotype had a specific geographical distribution. A new ST, named ST903, withblaIMP-26, was identified in the Philippines, while twoblaOXA-48-positive isolates were detected in the United States. There were no significant differences in the distribution of the VFs between the isolates; all were positive forfimH,mrkD,wabG, andureA. This is the first report of OXA-48-like enzymes in North America. Our study highlights the importance of surveillance programs using molecular techniques as powerful tools to identify the importance of international sequence types.

Download Full-text