First Report of Botrytis Leaf Blight and Fruit Rot on Schisandra chinensis Caused by Botrytis cinerea in China

Schisandra (Schisandra chinensis (Turcz.) Baill) is a perennial plant belonging to Magnoliaceae. It is a very important medicinal herb in China and is mainly used for treatment of insomnia and memory decay. From July to September 2008, an unknown leaf blight and fruit rot on schisandra were first observed at Jingyu County, Jilin Province. The same symptoms were detected in other areas of Jilin Province, such as Ji'an City, Baishan City, and Hunchun City. Initially, some small, brown spots appeared on the tip or margin of the leaves. Light brown or brown necrotic lesions developed and eventually covered entire leaves. Seriously affected leaves were rolled or distorted and eventually became completely dry and brittle. Small spots appeared on the surface of mature fruits, coalesced, and the fruits finally dropped. Gray mycelia and conidiophores developed on the diseased leaves and fruits. To isolate the causal agent, conidia and conidiophores were scraped aseptically from the internal tissues, suspended in sterile water, and streaked onto the surface of potato dextrose agar (PDA). Single-hyphal tips were transferred on PDA and the isolated fungus was identified as Botrytis cinerea Pers.: Fr. on the basis of its morphological characteristics and internal transcribed spacer (ITS) sequence. Colonies of B. cinerea on PDA were colorless at first and became gray to brown 20 days later with the mycelium growth and conidia producing in cultures. Conidia are single celled, lemon shaped, colorless to a light color, and 4.4 to 15.0 × 7.0 to 10.0 μm. Sclerotia formed about 1 week later, were black-brown and varied in size (2.0 to 5.0 × 2.0 to 4.0 mm) and shape. The ITS region of rDNA was amplified from DNA extracted from single-spore isolate BC12 of B. cinerea using primers ITS4/ITS5 and sequenced (GenBank Accession No. GU724512), BLAST analysis (1) of the 535-bp segment showed 99% similarity with the sequence of Botryotinia fuckeliana (perfect stage of B. cinerea). Pathogenicity tests were carried out on healthy schisandra plants that were 4 years old. After the surface of the leaves and fruits was disinfected with 5% sodium hypochlorite, a conidial suspension of 105 conidia/ml was sprayed on 10 schisandra leaves, and plugs of the fungus obtained from the colony margins were transferred onto a 3- × 3-mm wound on the surface of disinfected fruit. Ten control schisandra leaves and 10 fruits were inoculated at the same time. Plants were covered with polyethylene bags and incubated at 25°C in a greenhouse with relative humidity of 85% for 3 days. Similar symptoms to those observed on diseased leaves and fruits in the field were observed on inoculated schisandra leaves and fruits 7 days after inoculation, whereas control leaves and fruits showed no symptoms. The pathogen was successfully reisolated. The gray mold disease caused by B. cinerea was reported in many plants, such as Lavandula stoechas and Chamelaucium uncinatum in Italy (2,3). However, to our knowledge, this is the first report of gray mold disease of schisandra caused by B. cinerea in China. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) A. Garibaldi et al. Plant Dis. 94:968, 2009. (3) A. Garibaldi et al. Plant Dis. 94:380, 2010.

Download Full-text

First Report of Botrytis Leaf Blight on Eleutherococcus senticosus Caused by Botrytis cinerea in China

Plant Disease ◽

10.1094/pdis-01-14-0031-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1270-1270 ◽

Cited By ~ 4

Author(s):

X. Wang ◽

B. H. Lu ◽

Y. Zhi ◽

L. N. Yang ◽

J. Gao

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Leaf Tissue ◽

Leaf Blight ◽

Jilin Province ◽

Perennial Herb ◽

Conidial Suspension ◽

Acanthopanax Senticosus ◽

Eleutherococcus Senticosus ◽

First Report

Eleutherococcus senticosus (Acanthopanax senticosus, manyprickle acathopanax) is a perennial herb belonging to the family Araliaceae and is mainly distributed in northeastern China, Siberia, Korea, and Japan. It is used for the treatment of rheumatism and neurasthenia. With the development of its cultivation, many diseases began to occur (2) and a previously unknown leaf blight on manyprickle was first observed in July of 2010 in Linjiang City, Jilin Province. The same symptoms were detected in other areas of Jilin Province, such as Baishan and Hunchun cities. The disease has resulted in serious loss of production of manyprickle acanthopanax, with 5 to 10% of leaves infected. The infection initially manifested as irregular lesions on the tips or margins of the leaves, which gradually developed into a V-shaped blight with concentric rings that was grayish brown in the center and dark brown at the margins. The blight eventually spread to cover one third of the entire leaf. Severely infected leaves were rolled or distorted, eventually desiccated and became brittle. Under continuously humid conditions, scattered gray mycelium and conidia appeared on the surface of affected leaf tissue. To isolate the causal agent, tissues were excised from diseased leaves, immersed in 0.1% mercuric chloride, suspended in sterile water, and plated on potato dextrose agar (PDA). Conidiophores arose singly or in groups, straight or flexuous, septate, with an inflated basal cell and dendriform near the apex, brown to light brown, and measured 5.0 to 10.0 × 100.0 to 150.0 μm (n = 50). Conidia were single-celled, globoid or oval-shaped, colorless, measuring 6.0 to 10.0 × 7.0 to 13.0 μm (n = 50). In culture, dark, irregular sclerotia were produced. The morphological descriptions and measurements of the fungi were similar to Botrytis cinerea (4). The ITS region of rDNA was amplified and sequenced. BLAST analysis of the 567-bp segment (JX840481) showed 100% identity with the sequence of Botryotinia fuckeliana (perfect stage of B. cinerea). To further identify the species of B. cinerea, three nuclear protein-coding genes (G3PDH, HSP60, and RPB2) (3) were sequenced and the sequences (KJ018759, KJ018757, and KJ018755) all showed 100% identity with those of B. fuckeliana. Pathogenicity tests were carried out on potted, healthy, 1-year-old plants (n = 10). A conidial suspension of 105 conidia/ml was sprayed with each strain (five strains total) on five leaves still on plants, and five plants were sprayed with water as controls. Plants were covered with polyethylene bags and incubated for 3 days at 25°C in a greenhouse. Symptoms appeared 7 days after inoculation, and were similar to those originally observed on plants under natural conditions, whereas control plants remained healthy. The pathogen was successfully re-isolated from inoculated leaves and was identified as B. cinerea on the basis of its morphological characteristics and related gene sequences. B. cinerea has been previously reported on E. senticosus in Korea (1). However, to our knowledge, this is the first report of Botrytis leaf blight of E. senticosus caused by B. cinerea in China. These results lay the foundation for the disease control. References: (1) K. J. Choi et al. Korean J. Med. Crop Sci. 15:199, 2007. (2) J. Gao et al. Plant Dis. 95:493, 2011. (3) M. Staats et al. Mol. Biol. Evol. 22:333, 2005. (4) Z. Y. Zhang. Flora Fungorum Sinicorum. 26. Botrytis, Ramularia. Science Press, Beijing, 2006.

Download Full-text

First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽

10.1094/pdis-04-21-0698-pdn ◽

2021 ◽

Author(s):

Jun Guo ◽

Jin Chen ◽

Zhao Hu ◽

Jie Zhong ◽

Jun Zi Zhu

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Hunan Province ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Basal Cells ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold of Pomegranate (Punica granatum) in Greece

Plant Disease ◽

10.1094/pdis-93-12-1346c ◽

2009 ◽

Vol 93 (12) ◽

pp. 1346-1346 ◽

Cited By ~ 8

Author(s):

G. A. Bardas ◽

G. D. Tzelepis ◽

L. Lotos ◽

G. S. Karaoglanidis

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Punica Granatum ◽

The United States ◽

Gray Mold ◽

Fruit Rot ◽

American Phytopathological Society ◽

First Report ◽

Surface Sterilization ◽

Food Agric

Pomegranate is rapidly increasing in production in Greece. During August of 2008 in the region of Larisa (central Greece), preharvest fruit rot was observed on pomegranate (cv. Kapmaditika) that caused losses estimated at 10%. Symptoms first appeared as small spots on the fruits that later increased in size and developed into expanded, dark brown lesions. Internally, tissues were soft and brown with gray mycelia and conidiophores observed. Affected fruits decayed completely during 2 months of storage (5 to 6°C), causing yield losses of up to 20%. To isolate the casual agent, conidia and conidiophores were scraped aseptically from the internal tissues, suspended in sterile water, and streaked onto the surface of potato dextrose agar (PDA). Single hyphal tips were transferred to PDA, and the isolated fungus was identified as Botrytis cinerea Pers.:Fr. on the basis of morphological characteristics (2). B. cinerea was consistently isolated from symptomatic tissues. Colonies of B. cinerea on PDA were at first colorless and became gray to brown with the development of lemon-shaped conidia (average 7.5 × 9 μm). Sclerotia were black and varied in size (1.4 to 4.5 × 1.5 to 2.7 mm) and shape (2). Pathogenicity of the isolated fungus was tested by wound inoculating five mature pomegranate fruits (cv. Kampaditika) after surface sterilization with 5% sodium hypochlorite. Plugs of the fungus (5 mm in diameter) obtained from the colony margins were transferred onto a 3- × 3-mm wound on the surface of sterilized fruit. Sterile PDA plugs were used to inoculate five control pomegranate fruits. Fruit were incubated at 22°C and 80% relative humidity in the dark. Extensive decay, similar to that observed on diseased fruits in the field, was observed on inoculated fruits 7 days after inoculation, whereas control fruits showed no decay. The pathogen was reisolated from internal rotten tissues of inoculated fruit, but not from the noninoculated control fruits. Fruit rot of pomegranate caused by B. cinerea has been reported previously in the United States (1) and China (3). However, to our knowledge, this is the first report of B. cinerea causing gray mold of pomegranate in Greece. References: (1) A. M. French. California Plant Disease Host Index. Calif. Dept. Food Agric., Sacramento, 1989. (2) W. B. Hewitt. Compendium of Grape Diseases. American Phytopathological Society, 1994. (3) Z. Zhang. Flora Fungorum Sinicorum 26:277, 2006.

Download Full-text

First Report of Leaf Blight of Japanese Yew Caused by Pestalotiopsis microspora in Korea

Plant Disease ◽

10.1094/pdis-08-13-0821-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 691-691 ◽

Cited By ~ 2

Author(s):

Y. H. Jeon ◽

W. Cheon

Keyword(s):

Dna Sequences ◽

Apical Cell ◽

Morphological Characteristics ◽

Leaf Blight ◽

Economic Damage ◽

Leaf Margin ◽

Conidial Suspension ◽

First Report ◽

Pestalotiopsis Microspora ◽

Large Trees

Worldwide, Japanese yew (Taxus cuspidata Sieb. & Zucc.) is a popular garden tree, with large trees also being used for timber. In July 2012, leaf blight was observed on 10% of Japanese yew seedling leaves planted in a 500-m2 field in Andong, Gyeongsangbuk-do Province, South Korea. Typical symptoms included small, brown lesions that were first visible on the leaf margin, which enlarged and coalesced into the leaf becoming brown and blighted. To isolate potential pathogens from infected leaves, small sections of leaf tissue (5 to 10 mm2) were excised from lesion margins. Eight fungi were isolated from eight symptomatic trees, respectively. These fungi were hyphal tipped twice and transferred to potato dextrose agar (PDA) plates for incubation at 25°C. After 7 days, the fungi produced circular mats of white aerial mycelia. After 12 days, black acervuli containing slimy spore masses formed over the mycelial mats. Two representative isolates were further characterized. Their conidia were straight or slightly curved, fusiform to clavate, five-celled with constrictions at the septa, and 17.4 to 28.5 × 5.8 to 7.1 μm. Two to four 19.8- to 30.7-μm-long hyaline filamentous appendages (mostly three appendages) were attached to each apical cell, whereas one 3.7- to 7.1-μm-long hyaline appendage was attached to each basal cell, matching the description for Pestalotiopsis microspora (2). The pathogenicity of the two isolates was tested using 2-year-old plants (T. cuspidata var. nana Rehder; three plants per isolate) in 30-cm-diameter pots filled with soil under greenhouse conditions. The plants were inoculated by spraying the leaves with an atomizer with a conidial suspension (105 conidia/ml; ~50 ml on each plant) cultured for 10 days on PDA. As a control, three plants were inoculated with sterilized water. The plants were covered with plastic bags for 72 h to maintain high relative humidity (24 to 28°C). At 20 days after inoculation, small dark lesions enlarged into brown blight similar to that observed on naturally infected leaves. P. microspora was isolated from all inoculated plants, but not the controls. The fungus was confirmed by molecular analysis of the 5.8S subunit and flanking internal transcribed spaces (ITS1 and ITS2) of rDNA amplified from DNA extracted from single-spore cultures, and amplified with the ITS1/ITS4 primers and sequenced as previously described (4). Sequences were compared with other DNA sequences in GenBank using a BLASTN search. The P. microspora isolates were 99% homologous to other P. microspora (DQ456865, EU279435, FJ459951, and FJ459950). The morphological characteristics, pathogenicity, and molecular data assimilated in this study corresponded with the fungus P. microspora (2). This fungus has been previously reported as the causal agent of scab disease of Psidium guajava in Hawaii, the decline of Torreya taxifolia in Florida, and the leaf blight of Reineckea carnea in China (1,3). Therefore, this study presents the first report of P. microspora as a pathogen on T. cuspidata in Korea. The degree of pathogenicity of P. microspora to the Korean garden evergreen T. cuspidata requires quantification to determine its potential economic damage and to establish effective management practices. References: (1) D. F. Farr and A. Y. Rossman, Fungal Databases, Syst. Mycol. Microbiol. Lab. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ (2) L. M. Keith et al. Plant Dis. 90:16, 2006. (3) S. S. N. Maharachchikumbura. Fungal Diversity 50:167, 2011. (4) T. J. White et al. PCR Protocols. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

First Report of Strawberry Fruit Rot Caused by Alternaria tenuissima in Korea

Plant Disease ◽

10.1094/pdis.2001.85.5.563b ◽

2001 ◽

Vol 85 (5) ◽

pp. 563-563 ◽

Cited By ~ 5

Author(s):

H. B. Lee ◽

C.-J. Kim ◽

S. H. Yu

Keyword(s):

Fruits And Vegetables ◽

Morphological Characteristics ◽

West Germany ◽

Fruit Rot ◽

Conidial Suspension ◽

Strawberry Fruit ◽

Alternaria Tenuissima ◽

First Report ◽

The Usa ◽

Dark Green

A strawberry (Fragaria × ananassa Duch.) fruit rot disease has been observed in several vinyl-house fields at Nonsan and Taejon, Chungnam district, Korea, especially following moist and cool conditions in the spring and again in September. Over the past 7 years, incidence of the disease has ranged from 0.2 to 2.0%. Early symptoms on fruits were characterized by small, irregular lesions, which were slightly sunken and appeared light green to black in color as sporulation began. Conidia were 25 to 55 μm long by 10 to 17 μm wide; beaks, when present, were 2 to 3 μm wide and up to 40 μm long; and conidiophores were 20 to 110 μm long by 3 to 5 μm wide. Older lesions were circular, largely sunken, firm, and dark-green to almost black because of abundant sporulation. The fungus isolated from infected fruit tissues was identified as Alternaria tenuissima (Fries) Wiltshire, based on the morphological characteristics of the conidia and conidiophores. Pathogenicity tests were conducted by inoculating slightly wounded, ripe (red) and immature (green) fruits with a conidial suspension (1 × 106 conidia/ml). Twenty-four ripe and immature fruits were inoculated with each of six isolates in duplicate and placed in a moist chamber for 48 h at 25°C and then transferred to vinyl-house field. After 7 to 10 days fruit rot symptoms were visible on the inoculated fruits and appeared nearly identical to lesions observed in the field, although there were differences in aggressiveness among isolates. Control fruits sprayed with distilled water did not develop any symptoms. Green fruits were generally more resistant to infection than ripe ones. The causal fungus was easily reisolated from lesions on inoculated strawberries. Alternaria fruit rot of strawberries has been reported from the USA, UK, and West Germany (2). Howard and Albregts (1) first reported a strawberry fruit rot caused by A. tenuissima in Florida, but the disease is generally not considered important. However, occasionally losses from this disease have been extensive in Korea. To the authors' knowledge, this is the first report of strawberry fruit rot caused by Alternaria tenuissima in Korea. References: (1) C. M. Howard and E. E. Albregts. Phytopathology 63:638–639, 1973. (2) A. L. Snowdon. Pages 250–252 in: A Color Atlas of Post-Harvest Diseases and Disorders of Fruits and Vegetables. Vol. 1. 1990. Wolfe Scientific, London.

Download Full-text

First Report of Leaf Blight Caused by Septoria allii on Garlic Chives in Korea

Plant Disease ◽

10.1094/pdis-08-12-0809-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 147-147

Author(s):

J. H. Park ◽

S. E. Cho ◽

K. S. Han ◽

H. D. Shin

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Its Region ◽

Leaf Blight ◽

Plant Diseases ◽

Cultivated Plants ◽

Sequence Information ◽

Conidial Suspension ◽

Korean Society ◽

First Report

Garlic chives, Allium tuberosum Roth., are widely cultivated in Asia and are the fourth most important Allium crop in Korea. In June 2011, a leaf blight of garlic chives associated with a Septoria spp. was observed on an organic farm in Hongcheon County, Korea. Similar symptoms were also found in fields within Samcheok City and Yangku County of Korea during the 2011 and 2012 seasons. Disease incidence (percentage of plants affected) was 5 to 10% in organic farms surveyed. Diseased voucher specimens (n = 5) were deposited at the Korea University Herbarium (KUS). The disease first appeared as yellowish specks on leaves, expanding to cause a leaf tip dieback. Half of the leaves may be diseased within a week, especially during wet weather. Pycnidia were directly observed in leaf lesions. Pycnidia were amphigenous, but mostly epigenous, scattered, dark brown to rusty brown, globose, embedded in host tissue or partly erumpent, separate, unilocular, 50 to 150 μm in diameter, with ostioles of 20 to 40 μm in diameter. Conidia were acicular, straight to sub-straight, truncate at the base, obtuse at the apex, hyaline, aguttulate, 22 to 44 × 1.8 to 3 μm, mostly 3-septate, occasionally 1- or 2-septate. These morphological characteristics matched those of Septoria allii Moesz, which is differentiated from S. alliacea on conidial dimensions (50 to 60 μm long) (1,2). A monoconidial isolate was cultured on potato dextrose agar (PDA). Two isolates have been deposited in the Korean Agricultural Culture Collection (Accession Nos. KACC46119 and 46688). Genomic DNA was extracted using the DNeasy Plant Mini DNA Extraction Kit (Qiagen Inc., Valencia, CA). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1/ITS4 primers and sequenced. The resulting sequence of 482-bp was deposited in GenBank (JX531648 and JX531649). ITS sequence information was at least 99% similar to those of many Septoria species, however no information was available for S. allii. Pathogenicity was tested by spraying leaves of three potted young plants with a conidial suspension (2 × 105 conidia/ml), which was harvested from a 4-week-old culture on PDA. Control leaves were sprayed with sterile water. The plants were placed in humid chambers (relative humidity 100%) for the first 48 h. After 7 days, typical leaf blight symptoms started to develop on the leaves of inoculated plants. S. allii was reisolated from the lesions of inoculated plants, confirming Koch's postulates. No symptoms were observed on control plants. The host-parasite association of A. tuberosum and S. allii has been known only from China (1). S. alliacea has been recorded on several species of Allium, e.g. A. cepa, A. chinense, A. fistulosum, and A. tuberosum from Japan (4) and A. cepa from Korea (3). To the best of our knowledge, this is the first report of S. allii on garlic chives. No diseased plants were observed in commercial fields of garlic chives which involved regular application of fungicides. The disease therefore seems to be limited to organic garlic chive production. References: (1) P. K. Chi et al. Fungous Diseases on Cultivated Plants of Jilin Province, Science Press, Beijing, China, 1966. (2) P. A. Saccardo. Sylloge Fungorum Omnium Hucusque Congnitorum. XXV. Berlin, 1931. (3) The Korean Society of Plant Pathology. List of Plant Diseases in Korea, Suwon, Korea, 2009. (4) The Phytopathological Society of Japan. Common Names of Plant Diseases in Japan, Tokyo, Japan, 2000.

Download Full-text

First Report of Nigrospora Leaf Blight on Sesame Caused by Nigrospora sphaerica in China

Plant Disease ◽

10.1094/pdis-07-13-0684-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 842-842 ◽

Cited By ~ 3

Author(s):

H. Zhao ◽

H. Y. Liu ◽

X. S. Yang ◽

Y. X. Liu ◽

Y. X. Ni ◽

...

Keyword(s):

Morphological Characteristics ◽

Leaf Blight ◽

Morphological Data ◽

Its2 Region ◽

Oilseed Crop ◽

Conidial Suspension ◽

First Report ◽

Initial Symptoms ◽

Central Regions ◽

Leaf Pathogen

Sesame (Sesamum indicum L.) is an important oilseed crop widely grown in the central regions of China. A new leaf blight has increasingly been observed in sesame fields in Anhui, Hubei, and Henan provinces since 2010. Approximately 30 to 40% of the plants were symptomatic in the affected fields. Initial symptoms were yellow to brown, irregularly shaped lesions. Lesions later expanded and the affected leaves tuned grayish to dark brown and wilted, with a layer of whitish mycelial growth on the underside. Severe blighting caused the center of lesions to fall out, leaving holes in the leaves. Sections of symptomatic leaf tissues were surface-sterilized in 75% ethanol for 30 s, then in 1% HgCl2 for 30 s, rinsed three times in sterile distilled water, and plated onto potato dextrose agar (PDA). The resulting fungal colonies were initially white, and then became grayish-brown with sporulation. Conidia were single-celled, black, smooth, spherical, 14.2 to 19.8 μm (average 17.1 μm) in diameter, and borne on a hyaline vesicle at the tip of each conidiophore. Morphological characteristics of the isolates were similar to those of Nigrospora sphaerica (1). To verify the identification based on morphological features, the ITS1-5.8S-ITS2 region of the ribosomal RNA was amplified using ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) primers (3), and then sequenced and compared to the GenBank database through a BLAST search. Comparison of the sequence revealed 100% similarity to N. sphaerica (GenBank Accession No. JF817271.1). On the basis of morphological data and the ITS rDNA sequence, the isolate was determined to be N. sphaerica. Pathogenicity tests were conducted using fresh and healthy sesame leaves of 10 plants. A conidial suspension (106 conidia/ml) collected from a 7-day-old culture on PDA was used for inoculation. Leaves of 10 plants were spray-inoculated with the spore suspension at the 6-week-old growth stage, and an additional 10 plants were sprayed with sterile water. Inoculated plants were covered with polyethylene bags to maintain high humidity. Plants were kept at 28°C and observed for symptom every day. Ten to 15 days after inoculation, inoculated leaves developed blight symptoms similar to those observed on naturally infected leaves. No symptoms were observed on the control leaves. N. sphaerica was re-isolated from the inoculated leaves, thus fulfilling Koch's postulates. N. sphaerica has been reported as a leaf pathogen on several hosts worldwide (2). To our knowledge, this is the first report of Nigrospora leaf blight on sesame caused by N. sphaerica in China. References: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, UK, 1971. (2) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ . July 01, 2013. (3) M. A. Innis et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First report of Fusarium incarnatum causing fruit rot of litchi in China

Plant Disease ◽

10.1094/pdis-11-20-2393-pdn ◽

2021 ◽

Author(s):

Zhaoyin Gao ◽

Jiaobao Wang ◽

Zhengke Zhang ◽

Min Li ◽

Deqiang Gong ◽

...

Keyword(s):

Southern China ◽

Fusarium Species ◽

Morphological Characteristics ◽

Fruit Rot ◽

Conidial Suspension ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Litchi Fruit ◽

His3 Gene

Litchi (Litchi chinensis Sonn.) is an indigenous tropical and subtropical fruit in Southern China with an attractive appearance, delicious taste, and good nutritional value (Jiang et al. 2003). In March 2020, brown rots were observed on nearly ripe litchi fruits (cv. Guihuaxiang) in an orchard of Lingshui county, Hainan province of China (18.615877° N, 109.948871° E). About 5% fruits were symptomatic in the field, and the disease caused postharvest losses during storage. The initial infected fruits had no obvious symptoms on the outer pericarp surfaces, but appeared irregular, brown to black-brown lesions in the inner pericarps around the pedicels. Then lesions expanded and became brown rots. Small tissues (4 mm × 4 mm) of fruit pericarps were cut from symptomatic fruits, surface-sterilized in 1% sodium hypochlorite for 3 min, rinsed in sterilized water three times, plated on potato dextrose agar (PDA) and incubated at 28℃ in the darkness. Morphologically similar colonies were isolated from 85% of 20 samples after 4 days of incubation. Ten isolates were purified using a single-spore isolation method. The isolates grown on PDA had abundant, fluffy, whitish to yellowish aerial mycelia, and the reverse side of the Petri dish was pale brown. Morphological characteristics of conidia were further determined on carnation leaf-piece agar (CLA) (Leslie et al. 2006). Macroconidia were straight to slightly curved, 3- to 5-septates with a foot-shaped basal cell, tapered at the apex, 2.70 to 4.43 µm × 18.63 to 37.58 µm (3.56 ± 0.36 × 28.68 ± 4.34 µm) (n = 100). Microconidia were fusoid to ovoid, 0- to 1-septate, 2.10 to 3.57 µm × 8.18 to 18.20 µm (2.88 ± 0.34 × 11.71 ± 1.97 µm) (n = 100). Chlamydospores on hyphae singly or in chains were globose, subglobose, or ellipsoidal. Based on cultural features and morphological characteristics, the fungus was identified as a Fusarium species (Leslie et al. 2006). To further confirm the pathogen, DNA was extracted from the 7-day-old aerial mycelia of three isolates (LZ-1, LZ-3, and LZ-5) following Chohan et al. (2019). The sequences of the internal transcribed spacer region of rDNA (ITS), translation elongation factor-1 alpha (tef1) gene, and histone H3 (his3) gene were partially amplified using primers ITS1/ITS4, EF1-728F/EF1-986R, and CYLH3F/CYLH3R, respectively (Funnell-Harris et al. 2017). The nucleotide sequences were deposited in GenBank (ITS: 515 bp, MW029882, 533 bp, MW092186, and 465 bp, MW092187; tef1: 292 bp, MW034437, 262 bp, MW159143, and 292 bp, MW159141; his3: 489 bp, MW034438, 477 bp, MW159142, and 474 bp, MW159140). The ITS, tef1, and his3 genes showed 99-100% similarity with the ITS (MH979697), tef1 (MH979698), and his3 (MH979696) genes, respectively of Fusarium incarnatum (TG0520) from muskmelon fruit. The phylogenetic analysis of the tef1 and his3 gene sequences showed that the three isolates clustered with F. incarnatum. Pathogenicity tests were conducted by spraying conidial suspension (1×106 conidia/ml) on wounded young fruits in the orchid. Negative controls were sprayed with sterilized water. Fruits were bagged with polythene bags for 24 hours and then unbagged for 10 days. Each treatment had 30 fruits. The inoculated fruits developed symptoms similar to those observed in the orchard and showed light brown lesions on the outer pericarp surfaces and irregular, brown to black-brown lesions in the inner pericarps, while the fruits of negative control remained symptomless. The same fungus was successfully recovered from symptomatic fruits, and thus, the test for the Koch’s postulates was completed. F. semitectum (synonym: F. incarnatum) (Saha et al. 2005), F. oxysporum (Bashar et al. 2012), and F. moniliforme (Rashid et al. 2015) have been previously reported as pathogens causing litchi fruit rots in India and Bangladesh. To our knowledge, this is the first report of Fusarium incarnatum causing litchi fruit rot in China.

Download Full-text

First Report of Gray Mold Caused by Botrytis cinerea on Greenhouse-Grown Zucchini in Korea

Plant Disease ◽

10.1094/pdis-01-13-0005-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1116-1116 ◽

Cited By ~ 1

Author(s):

W. Cheon ◽

Y. H. Jeon

Keyword(s):

New York ◽

Botrytis Cinerea ◽

Severe Disease ◽

Morphological Characteristics ◽

Its Region ◽

Gray Mold ◽

Greenhouse Production ◽

First Report ◽

Plastic Bags ◽

Diseased Fruit

In the winter of 2011, greenhouse-grown zucchini (Cucurbita pepo) in Andong City, Korea, showed severe disease symptoms on fruits and dying leaves of zucchini plants that resembled gray mold disease with about 20% yield loss. Symptoms included extensive growth of mycelia and gray conidia on stem and fruit lesions. Lesions expanded rapidly under cool, humid conditions. As the disease progressed, leaves, stems, and fruits became necrotic and were covered by an abundant, soft, gray, sporulating mycelium. Diseased fruit tissue was excised and surface sterilized by immersion in 2% NaOCl for 1 min, placed on PDA (potato dextrose agar), and incubated at 22°C. Fungal colonies were initially white and became gray to brown after 72 h. Analysis of light micrographs showed the presence of elliptical conidia on PDA that was 7.5 to 16.0 μm long and 5 to 10.5 μm wide. In culture, a few, black, small and large irregular sclerotia were produced. Microsclerotia were round, spherical or irregular in shape, and ranged from 1.0 to 3.3 and 1.2 to 3.4 mm (width and length). Conidiophores were slender and branched with enlarged apical cells bearing smooth, ash-colored conidia. These morphological characteristics identified the fungus as Botrytis cinerea (1). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1 (forward) and ITS4 (reverse) primer set (ITS1: 5′-TCCGTAGGTGAACCTGCGG-3′, ITS4: 5′-TCCTCCGCTTATTGATATGC-3′) and sequenced (2). BLAST analysis of the PCR product showed that the sequence had 100% identity with the nucleotide sequences for B. cinerea. Pathogenicity tests were performed by placing mycelium fragments (1 cm2) of PDA cultures on zucchini fruits. Controls were treated with PDA alone. Five replicates for the inoculated and control plants were used. All fruits were covered with plastic bags and incubated in a growth chamber to maintain 90 to 100% relative humidity at 22°C. Typical symptoms appeared 2 to 6 days after inoculation. The inoculated plants developed typical gray mold symptoms with gray sporulating lesions, while controls remained healthy with no lesions. B. cinerea reisolated from the inoculated tissues was morphologically identical to the original isolates. In a cold outside (below 0°C), wet greenhouse, plants are likely to be exposed to resident Botrytis populations and if the gray mold disease occurs, it can spread on zucchini plants very fast, in 2 days to a week inside a 100 m2 greenhouse. Therefore, gray mold disease could have a significant impact on greenhouse production of zucchini. To our knowledge, this is the first report of B. cinerea causing gray mold of greenhouse-grown zucchini in Korea. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Genera of Imperfect Fungi. Burgess Publishing Company, Minneapolis, MN, 1972. (2) T. J. White et al. PCR Protocols. Academic Press, Inc., New York, 1990.

Download Full-text