First Report of Pyrimethanil Resistance in Botrytis cinerea from Stored Apples in Pennsylvania

Botrytis cinerea Pers.: Fr. (teleomorph Botryotinia fuckeliana [de Bary] Whetzel) causes gray mold on apple fruit. A survey of commercial packinghouses in Washington State revealed that it accounted for 28% of the decay in storage (1). Fungicide application coupled with cultural practices are the primary method of control as all commercial apple cultivars are susceptible to gray mold. In February 2013, gray mold was observed at ~5% incidence for commercially packed ‘Gala’ apple fruit that had been treated with Penbotec (active ingredient: pyrimethanil, Shield-Bright, Pace International) prior to controlled atmosphere storage in Pennsylvania. Eight infected apple fruit were collected, placed in 80 count boxes on cardboard trays, and stored at 4°C. One isolate was obtained from each decayed apple, placed on potato dextrose agar (PDA) petri plates, and incubated at 20°C with natural light. Eight single-spore isolates were identified as B. cinerea based on cultural characteristics. Species level identification was executed by obtaining mycelial genomic DNA, amplifying the ITS rDNA, and sequencing the ~550-bp amplicon directly (2). MegaBLAST analysis of the 2X consensus for the 8 isolates revealed 100% identity to B. cinerea ITS sequences in GenBank (KF156296.1 and JX867227.1) with E values of 0.0, thus confirming the morphological identification. Minimum inhibitory concentration (MIC) was determined using conidial suspensions obtained from ~14-day-old plates (104 spores/ml) and a range (0 to 500 μg/ml) of technical grade pyrimethanil on three replicated 96-well microtiter plates containing a defined medium for each experiment. Conidial proliferation was inhibited at 250 μg/ml for all eight isolates and the experiment was conducted four times. To further define the resistance levels between the isolates, mycelial growth analysis using a plug of actively growing mycelium from the margin of ~3-day-old plates was conducted with a defined medium three times with technical grade pyrimethanil with three plates per experiment. Five isolates grew at 250 μg/ml (highly resistant), while three did not (moderately resistant). To assess resistance in vivo, organic ‘Gala’ apples were rinsed with soap and water, sprayed with 70% ethanol, placed on trays, and allowed to air dry. Apples were wounded with a sterile finishing nail, inoculated with 20 μl of a conidial suspension (104 spores/ml) of either a moderately or a highly resistant isolate, and dipped in the labeled application rate of Penbotec at 500 μg/ml or sterile water for 30 s. Fruit were stored in 100 count boxes at 22°C for 5 days and decay incidence and severity were recorded. Ten fruit composed a replicate per treatment and the experiment was repeated. Water inoculated controls were symptomless and water-dipped inoculated fruit had 100% decay. Penbotec-treated fruit had 100% decay incidence and mean lesion diameters of 37.6 (±13.1 mm) for the highly, and 35.7 (±9.0 mm) for the moderately resistant isolate. This is the first report of pyrimethanil resistance in B. cinerea from decayed apples collected from a commercial packinghouse in Pennsylvania. The results indicate that pyrimethanil resistance has developed in B. cinerea, which can result in control failures on Penbotec-treated fruit during storage. Furthermore, it emphasizes the need for additional tools to manage gray mold on apple fruit and may pose issues for export concerning the spread of fungicide-resistant inoculum. References: (1) Y.-K. Kim and C. L. Xiao. Plant Dis. 92:940, 2008. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽

10.1094/pdis-04-21-0698-pdn ◽

2021 ◽

Author(s):

Jun Guo ◽

Jin Chen ◽

Zhao Hu ◽

Jie Zhong ◽

Jun Zi Zhu

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Hunan Province ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Basal Cells ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

Download Full-text

Pathogenic Capacity of Botrytis cinerea on Leaves of Pyrus mamorensis, an Endemic Tree of Mamora Forest in Morocco

Atlas Journal of Biology ◽

10.5147/ajb.v2i2.159 ◽

2017 ◽

Vol 2 (2) ◽

pp. 125-129

Author(s):

Zineb Sellal ◽

Jamila Dahmani ◽

Rachid Benkirane ◽

Amina Ouazzani Touhami ◽

Allal Douira

Keyword(s):

Botrytis Cinerea ◽

Disease Severity ◽

Filter Paper ◽

Pathogenic Fungus ◽

Gray Mold ◽

Conidial Suspension ◽

First Report ◽

Conidia Production

A survey in the Mamora forest was done in the spring of 2010 and revealed that 67% of buds and 27% of leaves of Pyrus mamorensis (Trabut) samples collected had lesions with a gray felting. The pathogenic fungus was identified as Botrytis cinerea by the filter – paper technic. Koch´s postulate was verified by inoculating healthy leaves. The estimated disease severity on P. mamorensis leaves was respectively 75.56% and 68.81% for inoculation by conidial suspension and the mycelial disks. Conidia production of Botrytis cinerea on inoculated leaves by conidial suspension was 1.03.105 conidia.cm-2 and by mycelial disks was 0.60.105 conidia.cm-2. This was the first report of gray mold disease of Mamora pear caused by Botrytis cinerea in Morocco.

Download Full-text

First Report of Fludioxonil Resistance in Botrytis cinerea from a Blackberry Field in Georgia

Plant Disease ◽

10.1094/pdis-10-13-1020-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 848-848 ◽

Cited By ~ 6

Author(s):

D. Fernández-Ortuño ◽

A. Grabke ◽

P. K. Bryson ◽

E. D. Beasley ◽

L. A. Fall ◽

...

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Crop Protection ◽

The United States ◽

Gray Mold ◽

Resistant Isolate ◽

Malt Extract ◽

First Report ◽

Control Fruit ◽

Lesion Diameter

Botrytis cinerea Pers. is an important plant-pathogenic fungi responsible for gray mold on more than 230 plant species worldwide, including blackberry (Rubus). One of the main strategies to control the disease involves the application of different classes of fungicides. The phenylpyrrole fludioxonil is currently marketed in combination with the anilinopyrimidine cyprodinil as Switch 62.5WG (Syngenta Crop Protection Inc., Greensboro, NC) for gray mold control. In August 2013, blackberries affected with symptoms resembling gray mold were collected from a field located in Berrien County (Georgia), where Switch 62.5WG had been used extensively over the last 5 years. Three single-spore isolates, each from a different fruit, were obtained and identified as B. cinerea on the basis of morphology and confirmed by a 238-bp PCR amplification product obtained with primer set G3PDH-F1 (5′-GGACCCGAGCTAATTTATGTCACGT-3′), G3PDH-F2 (5′-GGGTGTCAACAACGAGACCTACACT-3′), and G3PDH-R (5′-ACCGGTGCTCGATGGGATGAT-3′). In vitro sensitivity to fludioxonil (Scholar SC, Syngenta) was determined on 1% malt extract agar (MEA) using a conidial germination assay as previously described (4). One isolate was moderately resistant due to growth on medium amended with the discriminatory dose of 0.1 μg/ml fludioxonil and residual growth at 10 μg/ml (4). To assess performance of fludioxonil in detached fruit assays, commercially grown strawberries (24 in total for each isolate and treatment) were rinsed with water, dried, and sprayed 4 h prior to inoculation with either water (control fruit) or 2.5 ml/liter of Scholar SC to runoff using a hand mister. Scholar SC was used because fludioxonil was the sole active ingredient in this product and strawberries were used because latent infections in fresh blackberry fruit interfered with inoculation experiments. This dose reflects the rate recommended for postharvest gray mold control according to the Scholar label. Fruit was stab-wounded with a sterile syringe and inoculated with a 30-μl droplet of conidia suspension (106 spores/ml) of the two sensitive or the resistant isolate. After inoculation, the fruit were kept at 22°C for 4 days. The sensitive isolates developed gray mold on non-treated (2.7 cm lesion diameter) but not on Scholar SC-treated fruit (0.0 cm lesion diameter). The resistant isolate developed gray mold disease on the water-treated control fruit (2.5 cm lesion diameter) and the fungicide-treated fruit (1.8 cm lesion diameter). EC50 values were determined in microtiter assays as described previously (3) using the concentrations of 0.01, 0.04, 0.12, 0.37, 1.1, 3.3, and 10 μg/ml fludioxonil. Values were 0.02 and 0.05 μg/ml for the two sensitive isolates and 3.15 μg/ml for the resistant isolate. All experiments were performed twice. This is the first report of fludioxonil resistance in B. cinerea from blackberry in Georgia. Prior to this study, resistance to fludioxonil in B. cinerea was reported in France, Germany, and only a few states in the United States including Maryland, South Carolina, Virginia, and Washington (1,2). The emergence of resistance to fludioxonil emphasizes the importance of resistance management strategies. References: (1) D. Fernández-Ortuño et al. Plant Dis. 97:848, 2013. (2) D. Fernández-Ortuño et al. Plant Dis. 98:692, 2013. (3) M. Kretschmer et al. PLOS Pathog. 5:e1000696, 2009. (4) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011.

Download Full-text

First Report of Iprodione Resistance in Botrytis cinerea on Blackberry from South Carolina

Plant Disease ◽

10.1094/pdis-07-11-0543 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1481-1481

Author(s):

F. P. Chen ◽

X. L. Liu ◽

X. P. Li ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Disease Incidence ◽

Gray Mold ◽

Resistant Isolate ◽

Cross Resistance ◽

Broad Host Range ◽

Paper Strip ◽

Single Spore ◽

First Report

Botrytis cinerea Pers.:Fr., is a necrotrophic fungus with a broad host range that causes gray mold on hundreds of plant species (2). Control of gray mold mainly depends on fungicides, including the dicarboxamide iprodione. Thirty-nine diseased blackberry fruit were collected from four orchards in South Carolina and the sensitivity of single-spore isolates to iprodione was examined by Spiral Plater assays (1) on potato dextrose agar (PDA). Briefly, a 5.3 cm long paper strip containing mycelia was placed along the concentration gradient of the PDA and 50% inhibition (EC50 value) was calculated after 2 days of incubation with the Spiral Gradient Endpoint (SGE) software (Spiral Biotech, Norwood, MA). Each isolate was tested in duplicates. Sensitivity ranged from 0.043 to 2.596 μg/ml, with a maximum resistance factor of 60.4. Isolates with EC50 values greater than 2 μg/ml were found in two orchards. Those isolates represented 40 and 7.1% of the total isolates from each orchard. Two isolates with high (EC50 value of 2.596 μg/ml) and low (EC50 value of 0.062 μg/ml) values were chosen to determine the efficacy of iprodione formulated product Rovral 4 Fl (Bayer CropSciences, Research Triangle Park, NC) on detached apple fruit. Fifteen apples were used for each isolate and experiment. Each fruit was wounded on the surface in three locations with a sterile syringe and inoculated with 15 μl of a spore suspension (106 conidia/ml) at the wounded sites. Rovral was applied at the recommended label rate either 24 h before (protective treatment) or 48 h after inoculation (curative treatment). The experiment was conducted three times. Blackberry fruit were not found suitable for this assay because of persistent contamination problems likely from latent infections of a symptomatic fruit. Disease incidence and lesion diameter were recorded 7 days after incubation. Disease incidence following inoculation of the sensitive and resistant isolates on non-fungicide-treated fruit was 100 and 86.7%, respectively. Disease incidence on fungicide-treated apples was 4.4% for the sensitive isolate and 75.6% for the resistant isolate with corresponding mean lesion areas of 0.36 mm and 9.37 mm, respectively. Both isolates were controlled effectively in protective treatments, however, indicating low levels of resistance. To our knowledge, this is the first report of iprodione resistance in B. cinerea from blackberry or any other field-grown crop in South Carolina. This finding adds to a study from 1999 (3) documenting resistance to the dicarboxamide fungicide vinclozolin in B. cinerea collected from ornamentals in South Carolinian greenhouses and suggests that resistance to iprodione needs to be considered in the design of gray mold control strategies in commercial blackberry orchards. No cross resistance between the phenylpyrrole fludioxonil and iprodione was found. References: (1) H. Forster et al. Phytopathology 94:163, 2004. (2) B. Williamson et al. Mol. Plant Pathol. 8:561. 2007. (3) L. F. Yourman and S. N. Jeffers. Plant Dis. 83:569, 1999.

Download Full-text

First Report of Gray Mold in Tomato Caused by Botrytis cinerea in Baja California, Mexico

Plant Disease ◽

10.1094/pd-89-0528b ◽

2005 ◽

Vol 89 (5) ◽

pp. 528-528 ◽

Cited By ~ 1

Author(s):

R. J. Holguín-Peña ◽

F. G. Arcos

Keyword(s):

Botrytis Cinerea ◽

Baja California ◽

Polymerase Chain Reaction Amplification ◽

Random Amplified Polymorphic Dna ◽

Gray Mold ◽

Malt Extract ◽

Conidial Suspension ◽

Sterile Water ◽

Tomato Production ◽

First Report

San Quintin Valley, a 60-mile-long coastal plain (30°30′N, 116°W) in the Baja California Peninsula, is one of the major fresh tomato (Lycopersicon esculentum Mill.) production areas in Mexico with more than 8,000 ha. During the last 10 years, the valley's tomato production has declined because of gray mold and stem canker diseases. Flower rot, reddish brown margins on the leaves and stems, and fruit with a gray mold were observed on field-grown tomato plants (Roma type cv. Tequila) in the autumn of 2003. Severity ranging from 55 to 60% was observed at harvest. Infected tissues were sampled and disinfested by immersion in 1% NaOCl for 1 min, rinsed in sterile water, and placed on malt extract agar at 22°C. Fungal conidia were then transferred to 2% potato dextrose agar (PDA). The resulting fungal colonies were definitively identified as Botrytis cinerea Pers.:Fr. The colonies of B. cinerea were first hyaline and white and became dark gray after 96 h. Mycelia were septate with dark branched conidiophores. Conidia were unicellular, ellipsoid, and ranged from 5 to 8 × 8 to 14 μm. Profuse black sclerotia developed in 7-day-old cultures. Infection site analyses in diseased flowers at different stages during the bloom were done with scanning electron microscopy. Fungal hyphae were located predominantly on the receptacle areas, whereas conidia were located in the ovaries as described previously (3). The identity of B. cinerea was confirmed by a restriction digest with ApoI of the 413-kb polymerase chain reaction amplification product obtained with BA2f/BA1r primers (1) and random amplified polymorphic DNA banding patterns (2). Pathogenicity tests were done by spray inoculation of 1-ml aqueous conidial suspension (106 CFU/ml) on 20 healthy plants during the blossom stage. An equal number of plants sprayed with sterile water was used as the control. Plants were incubated at 20 ± 2°C for 5 days. The fungus was reisolated from diseased flowers and peduncles after surface disinfestation (2.5% NaOCl) and plating on PDA. No symptoms were observed in the noninoculated controls. To our knowledge, this is the first report of B. cinerea causing gray mold disease on tomato in Baja California. References: (1) K. Nielsen et al. Plant Dis. 86:682, 2002. (2) S. Rigotti et al. FEMS Microbiol. Lett. 209:169, 2002. (3) O. Viret et al. Phytopathology 94:850, 2004.

Download Full-text

First Report of Thiophanate-Methyl Resistance in Botrytis cinerea on Strawberry from South Carolina

Plant Disease ◽

10.1094/pdis-06-12-0557-pdn ◽

2012 ◽

Vol 96 (11) ◽

pp. 1700-1700 ◽

Cited By ~ 8

Author(s):

D. Fernández-Ortuño ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Fungicide Resistance ◽

Pathogenic Fungi ◽

Gray Mold ◽

Resistant Isolate ◽

Conidial Suspension ◽

Strawberry Fruit ◽

Single Spore ◽

Thiophanate Methyl

Botrytis cinerea Pers.:Fr. is the causal agent of gray mold disease and one of the most important plant-pathogenic fungi affecting strawberry (Fragaria× ananassa). Control of gray mold mainly depends on fungicides, including the methyl benzimidazole carbamate (MBC) thiophanate-methyl. In 2011, strawberries with gray mold symptoms were collected from commercial fields near Chesnee, Florence, Lexington, McBee, Monetta, and North Augusta, all in South Carolina. MBC fungicides were used in most of these fields for gray mold control during the last 3 years. A total of 124 single spore B. cinerea isolates were obtained, each from a different fruit. Resistance to thiophanate-methyl (Topsin M 70WP, Cerexagri-Nisso LLC, King of Prussia, PA) was determined using a conidial germination assay as described previously (1). The majority of isolates (81.4%) were resistant; the rest were sensitive. Resistant isolates were found in all locations with some populations (Chesnee, McBee, and Lexington) revealing no sensitive isolates. Genomic DNA from 35 resistant isolates (representing all locations) and 10 sensitive isolates (from Chesnee, Monetta, and North Augusta, SC) was extracted, and the molecular basis of MBC fungicide resistance was determined as described previously (2). All MBC-resistant isolates possessed the E198A mutation known to confer high levels of MBC fungicide resistance in many fungi, including B. cinerea (2,3). Disease was assessed using a detached strawberry fruit assay. Commercially grown strawberry fruit (24 in total for each isolate and fungicide treatment) were rinsed with water, dried, and sprayed 4 h prior to inoculation with either water or 2.4 g/liter of Topsin M to runoff using a hand mister. Fruit was stab-wounded with a sterile syringe and inoculated with a 30-μl droplet of a conidial suspension (106 spores/ml) of either a sensitive or resistant isolate. After inoculation, the fruit were kept at 22°C for 4 days. The sensitive isolate developed gray mold disease in untreated but not Topsin M-treated fruit. The resistant isolate developed gray mold disease of equal severity in both, the control and fungicide-treated fruit. This experiment was repeated once. The results of the study show that resistance to MBC fungicides is common and widespread in B. cinerea from strawberry in South Carolina. Prior to this study, resistance to MBCs has only been reported in B. cinerea from ornamental crops grown in greenhouses in South Carolina (4). References: (1) J. E. Luck and M. R. Gillings. Mycol. Res. 99:1483, 1995. (2) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011. (3) O. Yarden and T. Katan. Phytopathology 83:1478, 1993. (4) L. F. Yourman and S. Jeffers. Plant Dis. 83:569, 1999.

Download Full-text

First Report of Colletotrichum fioriniae Causing Postharvest Decay on ‘Nittany’ Apple Fruit in the United States

Plant Disease ◽

10.1094/pdis-08-13-0816-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 993-993 ◽

Cited By ~ 14

Author(s):

L. P. Kou ◽

V. Gaskins ◽

Y. G. Luo ◽

W. M. Jurick

Keyword(s):

United States ◽

Cold Storage ◽

Management Practices ◽

The United States ◽

Apple Fruit ◽

Morphological Identification ◽

Conidial Suspension ◽

First Report ◽

Postharvest Decay ◽

Bitter Rot

Bitter rot of apple is caused by Colletotrichum acutatum and C. gleosporioides and is an economically important disease in the mid-Atlantic and southern regions of the United States (1). However, other Colletotrichum spp. have been found to infect apple and pear fruit in Croatia that include C. fioriniae and C. clavatum (3). The disease is favorable under wet, humid conditions and can occur in the field or during storage causing postharvest decay (2). In February 2013, ‘Nittany’ apples with round, brown, dry, firm lesions having acervuli in concentric rings were observed at a commercial cold storage facility in Pennsylvania. Samples were placed on a paper tray in an 80-count apple box and immediately transported to the lab. Fruit were rinsed with sterile water, and lesions were sprayed with 70% ethanol until runoff. The skin was aseptically removed with a scalpel, and tissue under the lesion was placed onto potato dextrose agar (PDA) petri dishes. Dishes were incubated at 25°C with constant light, and a single-spore isolate was propagated on PDA. Permanent cultures were maintained as PDA slants stored at 4°C in darkness. The isolate was identified as a Colletotrichum sp. based on culture morphology, having light gray mycelium with a pinkish reverse and abundant pin-shaped melanized acervuli oozing pink conidia on PDA. Conidia were fusiform, pointed at one or both ends, one-celled, thin-walled, aseptate, hyaline, and averaged 10.5 μm (7.5 to 20 μm) long and 5.1 μm (5 to 10 μm) wide (n = 50). Genomic DNA was extracted from mycelia and amplified using conventional PCR and gene specific primers for 313 bp of the Histone 3 gene and with ITS4/5 primers for the internal transcribed spacer (ITS) rDNA region. MegaBLAST analysis of both gene sequences showed that our isolate was identical to other Colletotrichum fioriniae sequences in GenBank and was 100% identical to culture-collection C. fioriniae isolate CBS:128517, thus confirming the morphological identification. To prove pathogenicity, Koch's postulates were conducted using organic ‘Gala’ apple fruit that were washed with soap and water, sprayed with 70% ethanol, and wiped dry. The fruit were wounded with a sterile nail to a 3-mm depth, inoculated with 50 μl of a conidial suspension (1 × 104 conidia/ml), and stored at 25°C in 80-count boxes on paper trays for 14 days. Lesion diameter was measured from 10 replicate fruit with a digital micrometer and averaged 31.2 mm (±2.5 mm) over two experiments (n = 20). Water-only controls were symptomless. Artificially inoculated ‘Gala’ apples had identical external and internal symptoms (v-shaped decay pattern when the fruit were cut in half) to those observed on ‘Nittany’ apples that were originally obtained from cold storage. Bitter rot caused by C. fioriniae may become an emerging problem for the pome fruit growing industry in the near future, and may require investigation of new disease management practices to control this fungus. This is the first report of postharvest decay caused by C. fioriniae on apple fruit from cold storage in the United States. References: (1) H. W. Anderson. Diseases of Fruit Crops. McGraw-Hill, New York, 1956. (2) A. R. Biggs et al. Plant Dis. 85:657, 2001. (3) D. Ivic et al. J. Phytopathol. 161:284, 2013.

Download Full-text

First Report of Botrytis Leaf Blight and Fruit Rot on Schisandra chinensis Caused by Botrytis cinerea in China

Plant Disease ◽

10.1094/pdis-02-11-0086 ◽

2011 ◽

Vol 95 (6) ◽

pp. 769-769

Author(s):

R. H. Yu ◽

J. Gao ◽

J. Wang ◽

X. Wang

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Leaf Blight ◽

Jilin Province ◽

Fruit Rot ◽

Conidial Suspension ◽

Schisandra Chinensis ◽

Mycelium Growth ◽

First Report

Schisandra (Schisandra chinensis (Turcz.) Baill) is a perennial plant belonging to Magnoliaceae. It is a very important medicinal herb in China and is mainly used for treatment of insomnia and memory decay. From July to September 2008, an unknown leaf blight and fruit rot on schisandra were first observed at Jingyu County, Jilin Province. The same symptoms were detected in other areas of Jilin Province, such as Ji'an City, Baishan City, and Hunchun City. Initially, some small, brown spots appeared on the tip or margin of the leaves. Light brown or brown necrotic lesions developed and eventually covered entire leaves. Seriously affected leaves were rolled or distorted and eventually became completely dry and brittle. Small spots appeared on the surface of mature fruits, coalesced, and the fruits finally dropped. Gray mycelia and conidiophores developed on the diseased leaves and fruits. To isolate the causal agent, conidia and conidiophores were scraped aseptically from the internal tissues, suspended in sterile water, and streaked onto the surface of potato dextrose agar (PDA). Single-hyphal tips were transferred on PDA and the isolated fungus was identified as Botrytis cinerea Pers.: Fr. on the basis of its morphological characteristics and internal transcribed spacer (ITS) sequence. Colonies of B. cinerea on PDA were colorless at first and became gray to brown 20 days later with the mycelium growth and conidia producing in cultures. Conidia are single celled, lemon shaped, colorless to a light color, and 4.4 to 15.0 × 7.0 to 10.0 μm. Sclerotia formed about 1 week later, were black-brown and varied in size (2.0 to 5.0 × 2.0 to 4.0 mm) and shape. The ITS region of rDNA was amplified from DNA extracted from single-spore isolate BC12 of B. cinerea using primers ITS4/ITS5 and sequenced (GenBank Accession No. GU724512), BLAST analysis (1) of the 535-bp segment showed 99% similarity with the sequence of Botryotinia fuckeliana (perfect stage of B. cinerea). Pathogenicity tests were carried out on healthy schisandra plants that were 4 years old. After the surface of the leaves and fruits was disinfected with 5% sodium hypochlorite, a conidial suspension of 105 conidia/ml was sprayed on 10 schisandra leaves, and plugs of the fungus obtained from the colony margins were transferred onto a 3- × 3-mm wound on the surface of disinfected fruit. Ten control schisandra leaves and 10 fruits were inoculated at the same time. Plants were covered with polyethylene bags and incubated at 25°C in a greenhouse with relative humidity of 85% for 3 days. Similar symptoms to those observed on diseased leaves and fruits in the field were observed on inoculated schisandra leaves and fruits 7 days after inoculation, whereas control leaves and fruits showed no symptoms. The pathogen was successfully reisolated. The gray mold disease caused by B. cinerea was reported in many plants, such as Lavandula stoechas and Chamelaucium uncinatum in Italy (2,3). However, to our knowledge, this is the first report of gray mold disease of schisandra caused by B. cinerea in China. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) A. Garibaldi et al. Plant Dis. 94:968, 2009. (3) A. Garibaldi et al. Plant Dis. 94:380, 2010.

Download Full-text

First Report of Fludioxonil Resistance in Botrytis cinerea from a Strawberry Field in Virginia

Plant Disease ◽

10.1094/pdis-01-13-0012-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 848-848 ◽

Cited By ~ 12

Author(s):

D. Fernández-Ortuño ◽

P. K. Bryson ◽

A. Grabke ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Disease Incidence ◽

Crop Protection ◽

Gray Mold ◽

Resistant Isolate ◽

Single Spore ◽

First Report ◽

Single Spore Isolate

Gray mold caused by Botrytis cinerea Pers.:Fr. is one of the most economically important diseases of cultivated strawberry (Fragaria × ananassa) worldwide. Control of gray mold mainly depends on fungicides, including the phenylpyrrole fludioxonil, which is currently marketed in combination with cyprodinil as Switch 62.5WG (Syngenta Crop Protection, Research Triangle Park, Raleigh, NC). In 2012, 790 strains of B. cinerea were collected from 76 strawberry fields in eight states, including Arkansas, Florida, Georgia, Kansas, Maryland, North Carolina, South Carolina, and Virginia. Strains were collected from sporulating flowers and fruit and sensitivity to fludioxonil was determined using a conidial germination assay as previously described (2). Only one isolate from a farm located in Westmoreland County, Virginia, grew on medium amended with the discriminatory dose of 0.1 μg/ml fludioxonil and was therefore considered low resistant. The isolate did not grow on 10 μg/ml. All other 789 isolates did not grow at either of the two doses. This assay was repeated twice with a single-spore culture of the same strain. In both cases, residual growth was observed on the fludioxonil-amended medium of 0.1 μg/ml. The single spore isolate was confirmed to be B. cinerea Pers. using cultural and molecular tools as described previously (1). To assess resistance in vivo, commercially grown ripe strawberry fruit were rinsed with sterile water, dried, placed into plastic boxes (eight strawberries per box for each of the three replicates per treatment), and sprayed 4 h prior to inoculation with either water or 2.5 ml/liter of fludioxonil (Scholar SC, Syngenta) to runoff using a hand mister. This dose reflects the rate recommended for gray mold control according to the Scholar label. Each fruit was stabbed at three equidistant points, each about 1 cm apart and 1 cm deep using a syringe tip. Wounds were injected with a 30-μl droplet of conidia suspension (106 spores/ml) of either 5 sensitive or the resistant isolate. Control fruit were inoculated with water. After inoculation, the fruit were kept at 22°C for 4 days. In two independent experiments, sensitive and low resistant isolates were indistinguishable in pathogenicity on detached, unsprayed fruit. The low resistant isolate developed gray mold disease on all treated and untreated fruit (100% disease incidence) as determined by the absence or presence of gray mold symptoms. The sensitive isolates only developed disease on untreated fruit. The EC50 values, determined in microtiter assays with concentrations of 0.01, 0.03, 0.1, 0.3, 1, 3, and 10 μg/ml fludioxonil, were 0.01 μg/ml for the sensitive isolates and 0.26 μg/ml for the resistant isolate. To our knowledge, this is the first report of fludioxonil resistance in B. cinerea from strawberry in North America. Our monitoring results indicate that resistance is emerging 10 years after the introduction of fludioxonil and stress the importance of chemical rotation for gray mold control. References: (1) X. P. Li et al. Plant Dis. 96:1634, 2012. (2) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011.

Download Full-text