scholarly journals Characterization of a New Monopartite Begomovirus with a Betasatellite Associated with Leaf Curl, Yellow Vein, and Vein Enation in Hibiscus rosa-sinensis

Plant Disease ◽  
2020 ◽  
Vol 104 (5) ◽  
pp. 1318-1327
Author(s):  
Chih-Hung Huang ◽  
Chia-Hsing Tai ◽  
Nabin Sharma ◽  
Chia-Hung Chao ◽  
Chung-Jan Chang ◽  
...  
Keyword(s):  
Open Reading Frames ◽  
Yellow Vein ◽  
Nucleotide Identity ◽  
Cotton Leaf ◽  
Species Demarcation ◽  
Conserved Sequence ◽  
Hibiscus Rosa Sinensis ◽  
A Genome ◽  
Species Demarcation Threshold ◽  
Leaf Curl

A new begomovirus, tentatively named hibiscus yellow vein leaf curl virus (HYVLCV), was identified in Hibiscus rosa-sinensis plants showing symptoms of leaf curl, yellow vein, and vein enation on the undersides of the leaf in Taiwan. Sequence analysis of the full-length HYVLCV genome from the rolling cycle amplicon revealed a genome of 2,740 nucleotides that contains six open reading frames and a conserved sequence (5′-TAATATTAC-3′) commonly found in geminiviral genomes. HYVLCV shares the highest nucleotide identity (88.8%) with cotton leaf curl Multan virus (CLCuMuV) genome, which is lower than the criteria (91%) set for species demarcation in the genus Begomovirus. No begomoviral DNA-B was detected; however, a begomovirus-associated DNA betasatellite (DNA-β) was detected. The DNA-β (1,355 nucleotides) shares the highest nucleotide identity (78.6%) with malvastrum yellow vein betasatellite (MaYVB). Because the identity is slightly higher than the criteria (78%) set for the species demarcation threshold for a distinct DNA-β species, the DNA-β of HYVLCV reported in this study is considered the same species of MaYVB and tentatively named MaYVB-Hib. An expected 1,498-bp fragment was amplified with two HYVLCV-specific primers from 10 of 11 field-collected samples. Four independent amplicons were sequenced, revealing 100% nucleotide identity with the HYVLCV genome. Agroinoculation of a dimer of the infectious monopartite genome alone to Nicotiana benthamiana resulted in mild symptoms at 28 days postinoculation (dpi); coagroinoculation with the DNA-β satellite resulted in severe symptoms at 12 dpi. HYVLCV could be transmitted to healthy H. rosa-sinensis by grafting, resulting in yellow vein symptoms at 30 dpi.

scholarly journals First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum (Blechum pyramidatum)

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 701-701 ◽  
Author(s):  
W. S. Tsai ◽  
S. L. Shih ◽  
L. M. Lee ◽  
L. M. Dolores ◽  
L. Kenyon
Keyword(s):  
Dna Sequences ◽  
Disease Incidence ◽  
The Philippines ◽  
Open Reading Frames ◽  
Yellow Vein ◽  
Nucleotide Identity ◽  
Plant Sample ◽  
First Report ◽  
Conserved Sequence ◽  
Vein Disease

Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)—two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)—and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

scholarly journals Molecular Characterization of a Begomovirus and Betasatellite Causing Yellow Vein Net Disease of Ageratum houstonianum

Plant Disease ◽  
2015 ◽  
Vol 99 (5) ◽  
pp. 627-631 ◽  
Author(s):  
Ashish Srivastava ◽  
Susheel Kumar ◽  
Shri Krishna Raj
Keyword(s):  
Sequence Analysis ◽  
Sequence Homology ◽  
Phylogenetic Relationships ◽  
Disease Incidence ◽  
Open Reading Frames ◽  
Yellow Vein ◽  
Full Length Genome ◽  
First Time ◽  
Leaf Curl

Ageratum houstonianum was introduced in India as an annual ornamental plant and is grown in beds for blue head flowers. Yellow vein net disease was observed on A. houstonianum plants with about 9.0% disease incidence during a survey in February 2012 at gardens of NBRI, Lucknow, India. Association of a begomovirus and betasatellite with the disease was characterized based on sequence analyses of their cloned full length genome isolated from diseased A. houstonianum. Sequence analysis of the begomovirus showed presence of the six open reading frames in its genome, similar to the arrangement of Old World begomoviruses. The begomoviral genome shared 95 to 97% sequence identities with various strains of Ageratum enation virus (AEV); however, it showed distinct phylogenetic relationships with them, and hence was identified as a variant of AEV based on more than 94% sequence homology, the criteria defined by ICTV. The sequence analysis of associated betasatellite revealed highest 93% sequence identity and close phylogenetic relationships with Ageratum leaf curl betasatellite (ALCB) molecules; therefore, it was identified as an isolate of ALCB (based on 93% sequence homology). Agroinfiltration of partial dimers of the AEV variant and ALCB induced similar systemic yellow vein net and leaf curl symptoms on A. houstonianum when infiltrated in combination, fulfilling Koch’s postulates. Characterization of AEV and ALCB causing yellow vein net disease of A. houstonianum is being reported for the first time.

scholarly journals Association of a recombinant Cotton leaf curl Bangalore virus with yellow vein and leaf curl disease of okra in India

2013 ◽  
Vol 24 (2) ◽  
pp. 188-198 ◽  
Author(s):  
V. Venkataravanappa ◽  
C. N. Lakshminarayana Reddy ◽  
A. Devaraju ◽  
Salil Jalali ◽  
M. Krishna Reddy
Keyword(s):  
Yellow Vein ◽  
Cotton Leaf ◽  
Leaf Curl Disease ◽  
Leaf Curl

scholarly journals Engineering Resistance Against Cotton Leaf Curl Kokhran Virus-Burewala Strain Using CRISPR-Cas9 System in Nicotiana Benthamiana

2021 ◽  
Author(s):  
Muhammad Hamza ◽  
Muhammad Zuhaib Khan ◽  
Roma Mustafa ◽  
Hira Kamal ◽  
Aneela Hussain ◽  
...  
Keyword(s):  
Genome Editing ◽  
Nicotiana Benthamiana ◽  
Durable Resistance ◽  
Blot Hybridization ◽  
Southern Blot Hybridization ◽  
Pcr Primers ◽  
Cotton Leaf ◽  
A Genome ◽  
Intact Virus ◽  
Leaf Curl

Abstract Clustered regularly interspaced palindromic repeats (CRISPR) and associated Cas9 nuclease (CRISPR-Cas9) systems provide adaptive immunity to prokaryotes against infectious phage particles that can be engineered as a genome-editing tool. Guided by an RNA strand, the class II type II CRISPR-Cas9 system can be employed to provide resistance against plant DNA viruses. Here we describe an efficient CRISPR-Cas9 genome editing system based on simultaneous targeting of the highly conserved intergenic region (IR) of the virus that can provide resistance against Cotton leaf curl Kokhran virus-Burewala strain (CLCuKoV-Bur) in Nicotiana benthamiana plants. The data revealed that upon infection, the transgenic plants harboring CRISPR-Cas9 and two gRNAs showed complete resistance against CLCuKoV-Bur/Cotton leaf curl Multan betasatellite (CLCuMB). All efforts failed to find the intact virus in CLCuKoV-Bur/CLCuMB challenged transgenic (OX:Cas9NB:IR) plants using either gene specific PCR primers or CLCuKoV-Bur as a probe in southern blot hybridization. Thus, our results have demonstrated an efficient CRISPR-Cas9 approach to engineer durable resistance against CLCuKoV-Bur in a model system. The implications of these findings are discussed.

scholarly journals Association ofBhendi yellow vein mosaic virusand Cotton leaf curl Multan betasatellite withCapsicum annuumFrom Kashmir valley, India

2015 ◽  
Vol 32 ◽  
pp. 9 ◽  
Author(s):  
Rahul Mohan Singh ◽  
Shivangi Sharma ◽  
Aijaz A. Zaidi ◽  
Aflaq Hamid ◽  
Vipin Hallan
Keyword(s):  
Yellow Vein ◽  
Cotton Leaf ◽  
Kashmir Valley ◽  
Leaf Curl

First report of Mesta yellow vein mosaic virus, Cotton leaf curl Multan betasatellite and Cotton leaf curl Multan alphasatellite infecting cotton in Pakistan

Plant Disease ◽  
2014 ◽  
pp. 140122140029006 ◽  
Author(s):  
Usman Hameed ◽  
Muhammad Zia-Ur-Rehman ◽  
Hans-Werner Herrmann ◽  
Muhammad Saleem Haider ◽  
Judith K Brown
Keyword(s):  
Mosaic Virus ◽  
Yellow Vein ◽  
Cotton Leaf ◽  
First Report ◽  
Yellow Vein Mosaic Virus ◽  
Leaf Curl

scholarly journals First Report of Sweet potato leaf curl virus on Blue Morning Glory in Greece

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 700-700 ◽  
Author(s):  
E. Fiallo-Olivé ◽  
N. I. Katis ◽  
J. Navas-Castillo
Keyword(s):  
Sweet Potato ◽  
Rolling Circle Amplification ◽  
Morning Glory ◽  
Yellow Vein ◽  
Nucleotide Identity ◽  
Potato Leaf ◽  
First Report ◽  
Crete Island ◽  
Leaf Curl Virus ◽  
Leaf Curl

Blue morning glory (Ipomoea indica, Convolvulaceae) plants are widespread along the Greek coast, where they grow as weeds in addition to being cultivated as ornamentals. Yellow vein symptoms are frequently observed on these plants. These symptoms are similar to those reported for isolates of Sweet potato leaf curl virus (SPLCV) infecting I. indica in Italy and Spain (1,3). SPLCV belongs to the sweepoviruses, a unique group within the genus Begomovirus in the family Geniminiviridae that infects sweet potato (I. batatas) crops around the world. In May 2013, three leaf samples of I. indica showing yellow vein symptoms were collected in Kolymbari (Crete Island), where ~50% of the observed plants were symptomatic, and five asymptomatic leaf samples were collected in Kremasti and Mandriko (Rhodes Island). Total DNA, isolated from all samples, was used as a template in rolling-circle amplification (RCA) using ϕ29 DNA polymerase (TempliPhi kit, GE Healthcare, Little Chalfont, UK) and the product was digested with a set of restriction endonucleases. The samples from Kolymbari and one sample from Kremasti yielded amplification products that were shown to contain a single BamHI site. The DNA fragments of ~2.8 kbp obtained from one sample from each island were cloned into pBluescript II SK(+) (Stratagene, La Jolla, CA). Inserts of two clones from the Kolymbari sample and one clone from the Kremasti sample were completely sequenced (Macrogen, Seoul, South Korea). Sequences were aligned with available sequences of sweepoviruses using MUSCLE and pairwise identity scores were calculated with SDT as described (4). The sequences obtained from Kolymbari (2,830 nt, GenBank Accession Nos. KF697069 and KF697070) were 98.8% similar between them and showed the highest nucleotide identity (97.7%) with a SPLCV isolate obtained from an I. indica plant in Sicily Island (Italy) (AJ586885) (1). The sequence obtained from Kremasti (2,804 nt, KF697071) showed the highest nucleotide identity (92.4%) with a SPLCV isolate (previously named as Ipomoea yellow vein virus, which is currently a synonym of SPLCV [2]) obtained from an I. indica plant from southern Spain (EU839578) (3). Nucleotide sequence identities were above the 91% threshold for begomovirus species demarcation (2), thus confirming that the begomoviruses found infecting I. indica in Greece are isolates of SPLCV. It is worth to note that the infected I. indica plant from Kremasti did not show any conspicuous symptoms, thus highlighting the importance of this species as an alternative host for SPLCV, which could thus affect the sweet potato crop that is grown in Greece in familiar plots. To our knowledge, this is the first report of SPLCV in Greece. References: (1) R. W. Briddon et al. Plant Pathol. 55:286, 2006. (2) ICTV Geminiviridae Study Group. New species and revised taxonomy proposal for the genus Begomovirus (Geminiviridae). ICTV. Retrieved from http://talk.ictvonline.org/files/proposals/taxonomy_proposals_plant1/ m/plant04/4720.aspx , 20 November 2013. (3) G. Lozano et al. J. Gen. Virol. 90:2550, 2009. (4) B. Muhire et al. Arch. Virol. 158:1411, 2013.

scholarly journals Molecular characterization of Cotton leaf curl Multan virus and DNA-satellites complex associated enation leaf curl and yellow vein mosaic disease of hollyhock

2021 ◽  
Author(s):  
K.V. Ashwathappa ◽  
V Venkataravanappa ◽  
M. Nandan ◽  
H.D. Vinaykumar ◽  
K. S. Shankarappa ◽  
...  
Keyword(s):  
Complex Disease ◽  
Pcr Amplification ◽  
Mosaic Disease ◽  
Ornamental Plant ◽  
Yellow Vein ◽  
Cotton Leaf ◽  
New Delhi ◽  
The Status ◽  
Full Length Genome ◽  
Leaf Curl

Abstract Hollyhock is one important decorative plant grown in garden beds in different region of the the world. The ornamental plant is susceptible to many diseases caused by diverse pathogens. Among these viral pathogens can cause enormous damage to the ornamental plant. The aim of the present study was identification of begomovirus and DNA sateelites is associated with the yellow vein mosaic and enation leaf curl disease complex of hollyhock. The hollyhock plants showing the typical begomovirus-like symptoms were collected from Pusa campus, New Delhi (India). To know the status of the begomovirus, the total DNA isolated from the infected hollyhock was subjected to PCR amplification using primers specific to the begomovirus. The partial (1.2 kb) genome sequencing of ten hollyhock samples indicates the associated of begomovirus (nucleotide identities is more 95% among themselves). Therefore three representative samples (H1, H2, H3) full-length genome (DNA-A, betasatellite and alphasatellite) was amplified through RCA method. The pairwise comparision of complete genome of the begomoviruses, betasatellites and alphasatellites using Sequence Demarcation Tool (SDT) showed highest nucleotide (nt) identity of 88.0 to 92.7% (DNA-A) with Cotton leaf curl Multan virus, 92.5–96.7% with Ludwigia leaf distortion betasatellite and 90.4 to 93. 2% % with Ageratum enation alphasatellite. Further recombinantion analysis showed that the begomoviruses and DNA satellites under study was recombinants of previously reported begomoviruses and DNA sattelites. This is the first report of Cotton leaf curl Multan virus and DNA satellites associated complex disease of hollyhock in India.

scholarly journals Association of a Begomovirus and Nanovirus-like Molecule with Ageratum Yellow Vein Disease in Pakistan

Plant Disease ◽  
2000 ◽  
Vol 84 (1) ◽  
pp. 101-101 ◽  
Author(s):  
S. Mansoor ◽  
S. H. Khan ◽  
M. Hussain ◽  
Y. Zafar ◽  
M. S. Pinner ◽  
...  
Keyword(s):  
Full Length ◽  
Yellow Vein ◽  
Cotton Leaf ◽  
Degenerate Primers ◽  
Total Dna ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Vein Disease ◽  
Full Length Clone ◽  
Leaf Curl

Whitefly-transmitted geminiviruses (begomoviruses) cause heavy losses to many food and fiber crops in Pakistan. Many weeds also show symptoms typical of begomoviruses. Ageratum (Ageratum conyzoides) is a common perennial weed in Pakistan, growing along irrigation canals, that often shows symptoms, such as yellow vein and mosaic, suggesting infection by a begomovirus. To confirm this, symptomatic and asymptomatic ageratum plants were collected from three locations in the Punjab Province of Pakistan, and total DNA was isolated, subjected to agarose gel electrophoresis, transferred to a nylon membrane, and Southern blotted. Total DNA isolated from cotton infected with Cotton leaf curl virus (CLCuV), tomato infected with Tomato leaf curl virus from Pakistan (TLCV-Pak), tobacco infected with African cassava mosaic virus (ACMV) from Nigeria, and healthy tobacco were included as controls. A full-length clone of CLCuV DNA A was labeled with [32P]dCTP by oligo-labeling and hybridized at medium stringency. The probe detected characteristic geminivirus DNA forms in symptomatic ageratum and plants infected with CLCuV, TLCV-Pak, and ACMV, while no signal was detected in asymptomatic ageratum from the field or healthy tobacco. To confirm infection by a begomovirus, degenerate primers WTGF (5′-GATTGTACGCGTCCDCCTTTAATTT GAAYBGG-3′), designed in the rep gene of begomoviruses, and WTGR (5′-TANACGCGTGGC TTCKRTACATGGCCTDT-3′), designed in the coat protein gene of DNA A of begomoviruses, were used in polymerase chain reaction (PCR). Degenerate primers (PBLv2040 and PCRc1) also were used in PCR (2). A product of expected size (≈1.4 kb) was obtained with DNA A primers from symptomatic ageratum, while no product was obtained with DNA B primers in the same sample. Previously we were unable to detect a DNA component equivalent to begomovirus DNA B in cotton showing symptoms of cotton leaf curl disease (1). We recently reported a novel circular DNA molecule that was approximately half as long as the full-length DNA A (CLCuV DNA-1) associated with CLCuV that share homology to plant nanoviruses (1). The supercoiled replicative form of viral DNA isolated from infected ageratum plants indicated the presence of smaller molecules, as was found in cotton leaf curl disease, suggesting that a nanovirus-like molecule might be associated with ageratum yellow vein disease. A duplicate blot of samples used in Southern hybridization with the DNA A probe was prepared, and a probe of the full-length clone of the nanovirus-like molecule (CLCuV DNA-1) was prepared as described for DNA A. The probe detected characteristic nanovirus DNA forms in ageratum with yellow vein symptoms and cotton infected with CLCuV, while no signal was detected in plants infected with TLCV-Pak or ACMV, healthy tobacco, or asymptomatic ageratum. Abutting primers PB2-F and PB2R (1), designed based on the CLCuV DNA-1 sequence, were unable to amplify a PCR product from ageratum with yellow vein symptoms, suggesting the nanovirus-like molecule associated with ageratum yellow vein disease is distinct from CLCuV DNA-1. Our results show that yellow vein disease of ageratum in Pakistan is associated with a begomovirus infection and single-stranded circular DNA molecule with similarity to CLCuV DNA-1. References: (1) S. Mansoor et al. Virology 259:190, 1999. (2) M. R. Rojas et al., Plant Dis. 77:340, 1993.

Sign in / Sign up

Export Citation Format

Share Document