First report of late blight caused by Phytophthora infestans in potato in Tibet Autonomous Region of China

Late blight caused by Phytophthora infestans (Mont.) De Bary is the most destructive diseases in the potato field. Although it has been studied worldwide, it has not been reported in Tibet Autonomous Region of China, lying on the world’s highest plateau. To investigate whether the disease caused by P. infestans occurred in such region, a survey on potato disease was conducted in the summer in 2020. In August, potato (Solanum tuberosum) of the cultivar ‘Longshu 10’ with diseased leaves was observed in a potato field in Shigatse city in Tibet Autonomous Region (29.3N,88.8E). The necrotic brown lesions were shaped in round or irregularly with whitish growth of sporangium-producing structures on the underleaf surface, similar to typical late blight symptom. Affected leaves were collected for pathogen isolation. The abaxial side of the decayed leaves showed grey zones of sporulation. Upon isolation, three isolates were used for further investigation. The mycelium grew averagely at a linear rate of 4.35 mm per day at 19oC on Rye B agar (RBA, containing 50 g/L rye and 12 g/L agar), forming white colony. The opaque and lemon-shaped spores with a papilla at the distal end (Figure S1) had an average size of 36.2ⅹ20.3 µm, the shape and size consistent with P. infestans (Cardenas et al. 2011; Winton et al. 2007). The ribosomal ITS1-5.8S-ITS2 region was amplified from genomic DNA obtained from mycelium using primers ITS1 and ITS4 (Glass and Donaldson 1995). The sequences with 829 bp in size obtained from three isolates were identical, among which one of the sequences from Tibet isolate RKZ_27 was submitted to GenBank with Accession No. of MW559423. A BLAST search in NCBI (National Center for Biothchnology Information) revealed MW559423 had the highest similarity (100%) to P. infestans sequences (GenBank Accession No. of MK507866, MH401206 and KU992300). In addition, a partial nucleus DNA sequence from elongation factor 1-α (EF1-α) was amplified using primer set of EF_F/ EF_R (EF_F: 5’GGCCTTGACGACATCCAGAA3’; EF_R: 5’TAGCAGCTCAACCCGAAGTG3’), and a partial mitochondria DNA sequence (P2 region) including partial ATP synthase F1 subunit α gene (atp1), tRNA-Glu gene and partial NADH dehydrogenase subunit 4 (ND4) was amplified using primer set of P2F/P2R (P2F: 5’TTCCCTTTGTCCTCTACCGAT3’; P2R: 5’TTACGGCGGTTTAGCACATACA3’) (Vargas et al. 2009). The EF1-α and P2 region for three isolates were all identical and one of each sequence was submitted to GenBank with Accession No. of MZ189257 and MZ399710, respectively, which had 99.78% (XM_002998924.1) and 100% (MG869098) similarity with P. infestans, respectively. Phylogenetic analyses showed that the RKZ_27 was close to P. infestans (Figure S2). Pathogenicity was confirmed by inoculating ten potato leaves cv. ‘Favorita’ for each isolate with a 5 mm in diameter mycelium plug on each leaf. After 3 days of incubation at 19 oC in air-tight plastic bags, the inoculated leaves developed typical symptoms of late blight. All control leaves treated with distilled water remained healthy. The pathogenicity of three isolates were also confirmed by inoculating potato seedlings cv. ‘Favorita’ with sporangia suspension. The pathogen re-isolation on inoculated symptomatic leaves and seedlings were confirmed to be P. infestans by the morphological characteristics, which was fulfilled Koch postulates. The pathogenicity test both on leaves and seedlings were conducted twice. To our knowledge, this is the first report of P. infestans in potato field in Tibet Autonomous Region of China. The finding of potato late blight in this region have important epidemiological implications for the growers especially under favorable environmental conditions.

Download Full-text

First Report of Botryosphaeria dothidea, Diplodia seriata, and Neofusicoccum luteum Associated with Canker and Dieback of Grapevines in Tunisia

Plant Disease ◽

10.1094/pdis-05-13-0530-pdn ◽

2014 ◽

Vol 98 (3) ◽

pp. 420-420 ◽

Cited By ~ 6

Author(s):

S. Chebil ◽

R. Fersi ◽

A. Yakoub ◽

S. Chenenaoui ◽

M. Chattaoui ◽

...

Keyword(s):

Morphological Characteristics ◽

Aerial Mycelium ◽

Its2 Region ◽

Pathogenicity Test ◽

Botryosphaeria Dothidea ◽

Diplodia Seriata ◽

First Report ◽

Grapevine Dieback ◽

Pinus Spp ◽

Neofusicoccum Luteum

In 2011, common symptoms of grapevine dieback were frequently observed in 2- to 5-year-old table grape (Vitis vinifera L.) cvs. in four vineyards located in northern Tunisia. The symptoms included dead spur and cordons, shoot dieback, and sunken necrotic bark lesions, which progressed into the trunk resulting in the death of large sections of the vine. Longitudinal and transversal sections of cordons and spurs from symptomatic vines revealed brown wedge-shaped cankers of hard consistency. Twelve symptomatic samples from spur and cordons were collected, surface disinfected by dipping into 5% (v/v) sodium hypochlorite for 2 min, and small pieces from the edge of necrotic and healthy tissue were removed and plated onto potato dextrose agar (PDA) at 25°C in the dark. Based on colony and conidia morphological characteristics, isolates were divided in three species, named Diplodia seriata, Botryosphaeria dothidea, and Neofusicoccum luteum. D. seriata colonies were gray-brown with dense aerial mycelium producing brown cylindric to ellipsoid conidia rounded at both ends and averaged 22.4 × 11.7 μm (n = 50). B. dothidea colonies were initially white with abundant aerial mycelium, gradually becoming dark green olivaceous. Conidia were fusiform to fusiform elliptical with a subobtuse apex and averaged 24.8 × 4.7 μm (n = 50). N. luteum colonies were initially pale to colorless, gradually darkening with age and becoming gray to dark gray producing a yellow pigment that diffuses into the agar. Conidia were hyaline, thin-walled, aseptate, fusiform to fusiform elliptical, and averaged 19.8 × 5.5 μm (n = 50). Identity of the different taxa was confirmed by sequence analyses of the internal transcribed spacer (ITS1-5.8S-ITS2) region of the rDNA and part of the elongation factor 1-alpha (EF1-α) gene. BLAST analysis of sequences indicated that six isolates were identified as D. seriata (GenBank: AY259094, AY343353), one isolate as B. dothidea (AY236949, AY786319) and one isolate as N. luteum (AY259091, AY573217). Sequences were deposited in GenBank under accessions from KC178817 to KC178824 and from KF546829 to KF546836 for ITS region and EF1-α gene, respectively. A pathogenicity test was conducted on detached green shoots cv. Italia for the eight Botryosphaeriaceae isolates. Shoots were inoculated by placing a colonized agar plug (5 mm diameter) from the margin of a 7-day-old colony on fresh wound sites made with a sterilized scalpel. Each wound was covered with moisturized cotton and sealed with Parafilm. Control shoots were inoculated using non-colonized PDA plugs. After 6 weeks, discoloration of xylem and phloem and necrosis with average length of 38.8, 17.6, and 11.2 mm were observed from inoculated shoots with D. seriata, N. luteum, and B. dothidea, respectively, and all three fungi were re-isolated from necrotic tissue, satisfying Koch's postulates. Control shoots showed no symptoms of the disease and no fungus was re-isolated. In Tunisia, Botryosphaeria-related dieback was reported only on citrus tree caused by B. ribis (2), on Pinus spp. caused by D. pinea (4), on Quercus spp. caused by D. corticola (3), and on olive tree (Olea europea) caused by D. seriata (1). To our knowledge, this is the first report of D. seriata, B. dothidea, and N. luteum associated with grapevine dieback in Tunisia. References: (1) M. Chattaoui et al. Plant Dis. 96:905, 2012. (2) H. S. Fawcett. Calif. Citrogr. 16:208, 1931. (3) B. T. Linaldeddu et al. J. Plant Pathol. 91:234. 2009. (4) B. T. Linaldeddu et al. Phytopathol. Mediterr. 47:258, 2008.

Download Full-text

First Report of Cladobotryum protrusum causing Cobweb Disease on the Edible Mushroom Coprinus comatus

Plant Disease ◽

10.1094/pdis-07-14-0757-pdn ◽

2015 ◽

Vol 99 (2) ◽

pp. 287-287 ◽

Cited By ~ 6

Author(s):

G. Z. Wang ◽

M. P. Guo ◽

Y. B. Bian

Keyword(s):

Fruiting Body ◽

Morphological Characteristics ◽

Edible Mushroom ◽

Its2 Region ◽

Pathogenicity Test ◽

Distilled Water ◽

Fruiting Bodies ◽

Coprinus Comatus ◽

First Report ◽

Medicinal Value

Coprinus comatus is one of the most commercially important mushrooms in China. Its fruiting body possesses rich nutritional and medicinal value. In November 2013, unusual symptoms were observed on C. comatus on a mushroom farm in Wuhan, Hubei, China. At first, fruiting bodies were covered by white and cobweb-like mycelia. Later, the cap and stipe turned brown or dark before rotting and cracking. The pathogen was isolated from infected tissue of C. comatus. Colonies of the pathogen on potato dextrose agar (PDA) medium first appeared yellowish, followed by an obvious ochraceous or pinkish color. Aerial mycelia grew along the plate wall, cottony, 1 to 4 mm high. Conidiophores were borne on the tops of hyphae, had two to four branches, and were cylindrical, long clavate, or fusiform. Conidia were borne on the tops of the branches of conidiophores, had one to two separates, and were long and clavate. The spores ranged from 15.3 to 22.1 μm long and were 5.1 to 8.3 μm wide, which was consistent with the characteristics of Cladobotryum protrusum (1). The species was identified by ribosomal internal transcribed spacer sequencing. The ribosomal ITS1-5.8S-ITS2 region was amplified from the isolated strain using primers ITS1 and ITS4. A BLAST search in GenBank revealed the highest similarity (99%) to C. protrusum (GenBank Accession Nos. FN859408.1 and FN859413.1). The pathogen was grown on PDA at 25°C for 3 days, and the inoculation suspension was prepared by flooding the agar surface with sterilized double-distilled water for spore suspension (1 × 105 conidia/ml). In one treatment, the suspension was sprayed on casing soil (106 conidia/m2) and mixed thoroughly with it, then cased with treated soil for 2 to 3 cm thickness on the surface of compost in cultivation pots (35 × 25× 12 cm), with sterile distilled water as a control (2). Eight biological replicates were included in this treatment. In the second treatment, mycelia plugs (0.3 × 0.3 cm) without spore production were added to 20 fruiting bodies. Mushrooms treated with blank agar plugs (0.3 × 0.3 cm) were used as a control. The plugs were covered with sterilized cotton balls to avoid loss of moisture. Tested cultivation pots were maintained at 18°C and 85 to 95% relative humidity. In the samples where casing soil was sprayed with conidia suspension, white mildew developed on the pileus, and a young fruiting body grew out from the casing soil. Eventually, the surface of the mushroom was overwhelmed by the mycelia of the pathogen and the pileus turned brown or black. For the other group inoculated with mycelia plugs, only the stipe and pileus inoculated with mycelia turned brown or dark; it rotted and cracked 2 to 3 days later. The symptoms were similar to those observed on the C. comatus cultivation farm. Pathogens re-isolated from pathogenic fruiting bodies were confirmed to be C. protrusum based on morphological characteristics and ITS sequence. To our knowledge, this is the first report of the occurrence of C. protrusum on the edible mushroom C. comatus (3). Based on the pathogenicity test results, C. protrusum has the ability to severely infect the fruiting body of C. comatus. References: (1) K. Põldmaa. Stud. Mycol. 68:1, 2011. (2) F. J. Gea et al. Plant Dis. 96:1067, 2012. (3) W. H. Dong et al. Plant Dis. 97:1507, 2013.

Download Full-text

First Report of Late Blight Caused by Phytophthora infestans on Cape Gooseberry (Physalis peruviana) in Colombia

Plant Disease ◽

10.1094/pdis-91-4-0464b ◽

2007 ◽

Vol 91 (4) ◽

pp. 464-464 ◽

Cited By ~ 5

Author(s):

A. M. Vargas ◽

A. Correa ◽

D. C. Lozano ◽

A. González ◽

A. J. Bernal ◽

...

Keyword(s):

Late Blight ◽

Phytophthora Infestans ◽

Morphological Characteristics ◽

Control Measures ◽

Distilled Water ◽

First Report ◽

Physalis Peruviana ◽

Potato Slice ◽

Solanaceae Family ◽

Cape Gooseberry

Late blight caused by Phytophthora infestans is the most limiting disease for several species of the Solanaceae family in Colombia. A potential host for P. infestans is Cape gooseberry (Physalis peruviana), a species belonging to the Solanaceae family. Its center of origin is the highlands of Peru and it is grown at approximately 1,500 to 3,000 m above sea level. Cape gooseberry has become an important export fruit in Colombia. Consequently, in the last few years, the area cultivated with Physalis peruviana has increased dramatically. P. infestans was isolated from this crop in the province of Cundinamarca, Colombia. Symptoms caused by this oomycete appeared initially on the leaf margins as small, irregular, necrotic spots that expanded and merged, increasing the necrotic area. These spots had a soft texture resulting from the degradation of plant tissue by the pathogen. On old lesions, white mycelia and sporangia were observed. Affected plants were rarely killed, but under favorable conditions, severe symptoms were observed in leaves and yield was reduced. Ten isolates were obtained from infected tissue by placing a lesion directly on a potato slice in a moist chamber (2). Mycelia grown on the potato slice were then transferred to rye agar. Identification of the pathogen was performed based on morphological characteristics, specifically, sporangiophores of P. infestans are compoundly branched and develop sympodially, with swellings at the points where sporangia were attached (1). Further confirmation was obtained by sequencing the internal transcribed spacer (ITS) regions (GenBank Accession Nos. EF173467-EF173476). Koch's postulates were completed in the laboratory by spray inoculating detached leaves of Cape gooseberry with a zoospore suspension obtained from each of the 10 isolates. Inoculum was prepared by flooding 10-day-old cultures with sterile distilled water to obtain a 104/ml sporangial suspension followed by zoospore induction at 4°C. Leaves were sprayed with this suspension, placed in moist chambers, and incubated at 20°C in the dark. Control leaves were sprayed with sterile distilled water. Two separate leaves were inoculated with each isolate. The pathogen was reisolated from leaf lesions in all cases. The period between infection and the appearance of symptoms ranged from 5 to 7 days. To our knowledge, this is the first report of P. infestans causing damage on Cape gooseberry in Colombia. Chemical control measures are to some extent successfully applied in most regions where solanaceous crops are grown in Colombia. Nevertheless, suitable disease management for Physalis peruviana has not been achieved and further studies on the epidemiology of the disease on this new host are needed. References: (1) D. C. Erwin and O. K. Ribeiro. Phytophthora Diseases Worldwide. The American Phytopathological Society. St. Paul, MN, 1996. (2) G. A. Forbes et al. Phytopathology 87:375, 1997.

Download Full-text

First Report of Stem and Foliage Blight of Chrysanthemum Caused by Phytophthora drechsleri in the United States

Plant Disease ◽

10.1094/pdis-03-21-0631-pdn ◽

2021 ◽

Author(s):

Charles Krasnow ◽

Nancy Rechcigl ◽

Jennifer Olson ◽

Linus Schmitz ◽

Steven N. Jeffers

Keyword(s):

United States ◽

South Carolina ◽

Sequence Similarity ◽

Morphological Characteristics ◽

The United States ◽

Universal Primers ◽

Broad Host Range ◽

Pathogenicity Test ◽

First Report ◽

Foliage Blight

Chrysanthemum (Chrysanthemum × morifolium) plants exhibiting stem and foliage blight were observed in a commercial nursery in eastern Oklahoma in June 2019. Disease symptoms were observed on ~10% of plants during a period of frequent rain and high temperatures (26-36°C). Dark brown lesions girdled the stems of symptomatic plants and leaves were wilted and necrotic. The crown and roots were asymptomatic and not discolored. A species of Phytophthora was consistently isolated from the stems of diseased plants on selective V8 agar (Lamour and Hausbeck 2000). The Phytophthora sp. produced ellipsoid to obpyriform sporangia that were non-papillate and persistent on V8 agar plugs submerged in distilled water for 8 h. Sporangia formed on long sporangiophores and measured 50.5 (45-60) × 29.8 (25-35) µm. Oospores and chlamydospores were not formed by individual isolates. Mycelium growth was present at 35°C. Isolates were tentatively identified as P. drechsleri using morphological characteristics and growth at 35°C (Erwin and Ribeiro 1996). DNA was extracted from mycelium of four isolates, and the internal transcribed spacer (ITS) region was amplified using universal primers ITS 4 and ITS 6. The PCR product was sequenced and a BLASTn search showed 100% sequence similarity to P. drechsleri (GenBank Accession Nos. KJ755118 and GU111625), a common species of Phytophthora that has been observed on ornamental and vegetable crops in the U.S. (Erwin and Ribeiro 1996). The gene sequences for each isolate were deposited in GenBank (accession Nos. MW315961, MW315962, MW315963, and MW315964). These four isolates were paired with known A1 and A2 isolates on super clarified V8 agar (Jeffers 2015), and all four were mating type A1. They also were sensitive to the fungicide mefenoxam at 100 ppm (Olson et al. 2013). To confirm pathogenicity, 4-week-old ‘Brandi Burgundy’ chrysanthemum plants were grown in 10-cm pots containing a peat potting medium. Plants (n = 7) were atomized with 1 ml of zoospore suspension containing 5 × 103 zoospores of each isolate. Control plants received sterile water. Plants were maintained at 100% RH for 24 h and then placed in a protected shade-structure where temperatures ranged from 19-32°C. All plants displayed symptoms of stem and foliage blight in 2-3 days. Symptoms that developed on infected plants were similar to those observed in the nursery. Several inoculated plants died, but stem blight, dieback, and foliar wilt were primarily observed. Disease severity averaged 50-60% on inoculated plants 15 days after inoculation. Control plants did not develop symptoms. The pathogen was consistently isolated from stems of symptomatic plants and verified as P. drechsleri based on morphology. The pathogenicity test was repeated with similar results. P. drechsleri has a broad host range (Erwin and Ribeiro 1996; Farr et al. 2021), including green beans (Phaseolus vulgaris), which are susceptible to seedling blight and pod rot in eastern Oklahoma. Previously, P. drechsleri has been reported on chrysanthemums in Argentina (Frezzi 1950), Pennsylvania (Molnar et al. 2020), and South Carolina (Camacho 2009). Chrysanthemums are widely grown in nurseries in the Midwest and other regions of the USA for local and national markets. This is the first report of P. drechsleri causing stem and foliage blight on chrysanthemum species in the United States. Identifying sources of primary inoculum may be necessary to limit economic loss from P. drechsleri.

Download Full-text

First Report of Rhizoctonia solani AG 4 on Lamb's Lettuce in Italy

Plant Disease ◽

10.1094/pd-90-1109c ◽

2006 ◽

Vol 90 (8) ◽

pp. 1109-1109 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Northern Italy ◽

Crown Rot ◽

Pathogenicity Test ◽

First Report ◽

Pathogenicity Tests ◽

Hyphal Diameter ◽

Wheat Kernels ◽

Extensive Necrosis

Lamb's lettuce or corn salad (Valerianella olitoria) is increasingly grown in Italy and used primarily in the preparation of mixed processed salad. In the fall of 2005, plants of lamb's lettuce, cv Trophy, exhibiting a basal rot were observed in some commercial greenhouses near Bergamo in northern Italy. The crown of diseased plants showed extensive necrosis, progressing to the basal leaves, with plants eventually dying. The first symptoms, consisting of water-soaked zonate lesions on basal leaves, were observed on 30-day-old plants during the month of October when temperatures ranged between 15 and 22°C. Disease was uniformly distributed in the greenhouses, progressed rapidly in circles, and 50% of the plants were affected. Diseased tissue was disinfested for 1 min in 1% NaOCl and plated on potato dextrose agar amended with 100 μg/liter of streptomycin sulfate. A fungus with the morphological characteristics of Rhizoctonia solani was consistently and readily isolated and maintained in pure culture after single-hyphal tipping (3). The five isolates of R. solani, obtained from affected plants successfully anastomosed with tester isolate AG 4, no. RT 31, received from R. Nicoletti of the Istituto Sperimentale per il Tabacco, Scafati, Italy (2). The hyphal diameter at the point of anastomosis was reduced, and cell death of adjacent cells occurred (1). Pairings were also made with AG 1, 2, 3, 5, 7, and 11 with no anastomoses observed between the five isolates and testers. For pathogenicity tests, the inoculum of R. solani (no. Rh. Vale 1) was grown on autoclaved wheat kernels at 25°C for 10 days. Plants of cv. Trophy were grown in 10-liter containers (20 × 50 cm, 15 plants per container) on a steam disinfested substrate (equal volume of peat and sand). Inoculations were made on 20-day-old plants by placing 2 g of infected wheat kernels at each corner of the container with 3 cm as the distance to the nearest plant. Plants inoculated with clean wheat kernels served as controls. Three replicates (containers) were used. Plants were maintained at 25°C in a growth chamber programmed for 12 h of irradiation at a relative humidity of 80%. The first symptoms, consisting of water-soaked lesions on the basal leaves, developed 5 days after inoculation with crown rot and plant kill in 2 weeks. Control plants remained healthy. R. solani was consistently reisolated from infected plants. The pathogenicity test was carried out twice with similar results. This is, to our knowledge, the first report of R. solani on lamb's lettuce in Italy as well as worldwide. The isolates were deposited at the AGROINNOVA fungal collection. The disease continues to spread in other greenhouses in northern Italy. References: (1) D. Carling. Rhizoctonia Species: Pages 37–47 in: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. B. Sneh et al., eds. Kluwer Academic Publishers, the Netherlands, 1996. (2) J. Parmeter et al. Phytopathology, 59:1270, 1969. (3) B. Sneh et al. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN, 1996.

Download Full-text

First Report of Phytophthora drechsleri Associated with Stem and Foliar Blight of Gynura bicolor in Taiwan

Plant Disease ◽

10.1094/pdis-12-10-0931 ◽

2011 ◽

Vol 95 (7) ◽

pp. 874-874 ◽

Cited By ~ 1

Author(s):

Y. M. Shen ◽

C. H. Chao ◽

H. L. Liu

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Hyphal Growth ◽

Pathogenicity Test ◽

Distilled Water ◽

First Report ◽

Foliar Blight ◽

Dual Cultures ◽

Phytophthora Drechsleri ◽

Gynura Bicolor

Gynura bicolor (Roxb. ex Willd.) DC., known as Okinawa spinach or hong-feng-cai, is a commonly consumed vegetable in Asian countries. In May 2010, plants with blight and wilt symptoms were observed in commercial vegetable farms in Changhua, Taiwan. Light brown-to-black blight lesions developed from the top of the stems to the petioles and extended to the base of the leaves. Severely infected plants declined and eventually died. Disease incidence was approximately 20%. Samples of symptomatic tissues were surface sterilized in 0.6% NaOCl and plated on water agar. A Phytophthora sp. was consistently isolated and further plated on 10% unclarified V8 juice agar, with daily radial growths of 7.6, 8.6, 5.7, and 2.4 mm at 25, 30, 35, and 37°C, respectively. Four replicates were measured for each temperature. No hyphal growth was observed at 39°C. Intercalary hyphal swellings and proliferating sporangia were produced in culture plates flooded with sterile distilled water. Sporangia were nonpapillate, obpyriform to ellipsoid, base tapered or rounded, and 43.3 (27.5 to 59.3) × 27.6 (18.5 to 36.3) μm. Clamydospores and oospores were not observed. Oospores were present in dual cultures with an isolate of P. nicotianae (p731) (1) A2 mating type, indicating that the isolate was heterothallic. A portion of the internal transcribed spacer sequence was deposited in GenBank (Accession No. HQ717146). The sequence was 99% identical to that of P. drechsleri SCRP232 (ATCC46724) (3), a type isolate of the species. The pathogen was identified as P. drechsleri Tucker based on temperature growth, morphological characteristics, and ITS sequence homology (3). To evaluate pathogenicity, the isolated P. drechsleri was inoculated on greenhouse-potted G. bicolor plants. Inoculum was obtained by grinding two dishes of the pathogen cultured on potato dextrose agar (PDA) with sterile distilled water in a blender. After filtering through a gauze layer, the filtrate was aliquoted to 240 ml. The inoculum (approximately 180 sporangia/ml) was sprayed on 24 plants of G. bicolor. An equal number of plants treated with sterile PDA processed in the same way served as controls. After 1 week, incubation at an average temperature of 29°C, blight and wilt symptoms similar to those observed in the fields appeared on 12 inoculated plants. The pathogen was reisolated from the lesions of diseased stems and leaves, fulfilling Koch's postulates. The controls remained symptomless. The pathogenicity test was repeated once with similar results. G. bicolor in Taiwan has been recorded to be infected by P. cryptogea (1,2), a species that resembles P. drechsleri. The recorded isolates of P. cryptogea did not have a maximal growth temperature at or above 35°C (1,2), a distinctive characteristic to discriminate between the two species (3). To our knowledge, this is the first report of P. drechsleri being associated with stem and foliar blight of G. bicolor. References: (1) P. J. Ann. Plant Pathol. Bull. 5:146, 1996. (2) H. H. Ho et al. The Genus Phytophthora in Taiwan. Institute of Botany, Academia Sinica, Taipei, 1995. (3) R. Mostowfizadeh-Ghalamfarsa et al. Fungal Biol. 114:325, 2010.

Download Full-text

First Report of Fusarium pernambucanum Causing Fruit Rot of Muskmelon in China

Plant Disease ◽

10.1094/pdis-07-21-1520-pdn ◽

2021 ◽

Author(s):

Xianping Zhang ◽

Jiwen Xia ◽

Jiakui Liu ◽

Dan Zhao ◽

Lingguang Kong ◽

...

Keyword(s):

Phylogenetic Analyses ◽

Apical Cell ◽

Morphological Characteristics ◽

Fruit Rot ◽

Likelihood Method ◽

Correct Identification ◽

Pathogenicity Test ◽

First Report ◽

The Core ◽

Representative Isolate

Muskmelon (Cucumis melo L.) is one of the most widely cultivated and economically important fruit crops in the world. However, many pathogens can cause decay of muskmelons; among them, Fusarium spp. is the most important pathogen, affecting fruit yield and quality (Wang et al. 2011). In May 2017, fruit rot symptoms were observed on ripening muskmelons (cv. Jipin Zaoxue) in several fields in Liaocheng of Shandong Province, China. Symptoms appeared as brown, water-soaked lesions, irregularly circular in shape, with the lesion size ranging from a small spot (1 to 2 cm) to the decay of the entire fruit. The core and the surface of the infected fruit were covered with white to rose-reddish mycelium. Two infected muskmelons were collected from each of two fields, 10 km apart. Tissues from the inside of the infected fruit were surface disinfected with 75% ethanol for 30 s, and cultured on potato dextrose agar (PDA) at 25 °C in the dark for 5 days. Four purified cultures were obtained using the single spore method. On carnation leaf agar (CLA), macroconidia had a pronounced dorsiventral curvature, falcate, 3 to 5 septa, with tapered apical cell, and foot-shaped basal cell, measuring 19 to 36 × 4 to 6 μm. Chlamydospores were abundant, 5.5–7.5 μm wide, and 5.5–10.5 μm long, ellipsoidal or subglobose. No microconidia were observed. These morphological characteristics were consistent with the descriptions of F. pernambucanum (Santos et al. 2019). Because these isolates had similar morphology, one representative isolate was selected for multilocus phylogenetic analyses. DNA was extracted from the representative isolate using the CTAB method. The nucleotide sequences of the internal transcribed spacers (ITS) (White et al. 1990), translation elongation factor 1-α gene (TEF1), RNA polymerase II second largest subunit gene (RPB2), calmodulin (CAM) (Xia et al. 2019) were amplified using specific primers, sequenced, and deposited in GenBank (MN822926, MN856619, MN856620, and MN865126). Based on the combined dataset of ITS, TEF1, RPB2, CAM, alignments were made using MAFFT v. 7, and phylogenetic analyses were processed in MEGA v. 7.0 using the maximum likelihood method. The studied isolate (XP1) clustered together with F. pernambucanum reference strain URM 7559 (99% bootstrap). To perform pathogenicity test, 10 μl of spore suspensions (1 × 106 conidia/ml) were injected into each muskmelon fruit using a syringe, and the control fruit was inoculated with 10 μl of sterile distilled water. There were ten replicated fruits for each treatment. The test was repeated three times. After 7 days at 25 °C, the interior of the inoculated muskmelons begun to rot, and the rot lesion was expanded from the core towards the surface of the fruit, then white mycelium produced on the surface. The same fungus was re-isolated from the infected tissues and confirmed to fulfill the Koch’s postulates. No symptoms were observed on the control muskmelons. To our knowledge, this is the first report of F. pernambucanum causing of fruit rot of muskmelon in China. Considering the economic value of the muskmelon crop, correct identification can help farmers select appropriate field management measures for control of this disease.

Download Full-text

First Report of Powdery Mildew Caused by Golovinomyces biocellatus on Agastache rugosa in Korea

Plant Disease ◽

10.1094/pdis-03-14-0298-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1278-1278 ◽

Cited By ~ 1

Author(s):

S. E. Cho ◽

J. H. Park ◽

S. H. Hong ◽

I. Y. Choi ◽

H. D. Shin

Keyword(s):

Powdery Mildew ◽

Severe Disease ◽

Morphological Characteristics ◽

Control Measures ◽

Control Treatment ◽

Width Ratio ◽

Korean Isolate ◽

Pathogenicity Test ◽

Agastache Rugosa ◽

First Report

Agastache rugosa (Fisch. & C.A. Mey.) Kuntze, known as Korean mint, is an aromatic plant in the Lamiaceae. It is widely distributed in East Asian countries and is used as a Chinese traditional medicine. In Korea, fresh leaves are commonly added to fish soups and stews (3). In November 2008, several dozen Korean mints plants growing outdoors in Gimhae City, Korea, were found to be severely infected with a powdery mildew. The same symptoms had been observed in Korean mint plots in Busan and Miryang cities from 2008 to 2013. Symptoms first appeared as thin white colonies, which subsequently developed into abundant hyphal growth on stems and both sides of the leaves. Severe disease pressure caused withering and senescence of the leaves. Voucher specimens (n = 5) were deposited in the Korea University Herbarium (KUS). Appressoria on the mycelium were nipple-shaped or nearly absent. Conidiophores were 105 to 188 × 10 to 13 μm and produced 2 to 4 immature conidia in chains with a sinuate outline, followed by 2 to 3 cells. Foot-cells of the conidiophores were straight, cylindrical, slightly constricted at the base, and 37 to 58 μm long. Conidia were hyaline, ellipsoid to barrel-shaped, measured 25 to 40 × 15 to 23 μm (length/width ratio = 1.4 to 2.1), lacked distinct fibrosin bodies, and showed reticulate wrinkling of the outer walls. Primary conidia were obconically rounded at the apex and subtruncate at the base. Germ tubes were produced at the perihilar position of conidia. No chasmothecia were observed. The structures described above were typical of the Oidium subgenus Reticuloidium anamorph of the genus Golovinomyces. The measurements and morphological characteristics were compatible with those of G. biocellatus (Ehrenb.) V.P. Heluta (1). To confirm the identification, molecular analysis of the sequence of the internal transcribed spacer (ITS) region of ribosomal DNA (rDNA) of isolate KUS-F27200 was conducted. The complete ITS rDNA sequence was amplified using primers ITS5 and P3 (4). The resulting 514-bp sequence was deposited in GenBank (Accession No. KJ585415). A GenBank BLAST search of the Korean isolate sequence showed >99% similarity with the ITS sequence of many G. biocellatus isolates on plants in the Lamiaceae (e.g., Accession Nos. AB307669, AB769437, and JQ340358). Pathogenicity was confirmed by gently pressing diseased leaf onto leaves of five healthy, potted Korean mint plants. Five non-inoculated plants served as a control treatment. Inoculated plants developed symptoms after 7 days, whereas the control plants remained symptomless. The fungus present on inoculated plants was identical morphologically to that observed on the original diseased plants. The pathogenicity test was repeated with identical results. A powdery mildew on A. rugosa caused by G. biocellatus was reported from Romania (2). To our knowledge, this is the first report of powdery mildew caused by G. biocellatus on A. rugosa in Korea. The plant is mostly grown using organic farming methods with limited chemical control options. Therefore, alternative control measures should be considered. References: (1) U. Braun and R. T. A. Cook. Taxonomic Manual of the Erysiphales (Powdery Mildews), CBS Biodiversity Series No. 11. CBS, Utrecht, 2012. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., online publication, USDA ARS, retrieved 17 February 2014. (3) T. H. Kim et al. J. Sci. Food Agric. 81:569, 2001. (4) S. Takamatsu et al. Mycol. Res. 113:117, 2009.

Download Full-text

First Report of Phytophthora ramorum on Viburnum bodnantense in Belgium

Plant Disease ◽

10.1094/pdis.2003.87.2.203c ◽

2003 ◽

Vol 87 (2) ◽

pp. 203-203 ◽

Cited By ~ 11

Author(s):

D. De Merlier ◽

A. Chandelier ◽

M. Cavelier

Keyword(s):

The Netherlands ◽

Plant Protection ◽

Morphological Characteristics ◽

Pcr Primers ◽

Selective Medium ◽

Phytophthora Species ◽

Phytophthora Ramorum ◽

Pathogenicity Test ◽

First Report ◽

Root Necrosis

In the past decade, a new Phytophthora species inducing shoot canker on Rhododendron and dieback of Viburnum has been observed in Europe, mainly in Germany and the Netherlands, and California. This new pathogen has been named Phytophthora ramorum (3). In May 2002, a diseased Viburnum plant (Viburnum bodnantense) from the Plant Protection Service (Ministry of Agriculture, Belgium) was submitted to our laboratory for diagnosis. Symptoms included wilting, leaves turning from green to brown, discolored vascular tissues, and root necrosis. The plant came from a Belgian ornamental nursery that obtained supplies of stock plants from the Netherlands. Pieces of necrotic root tissue were excised, surface-disinfected, and transferred aseptically to a Phytophthora selective medium. P. ramorum was identified based on morphological characteristics, including the production of numerous, thin-walled chlamydospores (25 to 70 µm in diameter, average 43 µm) and deciduous, semi-papillate sporangia arranged in clusters. Radial growth after 6 days at 20°C on V8 juice agar was 2.8 mm per day. Random amplified microsatellite markers (RAMS) (2) from the total genomic DNA of the Belgian strain (CBS 110901) were similar to those of P. ramorum reference strains (CBS 101330, CBS 101332, and CBS 101554). Using PCR primers specific for P. ramorum, the identification was confirmed by W. A. Man in't Veld (Plantenziektenkundige Dienst, Wageningen, the Netherlands) (1). A pathogenicity test was carried out on three sterile cuttings of Rhododendron catawbiense (3). Brown lesions were observed on the inoculated cuttings after 6 to 7 days. None of the three uninoculated cuttings showed symptoms of infection. P. ramorum was reisolated from lesion margins on the inoculated cuttings. To our knowledge, this is the first report of the fungus from Belgium. Since our initial observation, we have found P. ramorum in other Belgian nurseries on R. yakusimanum. References: (1) M. Garbelotto et al. US For. Ser. Gen. Tech. Rep. PSW-GRT. 184:765, 2002. (2) J. Hantula et al. Mycol. Res. 101:565, 1997. (3) S. Werres et al. Mycol. Res. 105:1155, 2001.

Download Full-text

First Report of Ramularia coleosporii causing Leaf Spot on Perilla frutescens in Korea

Plant Disease ◽

10.1094/pdis-01-21-0223-pdn ◽

2021 ◽

Author(s):

Md Aktaruzzaman ◽

Tania Afroz ◽

Hyo-Won Choi ◽

Byung Sup Kim

Keyword(s):

Leaf Spot ◽

Ipomoea Batatas ◽

Rust Fungus ◽

Morphological Characteristics ◽

Perilla Frutescens ◽

Herbaceous Plant ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Perilla (Perilla frutescens var. japonica), a member of the family Labiatae, is an annual herbaceous plant native to Asia. Its fresh leaves are directly consumed and its seeds are used for cooking oil. In July 2018, leaf spots symptoms were observed in an experimental field at Gangneung-Wonju National University, Gangneung, Gangwon province, Korea. Approximately 30% of the perilla plants growing in an area of about 0.1 ha were affected. Small, circular to oval, necrotic spots with yellow borders were scattered across upper leaves. Masses of white spores were observed on the leaf underside. Ten small pieces of tissue were removed from the lesion margins of the lesions, surface disinfected with NaOCl (1% v/v) for 30 s, and then rinsed three times with distilled water for 60 s. The tissue pieces were then placed on potato dextrose agar (PDA) and incubated at 25°C for 7 days. Five single spore isolates were obtained and cultured on PDA. The fungus was slow-growing and produced 30-50 mm diameter, whitish colonies on PDA when incubated at 25ºC for 15 days. Conidia (n= 50) ranged from 5.5 to 21.3 × 3.5 to 5.8 μm, were catenate, in simple or branched chains, ellipsoid-ovoid, fusiform, and old conidia sometimes had 1 to 3 conspicuous hila. Conidiophores (n= 10) were 21.3 to 125.8 × 1.3 to 3.6 μm in size, unbranched, straight or flexuous, and hyaline. The morphological characteristics of five isolates were similar. Morphological characteristics were consistent with those described for Ramularia coleosporii (Braun, 1998). Two representative isolates (PLS 001 & PLS003) were deposited in the Korean Agricultural Culture Collection (KACC48670 & KACC 48671). For molecular identification, a multi-locus sequence analysis was conducted. The internal transcribed spacer (ITS) regions of the rDNA, partial actin (ACT) gene and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene were amplified using primer sets ITS1/4, ACT-512F/ACT-783R and gpd1/gpd2, respectively (Videira et al. 2016). Sequences obtained from each of the three loci for isolate PLS001 and PLS003 were deposited in GenBank with accession numbers MH974744, MW470869 (ITS); MW470867, MW470870 (ACT); and MW470868, MW470871 (GAPDH), respectively. Sequences for all three genes exhibited 100% identity with R. coleosporii, GenBank accession nos. GU214692 (ITS), KX287643 (ACT), and 288200 (GAPDH) for both isolates. A multi-locus phylogenetic tree, constructed by the neighbor-joining method with closely related reference sequences downloaded from the GenBank database and these two isolates demonstrated alignment with R. coleosporii. To confirm pathogenicity, 150 mL of a conidial suspension (2 × 105 spores per mL) was sprayed on five, 45 days old perilla plants. An additional five plants, to serve as controls, were sprayed with sterile water. All plants were placed in a humidity chamber (>90% relative humidity) at 25°C for 48 h after inoculation and then placed in a greenhouse at 22/28°C (night/day). After 15 days leaf spot symptoms, similar to the original symptoms, developed on the leaves of the inoculated plants, whereas the control plants remained symptomless. The pathogenicity test was repeated twice with similar results. A fungus was re-isolated from the leaf lesions on the inoculated plants which exhibited the same morphological characteristics as the original isolates, fulfilling Koch’s postulates. R. coleosporii has been reported as a hyperparasite on the rust fungus Coleosporium plumeriae in India & Thailand and also as a pathogen infecting leaves of Campanula rapunculoides in Armenia, Clematis gouriana in Taiwan, Ipomoea batatas in Puerto Rico, and Perilla frutescens var. acuta in China (Baiswar et al. 2015; Farr and Rossman 2021). To the best of our knowledge, this is the first report of R. coleosporii causing leaf spot on P. frutescens var. japonica in Korea. This disease poses a threat to production and management strategies to minimize leaf spot should be developed.

Download Full-text