Molecular Characterization of a Begomovirus and Betasatellite Causing Yellow Vein Net Disease of Ageratum houstonianum

Ageratum houstonianum was introduced in India as an annual ornamental plant and is grown in beds for blue head flowers. Yellow vein net disease was observed on A. houstonianum plants with about 9.0% disease incidence during a survey in February 2012 at gardens of NBRI, Lucknow, India. Association of a begomovirus and betasatellite with the disease was characterized based on sequence analyses of their cloned full length genome isolated from diseased A. houstonianum. Sequence analysis of the begomovirus showed presence of the six open reading frames in its genome, similar to the arrangement of Old World begomoviruses. The begomoviral genome shared 95 to 97% sequence identities with various strains of Ageratum enation virus (AEV); however, it showed distinct phylogenetic relationships with them, and hence was identified as a variant of AEV based on more than 94% sequence homology, the criteria defined by ICTV. The sequence analysis of associated betasatellite revealed highest 93% sequence identity and close phylogenetic relationships with Ageratum leaf curl betasatellite (ALCB) molecules; therefore, it was identified as an isolate of ALCB (based on 93% sequence homology). Agroinfiltration of partial dimers of the AEV variant and ALCB induced similar systemic yellow vein net and leaf curl symptoms on A. houstonianum when infiltrated in combination, fulfilling Koch’s postulates. Characterization of AEV and ALCB causing yellow vein net disease of A. houstonianum is being reported for the first time.

Download Full-text

First Report of Chilli leaf curl India virus Infecting Mentha spicata (Neera) in India

Plant Disease ◽

10.1094/pdis-07-13-0750-pdn ◽

2014 ◽

Vol 98 (1) ◽

pp. 164-164 ◽

Cited By ~ 15

Author(s):

S. T. Saeed ◽

A. Khan ◽

B. Kumar ◽

P. V. Ajayakumar ◽

A. Samad

Keyword(s):

Sequence Analysis ◽

Indian Subcontinent ◽

Disease Incidence ◽

Rolling Circle Amplification ◽

Full Length ◽

Yellow Vein ◽

Mechanical Transmission ◽

Mentha Spicata ◽

First Report ◽

Leaf Curl

Mint (Mentha spp.; family Lamiaceae) is an important essential oil-bearing crop cultivated on the Indian subcontinent as a cash crop for the international market and industrial purposes. Since May 2010, typical symptoms such as yellow vein, leaf yellowing, mosaic, crinkling, and cupping were observed, which led to significant yield loss in spearmint (M. spicata var. Neera) at CIMAP experimental fields and farmers' fields of Badaun, Rampur, and Moradabad regions of Uttar Pradesh province, India. Disease incidence was recorded in the range of 40 to 50%. Mentha spp. has been reported to be affected by many viral diseases (3). Due to the absence of fungal/bacterial infection, lack of mechanical transmission of the pathogen, and presence of whiteflies in the fields, the causal pathogen was suspected to be a begomovirus. Total genomic DNA was extracted from the leaves of naturally infected and healthy samples of Mentha by the CTAB protocol. Eighteen symptomatic samples were collected from different location of fields and screened for the presence of begomovirus. DNA from these samples was used as PCR template to amplify a 771-bp fragment using begomovirus coat protein (CP) gene specific primers. Eleven of 18 (61.1%) samples were found positive. PCR products were cloned into the pGEM-T Easy (Promega) and sequenced using the universal M13F/M13R primers showed sequence similarity with Chilli leaf curl India virus. To amplify the full-length DNA-A/B and a possible β-satellite, a second detection method was used: rolling circle amplification (RCA) using the TempliPhi 100 Amplification System (GE Healthcare). RCA products were digested independently with various restriction enzymes: BamHI, EcoRI, EcoRV, HincII, HindIII, SacI, and KpnI. Digested products were resolved on 1% agarose gel and the bands corresponding to ~2.7 and ~1.3 kb were purified using Nucleospin Gel and PCR Clean-up Kit and cloned into the respective sites of pGreen0029 vector. The sequence of full-length DNA-A (2,749 bp) and β-satellite component (1,347-bp) were obtained and deposited in NCBI GenBank with accession nos. KF312364 and KF364485, respectively. The sequence analysis showed maximum nucleotide identity (99%) with Chilli leaf curl India virus (FM877858) and distant affinities (≤88%) with other begomoviruses. The sequence analysis of isolated β-satellite showed 93% identity with Ageratum yellow vein virus satellite (AJ252072.1). No presence of DNA-B was detected using the universal primer PBL1v2040/PCRc1 (2), thus confirming it to be a monopartite begomovirus (1). Viruliferous whiteflies (Bemisia tabaci) proved Koch's postulation by inducing similar symptoms on healthy plants while aphids (Myzus persicae) failed to transmit the virus. To our knowledge, this is the first report of Chilli leaf curl India virus infecting M. spicata var. Neera in India. Mint is widely grown together with other reported hosts of begomoviruses, and thus could pose a serious threat as future expansion of begomovirus to new crops. Hence, the development of resistant varieties coupled with the implementation of adapted integrated pest management strategies would be essential for successful production of mint crops. References: (1) Y. Kumar et al. Plant Pathol. 60:1040, 2011. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) I. E. Tzanetakis et al. Plant Dis. 94:4, 2010.

Download Full-text

Sequence Analysis and Classification of Apparent Recombinant Begomoviruses Infecting Tomato in the Nile and Mediterranean Basins

Phytopathology ◽

10.1094/phyto-95-0549 ◽

2005 ◽

Vol 95 (5) ◽

pp. 549-555 ◽

Cited By ~ 48

Author(s):

C. M. Fauquet ◽

S. Sawyer ◽

A. M. Idris ◽

J. K. Brown

Keyword(s):

Sequence Analysis ◽

Phylogenetic Relationships ◽

Tomato Yellow Leaf ◽

Viral Diseases ◽

Yellow Leaf ◽

Recombination Hotspots ◽

Molecular Biodiversity ◽

Leaf Curl Virus ◽

Leaf Curl

Numerous whitefly-transmitted viral diseases of tomato have emerged in countries around the Nile and Mediterranean Basins the last 20 years. These diseases are caused by monopartite geminiviruses (family Gemini viridae) belonging to the genus Begomovirus that probably resulted from numerous recombination events. The molecular biodiversity of these viruses was investigated to better appreciate the role and importance of recombination and to better clarify the phylogenetic relationships and classification of these viruses. The analysis partitioned the tomato-infecting begomoviruses from this region into two major clades, Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus. Phylogenetic and pairwise analyses together with an evaluation for gene conversion were performed from which taxonomic classification and virus biodiversity conclusions were drawn. Six recombination hotspots and three homogeneous zones within the genome were identified among the tomatoinfecting isolates and species examined here, suggesting that the recombination events identified were not random occurrences.

Download Full-text

Genome organization and molecular characterization of the three Formica exsecta viruses—FeV1, FeV2 and FeV4

PeerJ ◽

10.7717/peerj.6216 ◽

2019 ◽

Vol 6 ◽

pp. e6216 ◽

Cited By ~ 3

Author(s):

Kishor Dhaygude ◽

Helena Johansson ◽

Jonna Kulmuni ◽

Liselotte Sundström

Keyword(s):

Molecular Characterization ◽

Genome Organization ◽

Rna Virus ◽

Open Reading Frames ◽

Link Type ◽

Infection Pathways ◽

Comparative Genomics Analysis ◽

First Time ◽

Negative Sense

We present the genome organization and molecular characterization of the three Formica exsecta viruses, along with ORF predictions, and functional annotation of genes. The Formica exsecta virus-4 (FeV4; GenBank ID: MF287670) is a newly discovered negative-sense single-stranded RNA virus representing the first identified member of order Mononegavirales in ants, whereas the Formica exsecta virus-1 (FeV1; GenBank ID: KF500001), and the Formica exsecta virus-2 (FeV2; GenBank ID: KF500002) are positive single-stranded RNA viruses initially identified (but not characterized) in our earlier study. The new virus FeV4 was found by re-analyzing data from a study published earlier. The Formica exsecta virus-4 genome is 9,866 bp in size, with an overall G + C content of 44.92%, and containing five predicted open reading frames (ORFs). Our bioinformatics analysis indicates that gaps are absent and the ORFs are complete, which based on our comparative genomics analysis suggests that the genomes are complete. Following the characterization, we validate virus infection for FeV1, FeV2 and FeV4 for the first time in field-collected worker ants. Some colonies were infected by multiple viruses, and the viruses were observed to infect all castes, and multiple life stages of workers and queens. Finally, highly similar viruses were expressed in adult workers and queens of six other Formica species: F. fusca, F. pressilabris, F. pratensis, F. aquilonia, F. truncorum and F. cinerea. This research indicates that viruses can be shared between ant species, but further studies on viral transmission are needed to understand viral infection pathways.

Download Full-text

MOLECULAR IDENTIFICATION OF Pepper yellow leaf curl Indonesia virus ON CHILI PEPPER IN NUSA PENIDA ISLAND

JURNAL HAMA DAN PENYAKIT TUMBUHAN TROPIKA ◽

10.23960/jhptt.22197-102 ◽

2021 ◽

Vol 21 (2) ◽

pp. 97-102

Author(s):

Dewa Gede Wiryangga Selangga ◽

Listihani Listihani

Keyword(s):

Sequence Analysis ◽

Molecular Identification ◽

Disease Incidence ◽

Analysis Data ◽

Chili Pepper ◽

Yellow Leaf ◽

Degenerate Primers ◽

Disease Symptoms ◽

Leaf Curl Disease ◽

Leaf Curl

Molecular identification of Pepper yellow leaf curl Indonesia virus on chili pepper in Nusa Penida Island. Pepper yellow leaf curl Indonesia virus (PYLCV) has been reported as caused yellow leaf curl disease in Bali Island since early 2012. Dominant symptoms of PYLCV infection in chili pepper were yellowing, leaf curl, yellow mosaic, and mottle. Bemisia tabaci, has been known to vector on the case yellow leaf curl disease. Observations on the Nusa Penida Island in 2020 showed symptoms such as yellow leaf curl disease, however, identification of PYLCV in Nusa Penida Island has not been studied. Molecular identification was conducted using polymerase chain reaction and sequence analysis. Data collected in this study was disease symptoms and disease incidence. The results showed that dominant disease symptoms caused by virus from Nusa Penida were yellow mosaic, yellowing, and mottle. Universal DNA fragments of 912 bp were successfully amplified from 50 leaf samples using Begomovirus degenerate primers SPG 1 (5’-CCCCKGTGCGWRAATCCAT-3’) and SPG 2 (5’ATCCVAA YWTYCAGGGAGCT-3’). Sequence analysis showed that the isolate from Nusa Penida was a Pepper yellow leaf curl Indonesia virus with a 98–100% homology with several reference isolates.

Download Full-text

Tomato leaf curl Gujarat virus, a New Begomovirus Species Causing a Severe Leaf Curl Disease of Tomato in Varanasi, India

Phytopathology ◽

10.1094/phyto.2003.93.12.1485 ◽

2003 ◽

Vol 93 (12) ◽

pp. 1485-1495 ◽

Cited By ~ 63

Author(s):

S. Chakraborty ◽

P. K. Pandey ◽

M. K. Banerjee ◽

G. Kalloo ◽

C. M. Fauquet

Keyword(s):

Tomato Leaf ◽

Open Reading Frames ◽

New Delhi ◽

Tomato Plants ◽

The Family ◽

Infected Tomato ◽

Tomato Leaf Curl ◽

Full Length Genome ◽

Severe Leaf ◽

Leaf Curl

The biological and molecular properties of Tomato leaf curl Gujarat virus from Varanasi, India (ToLCGV-[Var]) were characterized. ToLCGV-[Var] could be transmitted by grafting and through whitefly transmission in a persistent manner. The full-length genome of DNA-A and DNA-B of ToLCGV-[Var] was cloned in pUC18. Sequence analysis revealed that DNA-A (AY190290) is 2,757 bp and DNA-B (AY190291) is 2,688 bp in length. ToLCGV-[Var] could infect and cause symptoms in tomato, pepper, Nicotiana benthamiana, and N. tabacum when partial tandem dimeric constructs of DNA-A and DNA-B were co-inoculated by particle bombardment. DNA-A alone also is infectious, but symptoms were milder and took longer to develop. ToLCGV-Var virus can be transmitted through sap inoculation from infected tomato plants to the above-mentioned hosts causing the same symptoms. Open reading frames (ORFs) in both DNA-A and DNA-B are organized similarly to those in other begomoviruses. DNA-A and DNA-B share a common region of 155 bp with only 60% sequence identity. DNA-B of ToLCGV-[Var] shares overall 80% identity with DNA-B of Tomato leaf curl New Delhi virus-Severe (ToLCNDV-Svr) and 75% with ToLCNDV-[Lucknow] (ToLCNDV-[Luc]). Comparison of DNA-A sequence with different begomoviruses indicates that ToLCGV-[Var] shares 84% identity with Tomato leaf curl Karnataka virus (ToLCKV) and 66% with ToLCNDV-Svr. ToLCGV-[Var] shares a maximum of 98% identity with another isolate of the same region (ToLCGV-[Mir]; AF449999) and 97% identity with one isolate from Gujarat (ToLCGV-[Vad]; AF413671). All three viruses belong to the same species that is distinct from all the other geminivirus species described so far in the genus Begomovirus of the family Geminiviridae. The name Tomato leaf curl Gujarat virus is proposed because the first sequence was taken from an isolate of Gujarat, India.

Download Full-text

Molecular and Evolutionary Characterization of the cp32/18 Family of Supercoiled Plasmids in Borrelia burgdorferi297

Infection and Immunity ◽

10.1128/iai.68.3.1574-1586.2000 ◽

2000 ◽

Vol 68 (3) ◽

pp. 1574-1586 ◽

Cited By ~ 39

Author(s):

Melissa J. Caimano ◽

Xiaofeng Yang ◽

Taissia G. Popova ◽

Michael L. Clawson ◽

Darrin R. Akins ◽

...

Keyword(s):

Sequence Analysis ◽

Genomic Sequence ◽

Complete Sequence ◽

Open Reading Frames ◽

Exogenous Dna ◽

Variable Regions ◽

Different Types ◽

Sequence Relatedness ◽

Reading Frames

ABSTRACT In this study, we characterized seven members of the cp32/18 family of supercoiled plasmids in Borrelia burgdorferi297. Complete sequence analysis of a 21-kb plasmid (cp18-2) confirmed that the strain 297 plasmids are similar in overall content and organization to their B31 counterparts. Of the 31 open reading frames (ORFs) in cp18-2, only three showed sequence relatedness to proteins with known functions, and only one, a ParA/SopA ortholog, was related to nonborrelial polypeptides. Besides the lipoproteins, none of the ORFs appeared likely to encode a surface-exposed protein. Comparison with the B31 genomic sequence indicated that paralogs for most of the ORFs in cp18-2 can be identified on other genetic elements. cp18-2 was found to lack a 9- to 10-kb fragment present in the 32-kb homologs which, by extrapolation from the B31 cp32 sequences, contains at least 15 genes presumed to be unnecessary for plasmid maintenance. Sequence analysis of the lipoprotein-encoding variable loci provided evidence that recombinatorial processes within these regions may result in the acquisition of exogenous DNA. Pairwise analysis with random shuffling revealed that the multiple lipoproteins (Mlp; formerly designated 2.9 LPs) fall into two distinct homology groups which appear to have arisen by gene fusion events similar to those recently proposed to have generated the three OspE, OspF, and Elp lipoprotein families (D. R. Akins, M. J. Caimano, X. Yang, F. Cerna, M. V. Norgard, and J. D. Radolf, Infect. Immun. 67:1526–1532, 1999). Comparative analysis of the variable regions also indicated that recombination within the loci of each plasmid may occur independently. Last, comparison of variable loci revealed that the cp32/18 plasmid complements of the B31 and 297 isolates differ substantially, indicating that the two strains have been subject to divergent adaptive pressures. In addition to providing evidence for two different types of recombinatorial events involving cp32/18 plasmids, these findings underscore the need for genetic analysis of diverse borrelial isolates in order to elucidate the Lyme disease spirochete's complex parasitic strategies.

Download Full-text

Occurrence and Molecular Characterization of Squash leaf curl Phillipines virus in Taiwan

Plant Disease ◽

10.1094/pdis-91-7-0907a ◽

2007 ◽

Vol 91 (7) ◽

pp. 907-907 ◽

Cited By ~ 9

Author(s):

W. S. Tsai ◽

S. L. Shih ◽

S. K. Green ◽

F.-J. Jan

Keyword(s):

Satellite Dna ◽

The Philippines ◽

Positive Sample ◽

Open Reading Frames ◽

Sequence Comparisons ◽

Viral Dnas ◽

Two Samples ◽

Blastn Analysis ◽

Leaf Curl

Whitefly-transmitted, cucurbit-infecting begomoviruses (genus Begomovirus, family Geminiviridae) have been detected on cucurbit crops in Bangladesh, China, Egypt, Israel, Malaysia, Mexico, the Philippines, Thailand, United States, and Vietnam. Pumpkin plants showing leaf curling, blistering, and yellowing symptoms were observed in the AVRDC fields (Tainan, Taiwan) during 2001 and in nearby farmers' fields during 2005. Two samples from symptomatic plants were collected in 2001 and six collected in 2005. Viral DNAs were extracted (2), and the PCR, with previously described primers, was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in one of the 2001 samples and in all 2005 samples. The PCR-amplified 1.5 kb viral DNA-A from one positive sample each from the 2001 and 2005 collections was cloned and sequenced. On the basis of the 1.5-kb DNA-A sequences, specific primers were designed to completely sequence the DNA-A component. The overlap between fragments obtained using primer walking ranged from 43 to 119 bp with 100% nt identities. The complete DNA-A sequences were determined for the two isolates as 2,734 bp (2001) (GenBank Accession No. DQ866135) and 2,733 bp (2005) (GenBank Accession No. EF199774). Sequence comparisons and analyses were performed using the DNAMAN Sequence Analysis Software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of the begomovirus isolates each contained the conserved nanosequence-TAATATTAC and six open reading frames, including two in the virus sense and four in the complementary sense. On the basis of a 99% shared nucleotide sequence identity, they are considered isolates of the same species. BLASTn analysis and a comparison of the sequence with others available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the Taiwan virus shared its highest nt identity (more than 95%) with the Squash leaf curl Philippines virus (GenBank Accession No. AB085793). Virus-associated satellite DNA was not found in any of the samples. DNA-B was found in both samples, providing further evidence that the virus was the same as the bipartite Squash leaf curl Philippines virus. To our knowledge, this is the first report of Squash leaf curl Philippines virus in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Download Full-text

New Record of Catharanthus yellow mosaic virus and a Betasatellite Associated with Lethal Leaf Yellowing of Kalmegh (Andrographis paniculata) in Northern India

Plant Disease ◽

10.1094/pdis-08-14-0862-pdn ◽

2015 ◽

Vol 99 (2) ◽

pp. 292-292 ◽

Cited By ~ 7

Author(s):

A. Khan ◽

S. T. Saeed ◽

A. Samad

Keyword(s):

Sequence Analysis ◽

Mosaic Virus ◽

Rolling Circle Amplification ◽

Andrographis Paniculata ◽

Yellow Vein ◽

Yellow Mosaic Virus ◽

Mechanical Transmission ◽

Specific Primers ◽

Leaf Yellowing ◽

Leaf Curl

Andrographis paniculata (Family Acanthaceae), also called Kalmegh, is a medicinal herb in India well-known for its various pharmaceutical properties (1). In August 2012, during a survey in the northern parts of India, several Kalmegh plants in Barabanki District of Uttar Pradesh Province showed typical virus-like symptoms along with prominent lethal leaf yellowing. The infected plants initially showed some chlorotic streaks, which later turned completely yellow, ultimately leading to premature death. Mechanical/sap inoculation failed to transmit the pathogen. Based on the symptomology, a heavy infestation of whiteflies (Bemisia tabaci) in the infected fields, and lack of mechanical transmission, the association of a begomovirus was suspected. The disease incidence was calculated to be about 15 to 20% on the basis of plant population. Twenty samples from naturally infected plants of A. paniculata were collected from various field locations. Total genomic DNA from the symptomatic and non-symptomatic samples was isolated by the modified CTAB method (4). The initial PCR-based detection was performed using begomovirus coat protein gene specific primers (forward 5′-ATGGCGAAGCGACCAG-3′ and reverse 5′-TTAATTTGTGACCGAATCAT-3′), which generated an amplicon of 771 bp in most of the (17/20) symptomatic samples. No amplification was obtained in healthy or non-symptomatic plant samples. The full-length genome was amplified via rolling-circle amplification (RCA) according to the manufacturer's instructions using random hexamer primers and φ29 DNA polymerase. A portion of the RCA product (1 μl) was subjected to digestion with different restriction enzymes, out of which BamHI yielded DNA fragments of approximately 2.7 and 1.3 kb, corresponding to DNA-A and β satellite molecules, respectively. These fragments were eluted from the gel and cloned into the suitable restriction site of pGreen0029 vector. The positive clones were checked by restriction digestion. Twelve out of 20 clones were found to be positive and sequenced. The complete genome sequences of DNA A (2,754 bp) and β (1,366 bp) satellites were deposited in the GenBank database with the accession numbers KM359406 and KM359407, respectively. The absence of DNA-B molecule was ascertained, as no PCR amplification was detected with DNA-B-specific primers. Sequence analysis showed highest nucleotide identity (90%) with Catharanthus yellow mosaic virus (CYMV) (HE580234) and ≤85% identity with other begomoviruses of the database. Sequence analysis of the associated betasatellite showed 96% identity with Andrographis yellow vein leaf curl betasatellite (KC967282). CYMV was first reported on Catharanthus roseus with no associated betasatellite from Pakistan (2). However, this is the first report of CYMV along with a betasatellite infecting A. paniculata in India. Recently a begomovirus (Eclipta yellow vein virus) infection was reported on A. paniculata in association with Andrographis yellow vein leaf curl betasatellite from India for the first time (3); now the crop has also become a host of CYMV. Thus, this study highlights the spread of CYMV from its preliminary host to a new host plant (A. paniculata), across the South Asian countries. Therefore, it is important to take measures for the management of its transmitting vector so as to curtail the spread of the virus to new economically and commercially important crops. References: (1) S. Akbar. Altern. Med. Rev. 16:1, 2011. (2) M. Ilyas et al. Arch. Virol. 158:505, 2013. (3) A. Khan and A. Samad. Plant Dis. 98:698, 2014. (4) S. P. S. Khanuja et al. Plant Mol. Biol. Rep. 17:1, 1999.

Download Full-text

First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum (Blechum pyramidatum)

Plant Disease ◽

10.1094/pdis-10-13-1025-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 701-701 ◽

Cited By ~ 2

Author(s):

W. S. Tsai ◽

S. L. Shih ◽

L. M. Lee ◽

L. M. Dolores ◽

L. Kenyon

Keyword(s):

Dna Sequences ◽

Disease Incidence ◽

The Philippines ◽

Open Reading Frames ◽

Yellow Vein ◽

Nucleotide Identity ◽

Plant Sample ◽

First Report ◽

Conserved Sequence ◽

Vein Disease

Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)—two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)—and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

Download Full-text

Sequence Analysis and Molecular Characterization of the Lactococcus lactis Temperate Bacteriophage BK5-T

Applied and Environmental Microbiology ◽

10.1128/aem.67.8.3564-3576.2001 ◽

2001 ◽

Vol 67 (8) ◽

pp. 3564-3576 ◽

Cited By ~ 28

Author(s):

Chitladda Mahanivong ◽

John D. Boyce ◽

Barrie E. Davidson ◽

Alan J. Hillier

Keyword(s):

Sequence Analysis ◽

Nucleotide Sequence ◽

Lactococcus Lactis ◽

Direct Repeat ◽

Open Reading Frames ◽

Temperate Bacteriophage ◽

Terminal Sequence ◽

Repeat Sequences ◽

Reading Frames

ABSTRACT The Lactococcus lactis temperate bacteriophage BK5-T is one of twelve type phages that define L. lactis phage species. This paper describes the nucleotide sequence and analysis of a 21-kbp region of the BK5-T genome and completes the nucleotide sequence of the genome of this phage. The 40,003-nucleotide linear genome encodes 63 open reading frames. Sequence runoff experiments showed that the cohesive ends of the BK5-T genome contained a 12-bp 3′ single-stranded overhang with the sequence 5′-CACACACATAGG-3′. Two major BK5-T structural proteins, of approximately 30 and 20 kDa, were identified, and N-terminal sequence analysis determined that they were encoded by orf7 and orf12, respectively. A 169-bp fragment containing a 37-bp direct repeat and several smaller repeat sequences conferred resistance to BK5-T infection when introduced in trans to the host cell and is likely a part of the BK5-T origin of replication (ori).

Download Full-text