scholarly journals First Report of a Leaf Spot Disease of Tobacco Caused by Pseudomonas cichorii in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Dayu Lan ◽  
Fangling Shu ◽  
Yanhui Lu ◽  
Anfa Shou ◽  
Wei Lin ◽  
...  
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Leaf Spot Disease ◽  
Pathogenicity Test ◽  
Pseudomonas Cichorii ◽  
Koch’S Postulates ◽  
First Report ◽  
Initial Symptoms ◽  
Wide Range ◽  
Koch's Postulates

Tobacco (Nicotiana tabacum L.), one of the chief commercial crops, is wildly cultivated worldwide. In June 2020 and 2021, an unknown bacterial leaf spot on tobacco was found in Hezhou and Hechi City, Guangxi, China. 30% of the tobacco were affected and the rate of diseased leaves reached about 10% in the field under high temperature and rainstorm. The disease mainly damaged the middle and top leaves of tobacco plants at vigorous growing stage. The initial symptoms were water-soaked spots on the frontal half of a leaf, and then expanded into circular to irregular spots with a yellow halo at the edge. The spots mostly appeared dark brown at high air humidity, while yellow brown at low humidity and exhibited a concentric pattern. In severe cases, the lesions coalesced and the whole leaf was densely covered with lesions, resulting in the loss of baking value. A bacterium was consistently isolated from diseased leaf tissues on nutrient agar (NA). Growth on NA was predominantly grayish white circular bacterial colonies with smooth margins, and the bacterium is rod-shaped, gram-negative and fluorescent on King’s B medium. Seven isolates (ND04A-ND04C and ZSXF02-ZSXF05) were selected for molecular identification and pathogenicity tests. Genomic DNA of the bacterium was extracted and the housekeeping gene of cts (encoding citrate synthase) was amplified with the primers cts-Fs/cts-Rs (forward primer cts-Fs: 5’-CCCGTCGAGCTGCCAATWCTGA-3’; reverse primer cts-Rs: 5’-ATCTCGCACGGSGTRTTGAACATC-3’) (Berge et al. 2014; Sarkar et al. 2004). 409-bp cts gene sequences were deposited in the GenBank database for seven isolates (accession no. OK105110-OK105116). Sequence of seven isolates shared 100% identity with several Pseudomonas cichorii strains within the GenBank database (accession no. KY940268 and KY940271), and the phylogenetic tree of cts genes of the seven isolates clustered with the phylogroup 11 of Pseudomonas syringae (accession no. KJ877799 and KJ878111), which was classified as P.cichorii. To satisfy Koch’s postulates, a pathogenicity test was tested by using a needle to dip a suspension of the bacterium (108 CFU/ml) and pricking three holes in the tobacco leaf. The control plants leaves were needled with sterile water. Each tobacco plant was inoculated with three leaves, and the test was repeated three times. All plants were placed in transparent plastic boxes and incubated in a greenhouse at 25 ± 3°C. The water-soaked spots appeared 24h after inoculation and quickly expanded through leaf veins. Three days after inoculation, all the inoculated leaves showed symptoms similar to those observed in the field. Control plants remained healthy. Only P. cichorii was successfully re-isolated from the lesions, confirming Koch’s postulates. Pseudomonas cichorii can infect eggplant, lettuce, tomatoand other crops, and has a wide range of hosts (Timilsina et al. 2017; Ullah et al. 2015). To our knowledge, this is the first report of P. cichorii causing leaf spot on tobacco in China.

scholarly journals First Report of Pseudomonas syringae pv. coriandricola Causing Bacterial Leaf Spot on Carrot, Parsley, and Parsnip in Serbia

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 416-416 ◽  
Author(s):  
T. Popović ◽  
Ž. Ivanović ◽  
M. Ignjatov ◽  
D. Milošević
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Bacterial Suspension ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Bacterial Leaf Spot ◽  
Koch’S Postulates ◽  
First Report ◽  
Vegetable Farm ◽  
Koch's Postulates

During the spring of 2014, a severe leaf spot disease was observed on carrot (Daucus carota), parsley (Petroselinum crispum), and parsnip (Pastinaca sativa) on a 0.5-ha vegetable farm in Vojvodina Province, Serbia. The disease appeared under wet and cool conditions with 5 to 25% of plants infected for each of the three crops. Symptoms were characterized as brown angular leaf spots, ~2 mm in diameter, often limited by veins. Collected symptomatic leaves were rinsed and dried at room temperature, and leaf sections taken from the margin of necrotic tissue were macerated in sterile phosphate buffer and streaked onto nutrient agar with 5% (w/v) sucrose (NAS). After isolation, whitish, circular, dome-shaped, Levan-positive colonies consistently formed. Five strains from each host (carrot, parsley, and parsnip) were used for further study. Strains were gram-negative, aerobic, and positive for catalase and tobacco hypersensitive reaction but negative for oxidase, rot of potato slices, and arginine dihydrolase. These reactions corresponded to LOPAT group Ia, which includes Pseudomonas syringae pathovars (3). Repetitive extragenic palindromic sequence (Rep)-PCR fingerprint profiles using the REP, ERIC, and BOX primers (4) were identical for all strains. Sequence typing of the housekeeping genes gyrB and rpoD (1) was performed for three representative strains (one from each host). Sequences were deposited in the NCBI GenBank database as accessions KM979434 to KM979436 (strains from carrot, parsnip, and parsley, respectively) for the gyrB gene and KM979437 to KM979439 (strains from parsnip, parsley and carrot, respectively) for the rpoD gene. Sequences were compared with pathotype strain Pseudomonas syringae pv. coriandricola ICMP12471 deposited in the Plant Associated and Environmental Microbes Database ( http://genome.ppws.vt.edu/cgi-bin/MLST/home.pl ). BLAST analysis revealed 100% homology for gyrB and 99% homology for rpoD. Pathogenicity was tested with five representative strains from each host on four-week-old plants of carrot (cv. Nantes), parsley (cv. NS Molski), and parsnip (cv. Dugi beli glatki) using two methods: spraying the bacterial suspension (108 CFU ml−1) on the leaves until runoff (5) and injecting the bacterial suspension into leaves with a hypodermic syringe (2). Four plants were used per strain and method. Sterile distilled water was applied as a negative control treatment for each plant species. All plants were kept in a mist room with 100% humidity for 4 h, then transferred to a greenhouse at 25°C and 80% relative humidity and examined for symptom development over a period of three weeks. For all strains, inoculated leaves first developed water-soaked lesions on the leaves 5 to 7 days after inoculation (DAI); 14 DAI lesions became dark brown, often surrounded by haloes. No symptoms were observed on control plants inoculated with sterile distilled water. For fulfillment of Koch's postulates, re-isolations were done onto NAS. Re-isolated bacteria were obtained from each inoculated host and confirmed to be identical to the original isolates using the LOPAT tests and Rep-PCR fingerprinting profiles. Based on the pathogenicity test accompanied by completion of Koch's postulates, sequence analysis, and bacteriological tests, the strains were identified as P. s. pv. coriandricola. To our knowledge, this is the first report of bacterial leaf spot of carrot, parsley, and parsnip in Serbia. It may present a threat to production due to quality requirements for fresh market. References: (1) P. Ferrente and M. Scortichini. Plant Pathol. 59:954, 2010. (2) M. Gupta et al. Plant Dis. 97:418, 2013. (3) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966. (4) F. J. Louws et al. Appl. Environ. Microb. 60:2286, 1994. (5) X. Xu and S. A. Miller. Plant Dis. 97:988, 2013.

scholarly journals First Report of Leaf Spot Caused by Didymella americana on Cassia nomame in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Weiming Sun ◽  
Lina Feng ◽  
Xiaolei Wen ◽  
Bojia Han ◽  
Danrun Xing ◽  
...  
Keyword(s):  
Sequence Analysis ◽  
Leaf Spot ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
Rrna Gene ◽  
Pathogenicity Test ◽  
Koch’S Postulates ◽  
First Report ◽  
Initial Symptoms ◽  
Koch's Postulates

Cassia nomame (Sieb.) Kitagawa is an annual plant in the Leguminousae family. The aerial parts of C. nomame have been used as tonic and diuretic in Korea and Japan (Syed et al. 2019). A leaf spot was observed on the leaves of a 1-year-old C. nomame landrace in Changli County (39.42°N, 119.10°E), Qinhuangdao City, Hebei Province during August to October in 2018. In many fields (n≥3), the disease incidence over 80% in the middle and late stage of plant growth. Symptoms on leaves in one field began with many small, dark necrotic spot lesions. Later, the lesions spread to round-to-oval, slightly sunken in the center, and large necrotic patches with indefinite margins. Finally, lesions coalesced and resulted in defoliation. Lesions were occasionally observed on the pods. Symptoms on the pods were initially small, dark spots and then expanded to large necrotic patches with irregular edges. Symptomatic tissues (n=32) from pods and leaves were cut into 3 to 8 mm2 squares, surface disinfested with 75% ethanol for 10 s, rinsed with sterile distilled water, then placed on potato dextrose agar (PDA) at 28℃. After 3 days, ten isolates with consistent characteristics were obtained with a frequency 52.6%. The isolates on PDA were round, initially pale and had little aerial mycelium, gradually turned olive green and had dense wool-like dense aerial mycelia after 3 days. Conidia were hyaline, smooth, solitary, and elliptical. The conidia measured 5.4 to 8.2 μm × 2.5 to 3.8 μm (n=50), and has two oil bodies positioning at opposite poles. Pigmented chlamydospores were spherical or nearly pear-shaped, and solitary. Black fructifications (pycnidia) were produced profusely on PDA after subculture for 3 days. All the isolates were similar to Didymella sp. in morphology (Aveskamp et al. 2009). Choice three isolates YSGUO8 YSGGUO8-a and YSGGUO8-b to be further characterized by sequencing of the internal transcribed spacer (ITS), actin gene, and 28S large subunit of the nuclear rRNA gene (LSU) (Zhang et al. 2017). The sequences of three strains (MK836417 MZ484072 and MZ484073 for ITS, MK837604 MZ593675 and MZ593676 for actin, MK843781 MZ836208 and MZ836207 for LSU, respectively) showed 99% to 100% similarity with Didymella americana K-004 (KY070279 for ITS,KY070285 for LSU), Phoma americana CBS 256.65 (FJ426973 for ITS, FJ426871 for actin, MH870196 for LSU) and P. americana CBS 185.85 (FJ426972 for ITS, FJ426870 for actin, GU237990 for LSU) in GenBank. The fungi were identified as D. americana (formerly P. americana or Peyronellaea americana) on the basis of morphological characteristics and sequence analysis. A pathogenicity test was conducted with three times on 1-year-old C. nomame strain at the 4 to 6 compound leaf stage. Conidia were obtained from 7-day-old PDA cultures grown at 28℃ with a 12-h photoperiod. Koch’s postulates were fulfilled by spray inoculating ten healthy young plants with 106 conidia per milliliter of D. americana strain YSGUO8, and sterile water as the control. After inoculation, the plants were managed at 28℃, 60% relative humidity and a 12-h photoperiod. After 5 to 8 days, the inoculated leaves developed small and dark spots lesions similar to those observed on the leaves with initial symptoms in the field. The control leaves remained symptomless. The same fungi were re-isolated from infected leaves by morphology observation and sequence analysis, confirming Koch's postulates. D. americana has caused leaves spot on Table Beet in New York (Vaghefi et al. 2016). To our knowledge, this is the first report of D. americana causing leaf spot of C. nomame in China.

scholarly journals First Report of Leaf Spot Disease on Walnut Caused by Colletotrichum fioriniae in China

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 289-289 ◽  
Author(s):  
Y. Z. Zhu ◽  
W. J. Liao ◽  
D. X. Zou ◽  
Y. J. Wu ◽  
Y. Zhou
Keyword(s):  
Dna Sequences ◽  
Leaf Spot ◽  
Juglans Regia ◽  
Morphological Characteristics ◽  
Leaf Spot Disease ◽  
Koch’S Postulates ◽  
First Report ◽  
Spot Disease ◽  
Leaf Spots ◽  
Koch's Postulates

In May 2014, a severe leaf spot disease was observed on walnut tree (Juglans regia L.) in Hechi, Guangxi, China. Leaf spots were circular to semicircular in shape, water-soaked, later becoming grayish white in the center with a dark brown margin and bordered by a tan halo. Necrotic lesions were approximately 3 to 4 mm in diameter. Diseased leaves were collected from 10 trees in each of five commercial orchards. The diseased leaves were cut into 5 × 5 mm slices, dipped in 75% ethanol for 30 s, washed three times in sterilized water, sterilized with 0.1% (w/v) HgCl2 for 3 min, and then rinsed five times with sterile distilled water. These slices were placed on potato dextrose agar (PDA), followed by incubating at 28°C for about 3 to 4 days. Fungal isolates were obtained from these diseased tissues, transferred onto PDA plates, and incubated at 28°C. These isolates produced gray aerial mycelium and then became pinkish gray with age. Moreover, the reverse of the colony was pink. The growth rate was 8.21 to 8.41 mm per day (average = 8.29 ± 0.11, n = 3) at 28°C. The colonies produced pale orange conidial masses and were fusiform with acute ends, hyaline, sometimes guttulate, 4.02 to 5.25 × 13.71 to 15.72 μm (average = 4.56 ± 0.31 × 14.87 ± 1.14 μm, n = 25). The morphological characteristics and measurements of this fungal isolate matched the previous descriptions of Colletotrichum fioriniae (Marcelino & Gouli) R.G. Shivas & Y.P. Tan (2). Meanwhile, these characterizations were further confirmed by analysis of the partial sequence of five genes: the internal transcribed spacer (ITS) of the ribosomal DNA, beta-tubulin (β-tub) gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene, chitin synthase 3(CHS-1) gene, and actin (ACT) gene, with universal primers ITS4/ITS5, T1/βt2b, GDF1/GDR1, CHS1-79F/CHS1-354R, and ACT-512F/ACT-783R, respectively (1). BLAST of these DNA sequences using the nucleotide database of GenBank showed a high identify (ITS, 99%; β-tub, 99%; GAPDH, 99%; CHS-1, 99%; and ACT, 100%) with the previously deposited sequences of C. fioriniae (ITS, KF278459.1, NR111747.1; β-tub, AB744079.1, AB690809.1; GAPDH, KF944355.1, KF944354.1; CHS-1, JQ948987.1, JQ949005.1; and ACT, JQ949625.1, JQ949626.1). Koch's postulates were fulfilled by inoculating six healthy 1-year-old walnut trees in July 2014 with maximum and minimum temperatures of 33 and 26°C. The 6-mm mycelial plug, which was cut from the margin of a 5-day-old colony of the fungus on PDA, was placed onto each pin-wounded leaf, ensuring good contact between the mycelium and the wound. Non-colonized PDA plugs were placed onto pin-wounds as negative controls. Following inoculation, both inoculated and control plants were covered with plastic bags. Leaf spots, similar to those on naturally infected plants, were observed on the leaves inoculated with C. fioriniae within 5 days. No symptoms were observed on the negative control leaves. Finally, C. fioriniae was re-isolated from symptomatic leaves; in contrast, no fungus was isolated from the control, which confirmed Koch's postulates. To our knowledge, this is the first report of leaf disease on walnut caused by C. fioriniae. References: (1) L. Cai et al. Fungal Divers. 39:183, 2009. (2) R. G. Shivas and Y. P. Tan. Fungal Divers. 39:111, 2009.

scholarly journals First Report of Ramularia Leaf Spot Caused by Ramularia collo-cygni on Leaves and Seeds of Barley in Estonia

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 997-997 ◽  
Author(s):  
P. Sooväli ◽  
M. Tikhonova ◽  
P. Matušinsky
Keyword(s):  
Leaf Spot ◽  
Growth Stage ◽  
Positive Control ◽  
Pathogenicity Test ◽  
Koch’S Postulates ◽  
Ramularia Leaf Spot ◽  
Initial Symptoms ◽  
Two Samples ◽  
Agricultural Regions ◽  
Koch's Postulates

Ramularia leaf spot (RLS) is a disease of barley (Hordeum vulgare) caused by the fungus Ramularia collo-cygni Sutton & Waller (Rcc). Rcc causes necrotic lesions, premature senescence of leaves, and yield reduction. Under Estonian conditions, there are usually no leaf spots on the upper leaves of barley prior to flowering. In 2009, 2010, and 2012, symptoms similar to those of RLS were observed on leaves of spring and winter barley in several Estonian agricultural regions. Approximately 30% of the plants in affected fields were symptomatic. Symptoms were not observed in 2011, which was a dry and hot year. Initial symptoms were small brown spots, beginning on the upper leaves (flag leaf, F-1 leaf) at the flowering growth stage (4). Later, the spots spread to the sheaths, stems, and awns and became necrotic. The lateral margins of the spots were delimited by the leaf veins and spots are surrounded by a chlorotic halo. During summer 2012, two samples of 15 F-1 leaves were collected from spring barley cv. Maali and line SJ111609 from the Estonian Crop Research Institute in eastern Estonia in late July at growth stage 71 (4). In addition, six grain samples, containing 200 seeds each of the cv. Maali, were collected from different agricultural regions in Estonia, along with one grain sample of SJ111609 from Jõgeva. All samples were collected from untreated plots and leaves were observed under a dissecting microscope, revealing white clusters of conidiophores in rows on the undersides of the leaves. Conidia and conidiophores were scraped aseptically from the leaf surface using a sterile needle under a dissecting microscope and transferred to potato dextrose agar (PDA) containing ampicillin sodium salt (50 mg l−1). Plates were incubated at 18°C in the dark for 20 days until fungal mycelia were produced. The fungus was initially identified as Rcc on the basis of morphological characteristics (3). Colorless, 0- to 3-septate conidiophores were 15 to 17 × 2 to 5 μm, with a strongly curved end. Conidia were 7 to 11 × 3 to 6 μm, solitary, subglobose, single-celled, and of a darkish color. To confirm the presence of Rcc, DNA was extracted from the original barley leaf material, milled seeds, and positive control mycelia of Rcc grown on PDA using DNeasy Plant Mini Kit (Qiagen Gmbh, D-40724 Hilden, Germany) following manufacturer's guides. Rcc specific primers RC3 and RC5 (1) were used. A positive control consisting of 1 ng of purified Rcc DNA was included in the PCR. Standard PCR was conducted in a SEE AMP Seegene cycler. PCR were carried out in 20 μl volumes, containing 2 μl of DNA, 10 μl PCR mix, 0.4 μl each of forward and reverse Rcc primers, and 7.2 μl H2O. Qualitative detection analyzed by standard PCR with primers RC3 and RC5 revealed the presence of Rcc in symptomatic leaves and seeds. To complete Koch's postulates, a pathogenicity test was performed. Twenty-five barley seedlings were grown under controlled conditions (15°C/48 h dark, 16 h light/8 h dark, 70% RH) and spray-inoculated with a suspension of Rcc mycelium fragments as described by Macepeace et al. (2). The pathogen was re-isolated from leaves with necrotic lesions similar to those observed in the field, thus fulfilling Koch's postulates. To our knowledge, this is the first confirmed report of Ramularia leaf spot caused by Ramularia collo-cygni on barley in Estonia. References: (1) P. Frei et al. J. Phytopathol. 155:281, 2007. (2) J. C. Makepeace et al. Plant Pathol. 57:991, 2008. (3) B. C. Sutton and J. M. Waller. Trans. Brit. Mycol. Soc. 90:55, 1988. (4) J. C. Zadoks et al. Weed Res. 14:415, 1974.

scholarly journals First Report of Alternaria alternata Causing Leaf Spot on Menisper-mum dauricum DC. in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Hai feng Sun ◽  
Ming yu Wei ◽  
Na Li ◽  
Yu Yan
Keyword(s):  
Alternaria Alternata ◽  
Leaf Spot ◽  
Aerial Mycelium ◽  
Leaf Spot Disease ◽  
Small Lesion ◽  
Leaf Margin ◽  
Pathogenicity Test ◽  
First Report ◽  
Spot Disease ◽  
Initial Symptoms

Menispermum dauricum DC. is an ornamental plant used in traditional Chinese medicine. (Tang et al. 1992). In September 2019, a leaf spot on M. dauricum DC. was first found in a medicinal plant plantation in Harbin city (45.80°N, 126.53°E), Heilongjiang Province, China. The incidence was 76-90% on the 0.02 ha plantation. The initial symptoms were irregular black and brown spots on the leaves. The lesions expanded and coalesced, eventually leading to blight. Fresh leaf samples from ten M. dauricum plants with typical symptoms were collected. The areas of leaf between symptomatic and healthy tissue (5㎜×5㎜) were cut and surface disinfeated in 75% ethanol for 2 min, and with 1% HgCl2 for 1 min, and then rinsed three times with sterile water. Small lesion pieces were incubated on potato dextrose agar (PDA) for 7 days at 25℃, in the dark. Ten fungal isolates were obtained and transferred onto new PDA and potato carrot agar (PCA) plates to establish pure cultures. After 8 days, the colonies on PDA were 75-86㎜ in diameter, circular, with distinct concentric rings and a whitish aerial-mycelium margin, cottony, light gray to dark bluish brown. The colonies on the PCA were olive-green and bordered by white aerial hyphae. A total of 150 conidia were single or in short chains, obclavate, oval or inverted pear, light brown to brown, smooth or slightly spiny, with 1 to 6 transverse septa, 0 to 4 longitudinal or oblique septa, not narrow or slightly narrowed at the separation, 22.5-42.5×7.5-15.5㎛, and rostrate. Conidiophores were simple, erect, or ascending, dark brown, geniculate, septate, and with one or several conidial scars, 32.5-77.5×3.0-5.0㎛. Beaks were columnar or conical, 7.5-22.5×2.5-3.5㎛. Morphologically, all ten isolates were most similar to Alternaria alternata (Simmons 2007). For further identification of the fungus at the molecular level, internal transcribed spacer rDNA regions (ITS), RNA polymerase second largest subunit gene (RPB2) and Alternaria major allergen (Alt a 1) were amplified and sequenced using the primers ITS1 and ITS4, RPB2-5F2 and RPB2-7CR, Alt-for and Alt-rev (Woudenberg et al. 2015). The resulting sequences were deposited in GenBank (ITS: MT995193, MZ150794, RPB2: MT999483, MZ170963, Alt a 1: MT802122, MZ170962). BLAST search of these sequences showed 99%-100% homology with the ITS (FJ196306), RPB2 (KC584375) and Alt a 1 (KT315515) of the type strain CBS 916.96 of A. alternata, respectively. Thus, the fungus was identified as A. alternata based on the morphology and molecular analysis. For the pathogenicity test, spore suspensions (1×106 spores/mL) of the representative isolates BFG001 and BFG002 were sprayed onto the leaves of six healthy plants, separately. As a control, six plants were treated with sterile distilled water. The plants used in the experiment were covered with plastic bags and incubated at 25℃ for 10 days. Eight days after inoculation, irregular, slightly sunken black leaf spots appeared at the leaf margin. The experiment was repeated three times with the same method. The same fungus was successfully re-isolated from the leaves of the inoculated plants, fulfilling Koch’s postulates. No symptoms were observed on control plants. To our knowledge, this is the first report of leaf spot disease on M. dauricum DC. caused by A. alternata in the world. The appearance of leaf spot disease reduces the yield and quality of Chinese medicinal materials. This report has laid the foundation for the further research and control of leaf spot disease.

scholarly journals First report of Colletotrichum fioriniae causing anthracnose on mu oil tree in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yang Zhang ◽  
Guangqiang Li ◽  
Dou Yang ◽  
Ruoling Zhang ◽  
Songze Wan
Keyword(s):  
Leaf Spot ◽  
Disease Incidence ◽  
Juglans Regia ◽  
Morphological Characteristics ◽  
Leaf Spot Disease ◽  
Pathogenicity Test ◽  
First Report ◽  
Spot Disease ◽  
Initial Symptoms ◽  
Oil Plant

Mu oil tree (Vernicia montana) is an economically important woody oil plant, which is widely distributed in southern China. In mid-May 2020, a leaf spot disease was observed on the leaves of mu oil tree in Taihe County in Jiangxi Province, China (26°55′25.55″N, 114°49′5.85″E). The disease incidence was estimated to be above 40%. Initial symptoms were circular red-brown spots which were 1-2 mm in diameter, then enlarged with red-brown center. In later stages, the spots coalesced and formed large patches, and subsequently red-brown centers of lesions gradually dried and fell out, forming a “shot hole” appearance. To identify the pathogen, diseased leaves were collected from Taihe County. Leaf tissues (5 × 5 mm) were cut from the margins of typical symptomatic lesions, surface- sterilized in 75% ethanol for 30 seconds and 3% sodium hypochlorite for 60 seconds, then rinsed with sterile distilled water three times. Leaf pieces were placed on potato dextrose agar (PDA; 1.5%, Difco-BD Diagnostics) and incubated at 25 °C in the dark. Pure cultures were obtained from individual conidia by recovering single spores. On PDA, colonies were initially white and cottony. The mycelia then became pinkish to deep-pink with time at the center on the front side and pink on the reverse side. Colonies produced pale orange conidial masses after 9 days. Conidia were fusiform with acute ends, smooth-walled, hyaline, and measured 3.6–5.5 × 8.1–14.5 µm (4.5 ± 0.5 × 10.6 ± 1.0 µm, n = 100). The morphological characteristics of the isolate matched the descriptions of Colletotrichum acutatum complex (Damm et al. 2012). For molecular identification, the internal transcribed spacer (ITS) region, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), chitin synthase (CHS-1), beta-tubulin 2 (TUB2), and actin (ACT) were sequenced using the primers ITS1/ITS4, GDF/GDR, CHS-79F/CHS-345R, T1/Bt2b, ACT-512F/ACT-783R, respectively (Weir et al. 2012). The obtained sequences were deposited into the GenBank [accession nos. MW584317 (ITS); MW656269 (GAPDH); MW656270 (TUB2); MW656268 (CHS-1); MW656267 (ACT)]. All the sequences showed 94 to 100% similarity with those of C. fioriniae. A neighbor-joining phylogenetic tree was generated by combining all the sequenced loci using MEGA7.0 (Kumar et al. 2016). The isolate TH-M4 clustered with C. fioriniae, having 99% bootstrap support. Base on the morphology and multi-gene phylogeny, isolate TH-M4 was identified as C. fioriniae (Damm et al. 2012). To confirm pathogenicity, 20 healthy leaves of 10 mu oil trees (3-year-old) grown outdoors were inoculated with a drop of spore suspension (106 conidia per mL) of the isolate TH-M4 in September 2020. Another 10 plants were inoculated with sterile water as the control. The leaves were wounded with a sterile toothpick. All the inoculated leaves were covered with black plastic bags to maintain humidity for 2 days. The pathogenicity test was repeated twice. The resulting symptoms were similar to those on the original infected plants, whereas the control leaves remained asymptomatic. The same fungus was re-isolated from the lesions on the inoculated plant, fulfilling Koch’s postulates. C. fioriniae has been recorded as anthracnose pathogen on Mahonia aquifolium (Garibaldi et al. 2020), Paeonia lactiflora (Park et al. 2020), Solanum melongena (Xu et al. 2020), and Juglans regia (Varjas et al. 2020). To our knowledge, this is the first report of C. fioriniae associated with leaf spot disease on mu oil tree in China. This study provided crucial information for epidemiologic studies and appropriate control strategies for this oil plant disease.

scholarly journals First Report of Bacterial Leaf Spot on Snow Lotus Caused by Pseudomonas syringae in China

Plant Disease ◽  
2009 ◽  
Vol 93 (2) ◽  
pp. 204-204 ◽  
Author(s):  
S. F. Zhao ◽  
Y. N. Luo ◽  
H. Y. Zhao ◽  
J. Du ◽  
X. Y. Fang
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Unknown Etiology ◽  
Leaf Spot Disease ◽  
Sterile Water ◽  
Bacterial Leaf Spot ◽  
Saussurea Involucrata ◽  
First Report ◽  
Initial Symptoms ◽  
Snow Lotus

Snow lotus (Saussurea involucrata (Kar. & Kir.) Sch. Bip.) is an economically important medicinal herb increasingly grown in China in recent years. During the summer and autumn of 2005, 2006, and 2007, a necrosis of unknown etiology was observed on leaves in commercial production areas in Xinjiang Province of China. Disease incidence was approximately 40 to 50% of the plants during the 2005 and 2007 growing seasons. Initial symptoms consisted of pronounced water-soaked, dark brown-to-black spots that were 1 to 2 mm in diameter on young, expanding leaves. Later, some leaf spots on older leaves enlarged and coalesced, causing leaf desiccation. Leaf samples were collected in 2005, 2006, and 2007 from the affected hosts. Bacterial streaming was evident from these samples, and 28 strains were isolated on nutrient agar or King's medium B (KMB). All strains were gram negative and fluoresced bluegreen under UV light after 48 h of growth at 28°C on KMB. On the basis of LOPAT tests, the strains were identified as Pseudomonas syringae (1). The identity of two strains was confirmed by sequencing the 16S rDNA gene, which revealed 98% similarity to P. syringae strains in NCBI (Accession Nos. FJ001817 and FJ001818 for XJSNL 111 and 107, respectively). Infiltration of tobacco leaves with bacterial suspensions resulted in typical hypersensitivity reactions within 24 h. Pathogenicity of the strains was confirmed by spray inoculating five snow lotus leaves of a six-leaf stage plant with 108 CFU ml–1 bacterial suspensions in sterile water and five plants sprayed with sterile distilled water served as controls. Inoculated and sterile water-sprayed controls were maintained in the growth chamber with 90% relative humidity for 15 days at 15 ± 2°C. Symptoms similar to the original symptoms were observed on inoculated plants after 2 weeks. No symptoms developed on controls. Bacteria reisolated from inoculated plants were identified as strains of P. syringae. Isolates were deposited at the Key Laboratory for Oasis Crop Disease Prevention and Cure, Shihezi University. Rust caused by Puccinia carthami and leaf spot disease caused by Alternaria carthami of snow lotus have been reported (2,3). To our knowledge, this is the first report of P. syringae as the cause of bacterial leaf spot on snow lotus in China. References: (1) A. Braun-Kiewnick and D. C. Sands. Pseudomonas. Page 84 in: Laboratory Guide for the Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001. (2) S. Zhao et al. Plant Dis. 91:772, 2007. (3) S. Zhao et al. Plant Dis. 92:318, 2008.

scholarly journals First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 418-418 ◽  
Author(s):  
M. Gupta ◽  
N. Bharat ◽  
A. Chauhan ◽  
A. Vikram
Keyword(s):  
Host Range ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Molecular Techniques ◽  
Bacterial Suspension ◽  
Leaf Spot Disease ◽  
Rrna Gene ◽  
First Report ◽  
Leaf Spots ◽  
Initial Symptoms

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5′AACTGAAGAGTTTGATCCTGGCTC3′ and PR:5′TACGGTTACCTTGTTACGACTT3′, a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml–1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

scholarly journals First Report of a Leaf Spot on Conyza sumatrensis Caused by Phoma macrostoma in China

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 148-148 ◽  
Author(s):  
J. Liu ◽  
H. D. Luo ◽  
W. Z. Tan ◽  
L. Hu
Keyword(s):  
Leaf Spot ◽  
Fungal Pathogens ◽  
Biological Diversity ◽  
Biocontrol Agent ◽  
Continuous Light ◽  
The United States ◽  
Leaf Spot Disease ◽  
Pathogenicity Test ◽  
Dry Land ◽  
First Report

Conyza sumatrensis (Asteraceae), an annual or biennial plant, is native to North and South America. It is an invasive, noxious weed that is widespread in southern and southeastern China. It invades farm land and causes great losses to dry land crops, including wheat, corn, and beans. It also reduces biological diversity by crowding out native plants in the infested areas (3,4). During a search for fungal pathogens that could serve as potential biological control agents of C. sumatrensis, a leaf spot disease was observed in 2010 in Chongqing, China. An isolate (SMBC22) of a highly virulent fungus was obtained from diseased leaves. Pathogenicity tests were performed by placing 6-mm-diameter mycelial disks of 7-day-old potato dextrose agar (PDA) cultures of SMBC22 on leaves of 15 healthy greenhouse-grown plants of C. sumatrensis; the same number of control plants was treated with sterile PDA disks. Treated plants were covered with plastic bags for 24 h and maintained in a growth chamber with daily average temperatures of 24 to 26°C, continuous light (3,100 lux), and high relative humidity (>90%). Lesions similar to those observed in the field were first obvious on the SMBC22-inoculated leaves 3 days after inoculation. Symptoms became severe 7 to 9 days after inoculation. Control plants remained healthy. The fungus was reisolated from inoculated and diseased leaves and it was morphologically the same as SMBC22. The pathogenicity test was conducted three times. A survey of 10 southern and southeastern Chinese provinces revealed that the disease was widespread and it attacked leaves and stems of seedlings and mature plants of C. sumatrensis. Lesions on leaves were initially small, circular, and water soaked. The typical lesion was ovoid or fusiform, dark brown, and surrounded by a yellow halo. The spots coalesced to form large lesions and plants were often completely blighted. Fungal colonies of SMBC22 on PDA plates were initially white and turned dark gray. Colonies were circular with smooth edges with obvious rings of pycnidia on the surface. Aerial hyphae were short and dense. Pycnidia, black and immersed or semi-immersed in the medium, were visible after 12 days of incubation. Pycnidia were 72 to 140 μm in diameter. Conidia were produced in the pycnidia and were hyaline, unicellular, ellipsoidal, and 4.4 to 6.1 × 1.6 to 2.2 μm. To confirm identification of the fungus, genomic DNA was extracted from mycelia of a 7-day-old culture on PDA at 25°C (2). The internal transcribed spacer (ITS) gene of rDNA was amplified using primers ITS4/ITS5. The gene sequence was 524 bp long and registered in NCBI GenBank (No. HQ645974). BLAST analysis showed that the current sequence had 99% homology to an isolate of Phoma macrostoma (DQ 404792) from Cirsium arvense (Canada thistle) in Canada and reported to cause chlorotic symptoms on that host plant (1). To our knowledge, this is the first report of P. macrostoma causing disease on C. sumatrensis in China. P. macrostoma, thought of as a biocontrol agent of broadleaf weeds in Canada, has been patented in the United States. The current isolate of P. macrostoma is considered as a potential biocontrol agent of C. sumatrensis. References: (1) P. R. Graupner et al. J. Nat. Prod. 66:1558, 2004. (2) S. Takamatsu et al. Mycoscience 42:135, 2001. (3) W. Z. Tan et al. Page 177 in: Manual of Emergency Control Technology Invasive Pests in China. G. L. Zhang, ed. Science Press, Beijing, 2010. (4) C. Wang et al. J. Wuhan Bot. Res. 28:90, 2010.

scholarly journals First Report of a Leaf Spot on Snow Lotus Caused by Alternaria carthami in China

Plant Disease ◽  
2008 ◽  
Vol 92 (2) ◽  
pp. 318-318
Author(s):  
S. Zhao ◽  
G. Xie ◽  
H. Zhao ◽  
H. Li ◽  
C. Li
Keyword(s):  
Leaf Spot ◽  
Disease Incidence ◽  
Leaf Spot Disease ◽  
Tianshan Mountain ◽  
Causal Organism ◽  
Saussurea Involucrata ◽  
First Report ◽  
Spot Disease ◽  
Initial Symptoms ◽  
Snow Lotus

Snow lotus (Saussurea involucrata Karel. & Kir. ex Sch. Bip.) is an economically important medicinal herb increasingly grown in China in recent years. In June of 2005, a leaf spot disease on commercially grown plants was found in the QiTai Region, south of the Tianshan Mountain area of Xinjiang, China at 2,100 m above sea level. Disease incidence was approximately 60 to 70% of the plants during the 2006 and 2007 growing seasons. Initial symptoms appeared on older leaves as irregularly shaped, minute, dark brown-to-black spots, with yellow borders on the edge of the leaflet blade by July. As the disease progressed, the lesions expanded, causing the leaflets to turn brown, shrivel, and die. A fungus was consistently isolated from the margins of these lesions on potato dextrose agar. Fifty-eight isolates were obtained that produced abundant conidia in the dark. Conidia were usually solitary, rarely in chains of two, ellipsoid to obclavate, with 6 to 11 transverse and one longitudinal or oblique septum. Conidia measured 60 to 80 × 20 to 30 μm, including a filamentous beak (13 to 47 × 3.5 to 6 μm). According to the morphology, and when compared with the standard reference strains, the causal organism of leaf spot of snow lotus was identified as Alternaria carthami (1,4). Pathogenicity of the strains was tested on snow lotus seedlings at the six-leaf stage. The lower leaves of 20 plants were sprayed until runoff with conidial suspensions of 1 × 104 spores mL–1, and five plants sprayed with sterile distilled water served as controls. All plants were covered with a polyethylene bag, incubated at 25°C for 2 days, and subsequently transferred to a growth chamber at 25°C with a 16-h photoperiod. Light brown lesions developed within 10 days on leaflet margins in all inoculated plants. The pathogen was reisolated from inoculated leaves, and isolates were deposited at the Key Oasis Eco-agriculture Laboratory of Xinjiang Production and Construction Group, Xinjiang and the Institute of Biotechnology, Zhejiang University. No reports of a spot disease caused by A. carthami on snow lotus leaves have been found, although this pathogen has been reported on safflower in western Canada (3), Australia (2), India (1), and China (4). To our knowledge, this is the first report of a leaf spot caused by A. carthami on snow lotus in China. References: (1) S. Chowdhury. J. Indian Bot. Soc. 23:59, 1944. (2) J. A. G. Irwin. Aust. J. Exp. Agric. Anim. Husb. 16:921, 1976. (3) G. A. Petrie. Can. Plant Dis. Surv. 54:155, 1974. (4) T. Y. Zhang. J. Yunnan Agric. Univ.17:320, 2002.

Sign in / Sign up

Export Citation Format

Share Document