First Report of Natural Infection of Greenhouse Tomatoes by Potato spindle tuber viroid in the United States

In April 2009, a large number of tomato plants (Solanum lycopersicum L.) grown in a commercial greenhouse facility near Los Angles, CA exhibited general plant stunting (short internodes) and foliar symptoms that included distortion, chlorosis, and scattered necrotic spotting. Over time, the leaves began to exhibit a purple color and curling. Diseased plants were often elongated and frail with spindly shoots. The disease resulted in a significant yield loss due to reduced fruit size. Disease symptoms described above are generally different from those of Pepino mosaic virus (PepMV) infection, which causes yellow mosaic or patches on leaves and marbling of fruits. The disease was initially localized in certain areas in a greenhouse despite using a number of cultural management efforts including vigorous scouting, roguing of diseased plants, and strict hygiene and cleaning practices. The disease was also observed in neighboring greenhouses by the spring of 2010. A standard panel of tests for common tomato viruses and viroids were conducted using the appropriate serological or PCR assays. Reverse transcription (RT) PCR analysis of nine symptomatic plants with pospiviroid-specific primers, Pospil-RE and Pospil-FW (3), produced an amplicon of the expected size (~196 bp) while three healthy looking tomato plants did not. Subsequently, full viroid genomic sequences were obtained through RT-PCR with primer sets specific for Potato spindle tuber viroid (PSTVd), 3H1/2H1 (2), as well as for the pospiviroid genus, MTTVd-F and MTTVd-R (1). Sequences obtained from direct sequencing of amplicons or cloned PCR products from one isolate were identical and consisted of a full viroid genome of 358 nt, which was named PSTVd-CA1 (GenBank Accession No. HM753555). BLASTn queries of the NCBI database showed that this isolate had a high sequence identity (98%) to other PSTVd isolates (i.e., EF044304, X52037, and Y09577). The disease was reproducible upon mechanical transmission (1) on three tomato ‘Moneymaker’ plants, which expressed symptoms that were similar to those on the source plants. Recovery of PSTVd on the inoculated tomato plants was confirmed by RT-PCR and sequencing. Because of its susceptibility to viroid infection, tomato ‘Moneymaker’ plants are commonly used as indicators for the study of pospiviroids, including PSTVd. Natural PSTVd infection on greenhouse tomatoes has been reported in Europe (3) and New Zealand. Although a number of reports in the United States have been published on naturally occurring PSTVd infections of potatoes, to our knowledge, this is the first report of a natural PSTVd infection on tomatoes in the United States. The exact source of the PSTVd inoculum in the current disease outbreak is unknown, but it could have been introduced from infected potato or ornamental plants (4) or through infected tomato seeds. The disease epidemic might have been enhanced by frequent hands-on activities in greenhouse tomato production and the environmental conditions (high temperature and intense lighting) in the greenhouse that favor symptom expression. References: (1) K.-S. Ling and W. Zhang, Plant Dis. 93:1216, 2009. (2). A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (3) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004. (4) J. Th. J. Verhoeven et al. Plant Pathol. 59:3, 2010.

Download Full-text

First Report of Pelargonium zonate spot virus from Tomato in the United States

Plant Disease ◽

10.1094/pdis-91-5-0633b ◽

2007 ◽

Vol 91 (5) ◽

pp. 633-633 ◽

Cited By ~ 8

Author(s):

H.-Y. Liu ◽

J. L. Sears

Keyword(s):

United States ◽

The United States ◽

Rt Pcr ◽

Spot Virus ◽

Chenopodium Amaranticolor ◽

Tomato Plants ◽

First Report ◽

Chenopodium Murale ◽

Tomato Field ◽

Infected Tomato

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

Download Full-text

First Report of Potato spindle tuber viroid in Tomato in Belgium

Plant Disease ◽

10.1094/pdis-91-8-1055a ◽

2007 ◽

Vol 91 (8) ◽

pp. 1055-1055 ◽

Cited By ~ 13

Author(s):

J. Th. J. Verhoeven ◽

C. C. C. Jansen ◽

J. W. Roenhorst ◽

S. Steyer ◽

D. Michelante

Keyword(s):

Potato Spindle Tuber Viroid ◽

Growth Reduction ◽

Rt Pcr ◽

Tomato Plants ◽

Final Destination ◽

The United Kingdom ◽

Pcr Product ◽

Viroid Infection ◽

Young Leaves ◽

Plant Pathol

During August of 2006, a sample of a tomato plant (Solanum lycopersicum, formerly Lycopersicum esculentum) from a greenhouse in Belgium was received for diagnosis. The plant showed severe growth reduction and the young leaves were chlorotic and distorted. In the greenhouse, the disease had been spreading slowly along the row. These observations suggested the presence of a viroid infection, and reverse transcriptase (RT)-PCR with two sets of universal pospiviroid primers (Pospi1-RE/FW and Vid-FW/RE; 3) yielded amplicons of the expected size (approximately 196 and 360 bp). Sequence analysis of the larger PCR product revealed that the genome was 358 nt and 100% identical to two isolates of Potato spindle tuber viroid (PSTVd) previously submitted to the NCBI GenBank (Accession Nos. AJ583449 from the United Kingdom and AY962324 from Australia). A pathogen associated with the symptomatic tomato plants was therefore identified as PSTVd. Tracing the origin of the infection revealed the following information: during November of 2005, 8-day-old tomato seedlings raised from seed by a Dutch nursery were transferred to a small part of the greenhouse of the Belgian grower; 7 to 8 weeks later, the plants were transplanted to their final destination; during May of 2006, the grower first observed growth reduction in a single plant; several weeks later, similar symptoms were observed in two more plants in the same row close to the first symptomatic plant; and by September, there were approximately 20 symptomatic tomato plants, all located in two adjacent rows. The viroid outbreak was fully eradicated by destroying all tomato plants in the affected rows as well as in two adjacent rows at both sides. The absence of further infections was confirmed by testing approximately 1,200 tomato plants in pooled samples for PSTVd by RT-PCR (2) and real-time RT-PCR (1). The origin and the method of introduction and spread of the viroid remain unclear. References: (1) N. Boonham et al. J. Virol. Methods 116:139, 2004. (2) R. A. Mumford et al. Plant Pathol. 53:242, 2004. (3) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

Download Full-text

First Report of Turnip mosaic virus Infecting Brassica carinata (Ethiopian Mustard) in the United States

Plant Disease ◽

10.1094/pdis-05-13-0500-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1664-1664 ◽

Cited By ~ 3

Author(s):

B. Babu ◽

H. Dankers ◽

S. George ◽

D. Wright ◽

J. Marois ◽

...

Keyword(s):

United States ◽

Mosaic Virus ◽

The United States ◽

Turnip Mosaic Virus ◽

Brassica Carinata ◽

Rt Pcr ◽

First Report ◽

Ethiopian Mustard ◽

Plant Pathol ◽

Pcr Assays

Brassica carinata L. Braun (Ethiopian mustard) is an annual oil seed crop currently being evaluated for its potential use as a source of biofuel. Due to its high content of erucic acid, it provides a biodegradable non-fossil fuel feedstock that has many applications ranging from biofuels to other industrial uses such as polymers, waxes, and surfactants. Moreover, high glucosinolate content adds the scope of B. carinata being used as a bio-fumigant. B. carinata is amenable to low input agriculture and has great economic potential to be used as a winter crop, especially in the southeastern United States. Virus-like leaf symptoms including mosaic, ringspot, mottling, and puckering were observed on B. carinata (cvs. 080814 EM and 080880 EM) in field trials at Quincy, FL, during spring 2013, with disease incidence of >80%. A more extensive survey of the same field location indicated that mosaic symptoms were the most common. Viral inclusion assays (1) of leaves with a range of symptoms indicated the presence of potyvirus-like inclusion bodies. Total RNA extracts (RNeasy Plant Mini Kit, Qiagen Inc., Valencia, CA) from six symptomatic samples and one non-symptomatic B. carinata sample were subjected to reverse transcription (RT)-PCR assays using SuperScript III One-Step RT-PCR System (Invitrogen, Life Technologies, NY), and two sets of potyvirus-specific degenerate primers MJ1-F and MJ2-R (2) and NIb2F and NIb3R (3), targeting the core region of the CP and NIb, respectively. The RT-PCR assays using the CP and NIb specific primers produced amplicons of 327 bp and 350 bp, respectively, only in the symptomatic leaf samples. The obtained amplicons were gel-eluted and sequenced directly (GenBank Accession Nos. KC899803 to KC899808 for CP and KC899809 to KC899813 for NIb). BLAST analysis of these sequences revealed that they came from Turnip mosaic virus (TuMV). Pairwise comparisons of the CP (327 bp) and NIb (350 bp) segments revealed 98 to 99% and 96 to 98% nucleotide identities, respectively, with corresponding sequences of TuMV isolates. These results revealed the association of TuMV with symptomatic B. carinata leaf samples. Although TuMV has been reported from B. carinata in Zambia (4), this is the first report of its occurrence on B. carinata in the United States. Considering the importance of B. carinata as a biofuel source, this report underscores the need for developing effective virus management strategies for the crop. References: (1) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986. (2) M. Grisoni et al. Plant Pathol. 55:523, 2006. (3) L. Zheng et al. Plant Pathol. 59:211, 2009. (4) D. S. Mingochi and A. Jensen. Acta Hortic. 218:289, 1988.

Download Full-text

First Report of Potato spindle tuber viroid Naturally Infecting Greenhouse Tomatoes in North Carolina

Plant Disease ◽

10.1094/pdis-07-12-0679-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 148-148 ◽

Cited By ~ 11

Author(s):

K.-S. Ling ◽

R. Li ◽

D. R. Panthee ◽

R. G. Gardner

Keyword(s):

North Carolina ◽

Real Time ◽

Potato Spindle Tuber Viroid ◽

Seed Sample ◽

Rt Pcr ◽

Tomato Plants ◽

First Report ◽

Viroid Infection ◽

Leaf Tissues ◽

The U.S

In spring 2012, a severe disease was observed on a limited number of tomato plants (Solanum lycopersicum L.) in a research greenhouse facility in western North Carolina. The first symptoms noted were downward curling of the terminal leaves accompanied by a rough puckered darker green texture. This was followed in time by greater distortion of the leaves with pale green on leaf margins. Older leaves with symptoms developed necrosis, with necrotic spots and streaks appearing on a few fruits. On some of these affected fruits, stems, peduncles, pedicels, and sepals also showed symptoms. Infected plants were badly stunted, and fruits in the upper parts of plants displaying severe symptoms remained very small. In just a few months, the disease spread to other tomato plants inside the greenhouse. A survey in May 2012 showed a disease incidence of 18% (156 symptomatic plants out of a total of 864) in this greenhouse. Initial screenings for possible viruses using ELISA (Agdia, Elkhart, IN), as well as a reverse transcription (RT)-PCR panel of 15 common tomato viruses in our laboratory were negative. Because of the symptoms and negative results for viruses, a viroid infection was suspected. Total plant RNA was prepared using TRIzol reagent (Invitrogen, Carlsbad, CA) from leaf tissues of eight diseased plants and one seed sample. Using real-time RT-PCR developed against Potato spindle tuber viroid (PSTVd) and some related pospiviroids (1), positive signals were observed with a mean Ct = 13.24 for leaf tissues and Ct = 19.91 for the seed sample. To obtain a full viroid genome, RT-PCR using two different sets of primers, one specific for PSTVd (PSTVd-F and PSTVd-R) (2), and a universal primer set for pospiviroids (MTTVd-F and MTTVd-R) (3) was performed. RT-PCR generated amplicons with expected size of ~360 bp from all eight leaf and one seed samples, but not from a healthy control. PCR products were cloned using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA). A total of 22 full genomic sequences were obtained. A multi-sequence alignment generated a consensus sequence of 360 nt, designated as NC12-01 (GenBank Accession No. JX280944). BLASTn search in the NCBI database revealed the highest sequence identity of 96.9% to Australian (AY962324) and UK (AJ583449) isolates of PSTVd and 95.9% identity to the tomato isolate of PSTVd-CA1 (HM753555). Similar disease symptoms were observed on two ‘Rutgers’ tomato plants 2 weeks post mechanical inoculation and the presence of PSTVd was confirmed by real-time RT-PCR (1). A mock-inoculated plant did not show any symptoms. In the U.S., natural infection of PSTVd on tomato was first identified in California in 2010 (3). To our knowledge, this is the first report of a natural occurrence of PSTVd on tomato in the eastern U.S. The diseased plants were contained, properly disposed of, and eradicated in this location. The broader geographic distribution of PSTVd on tomato in the U.S., and the potential latent infection in potato and a number of ornamentals (4), emphasizes the need for better plant and seed health tests for viroids on these plants. References: (1) N. Boonham et al. J. Virol. Methods 116:139, 2004. (2) H. Bostan et al. J. Virol. Methods 116:189, 2004. (3) K.-S. Ling and D. Sfetcu. Plant Dis. 94:1376, 2010. (4) R. A. Owens and J. Th. J. Verhoeven. The Plant Health Instructor. DOI: 10.1094/PHI-I-2009-0804-01, 2009.

Download Full-text

First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic

Plant Disease ◽

10.1094/pdis-09-13-0992-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 701-701

Author(s):

K.-S. Ling ◽

R. Li ◽

D. Groth-Helms ◽

F. M. Assis-Filho

Keyword(s):

United States ◽

Dominican Republic ◽

Mosaic Virus ◽

Potato Spindle Tuber Viroid ◽

The United States ◽

Disease Outbreak ◽

Ringspot Virus ◽

Rt Pcr ◽

Spot Virus ◽

Three Samples

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.

Download Full-text

First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽

10.1094/pdis-05-21-0917-pdn ◽

2021 ◽

Author(s):

Gardenia Orellana ◽

Alexander V Karasev

Keyword(s):

United States ◽

Leaf Tissue ◽

The United States ◽

Universal Primers ◽

Rt Pcr ◽

Universal Primer ◽

Tissue Samples ◽

First Report ◽

Specific Pcr ◽

Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

Download Full-text

Molecular Characterization of Recombinant Strains of Potato virus Y From Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-15-0562-re ◽

2016 ◽

Vol 100 (2) ◽

pp. 292-297 ◽

Cited By ~ 14

Author(s):

Mohamad Chikh-Ali ◽

Hayam Alruwaili ◽

Dalton Vander Pol ◽

Alexander V. Karasev

Keyword(s):

United States ◽

Saudi Arabia ◽

Seed Potato ◽

Potato Virus ◽

Potato Virus Y ◽

The United States ◽

Tuber Quality ◽

Rt Pcr ◽

First Report ◽

Recombinant Strains

Potato virus Y (PVY) exists as a complex of strains, many of which are recombinants. The practical importance of PVY recombinant strains has increased due to their ability to induce potato tuber necrotic ring spot disease (PTNRD) that seriously affects tuber quality. In Saudi Arabia, potato production has increased fivefold during the last three decades, reaching 460,000 tons per year. Although PVY has been reported as one of the main viruses affecting potatoes, no information is available on PVY strains circulating in the country. In August 2014, a survey was conducted in a seed potato field at Al-Jouf, Saudi Arabia. PVY-positive samples selected based on visual symptoms and serological reactivity were subjected to strain typing using multiplex RT-PCR assays and were determined to represent recombinant PVY strains. Whole genome sequences were determined for two representative isolates, S2 and S9, through direct sequencing of a series of overlapping RT-PCR fragments for each isolate, and found to represent strains PVY-NE11 and PVYZ (SYR-III), respectively. One of the recombinant types, SYR-III, was previously found in nearby Syria and Jordan, but the second recombinant, PVY-NE11, was found before only in the United States. Both recombinants, PVY-NE11 and SYR-III, were previously found associated with PTNRD and thought to be rare. The current identification of PVY-NE11 and SYR-III in seed potato in a new geographic region suggests that these recombinants may not be as rare as previously believed. This is the first report on the occurrence of recombinant strains of PVY in potato in Saudi Arabia, and the first report on the PVY-NE11 strain of PVY found in potato outside of the United States.

Download Full-text

First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States

Plant Disease ◽

10.1094/pdis-91-4-0463c ◽

2007 ◽

Vol 91 (4) ◽

pp. 463-463 ◽

Cited By ~ 6

Author(s):

I. E. Tzanetakis ◽

J. D. Postman ◽

R. R. Martin

Keyword(s):

United States ◽

The United States ◽

Ringspot Virus ◽

Tobacco Streak Virus ◽

Rapid Decline ◽

Streak Virus ◽

Black Raspberry ◽

Rt Pcr ◽

Indicator Plants ◽

First Report

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5′-GTTTCCTGTGCTCCTCA-3′) and R (5′-GTCACACCGAGGTACT-3′) (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

Download Full-text

First Report of Iris yellow spot virus in Commercial Leek (Allium porrum) in the United States

Plant Disease ◽

10.1094/pd-91-0113b ◽

2007 ◽

Vol 91 (1) ◽

pp. 113-113 ◽

Cited By ~ 5

Author(s):

H. F. Schwartz ◽

K. Otto ◽

H. R. Pappu

Keyword(s):

United States ◽

The United States ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Allium Porrum ◽

Rt Pcr ◽

Spot Virus ◽

Disease Symptoms ◽

First Report

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has a wide host range, with onion (Allium cepa L.) being one of the most economically important hosts. IYSV has been widely reported from this species throughout most onion-production regions of the United States and many areas of the world in recent years. A relative of onion, leek (Allium porrum L.), has been reported to be a host of IYSV in countries such as the Netherlands, Reunion Island, and Australia (1,4). A related tospovirus, Tomato spotted wilt virus (TSWV), was recently reported causing necrotic lesions and extended bleaching of leaf tips of leek in Georgia (2). In September of 2006, disease symptoms suspected to be caused by IYSV were observed on central and outer leaves of plants in a 2.6-ha section of commercial leeks being grown from seed (cvs. Tadorna and King Richard). The leek plants were adjacent to a 3.1-ha section of seeded onion (cv. Exacta) that had been harvested 2 weeks earlier. Twenty-five to thirty percent of unharvested onion plants next to the leek section also exhibited IYSV-type disease symptoms generally on the central leaves. Both Allium spp. were seeded 5 months earlier and grown under certified organic, pivot-irrigated conditions in Larimer County in northern Colorado. Disease symptoms on leek and onion leaves appeared as dry, white-to-straw-colored, spindle- or diamond-shaped lesions that ranged in size from 5 to 10 × 25 to 50 mm or larger depending on lesion age. Lesion centers, especially on leek, often had green centers with concentric rings of alternating green and straw-colored tissue. Green tissue near necrotic lesions of a single symptomatic leaf from 10 plants each of leek and onion was sampled and analyzed using a double-antibody sandwich (DAS)-ELISA (Agdia, Inc., Elkhart, IN). Five of ten leek and nine of ten onion samples were positive for IYSV. Using reverse transcription (RT)-PCR and primers specific to the small RNA of IYSV (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′), the complete nucleocapsid (N) gene was amplified from symptomatic leek plants and then sequenced (3). Comparisons with IYSV N gene sequences available in the GenBank confirmed the identity of the virus as IYSV. Leek samples were negative for TSWV when tested by RT-PCR with TSWV-specific primers. In addition, three specimens of the presumed thrips vector recovered from five IYSV-infected leek plants were identified as Thrips tabaci (L. A. Mahaffey and W. S. Cranshaw, personal communication). Earlier in the season, T. tabaci was observed in the nearby planting of onion that also exhibited IYSV in September. To our knowledge, this is the first report of natural infection of commercial leek with IYSV in the United States. The incidence of plants (25 to 30%) with foliar lesions on multiple leaves and stunting of 5% of infected plants in both leek cultivars suggests that IYSV could seriously reduce leek stem development and marketability. References: (1) I. Cortes et al. Phytopathology 88:1276, 1998. (2) C. Nischwitz et al. Plant Dis. 90:525, 2006. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.

Download Full-text

First Report of Barley virus G in the United States and California

Plant Disease ◽

10.1094/pdis-03-21-0478-pdn ◽

2021 ◽

Author(s):

Anna Christine Erickson ◽

Bryce Falk

Keyword(s):

United States ◽

Viral Genome ◽

The United States ◽

Full Length ◽

Yellow Dwarf ◽

Rt Pcr ◽

First Report ◽

Query Coverage ◽

Full Length Sequence ◽

The U.S

Barley (Hordeum vulgare) is a valuable annual cereal crop grown widely throughout the United States and the world. The majority of barley grown commercially in California and throughout the U.S. is used for livestock feed, with the remainder being used by the malting industry and, to a lesser extent, direct food consumption; it is also often employed as a cover crop (Lazicki et al. 2016). Yellow dwarf viruses (YDVs), in the family Luteoviridae, that infect barley and other cereal crops are common and widely distributed throughout California and the U.S. (Griesbach et al. 1989; Seabloom et al. 2009). In April 2018, five barley samples exhibiting typical symptoms of YDV infection (primarily yellowing of leaf margins and tips) collected from fields in Yolo county planted with cultivar Butta 12 , were tested for viruses. Total RNA was extracted from leaf tissue using Trizol reagent, according to the manufacturer’s protocol. RNA was used as template in a multiplexed RT-PCR assay designed for the generic detection of barley and cereal infecting YDVs, using the protocol established by Malmstrom and Shu (2004). A 372 basepair amplicon indicative of Polerovirus infection was amplified from two of the samples and sequenced (Quintara Biosciences), and the resulting data analyzed via a BLASTn search. No further testing or work was done with the three samples that tested negative. Not unexpectedly, the top result returned for one of the positive samples was Cereal yellow dwarf virus-RPV (CYDV-RPV; 98% identity), a virus common to cereals in California and the U.S.. Unexpectedly, however, the top result returned for the other sample was Barley virus G (BVG), sharing 98.43% identity with the Uiseong BVG isolate (GenBank accession LC259081). To further confirm the presence of BVG in the sample, the full-length viral genome was amplified using two-step RT-PCR with primers targeting the extreme 5’ and 3’ ends of the viral genome, using the PrimeScript RT and PrimeSTAR GXL DNA Polymerase kits (Takara Bio), cloned into the binary vector pJL89 and a BLAST search of the resulting 5621 nucleotide full-length sequence (100% query coverage) once again returned results showing the YDV to be BVG. The full-length sequence was deposited into GenBank (MW853785). Nucleotide sequence comparisons showed that the CA BVG isolate shares 96.62%, 96.57%, and 96.02% identity with the sequences of the BVG-Gimje (KT962089), BVG-Uiseong (LC259081), and BVG-Aus8 (LC500836) isolates, respectively. To our knowledge, this is the first report of barley virus G in California and in the United states. Currently the prevalence, host range and mode and timing of introduction of BVG in California and the U.S. are unknown; its impact on cereal production and yield in any location in which it has been identified thus far is also unknown and may warrant further investigation.

Download Full-text