First Report of Potato spindle tuber viroid in Tomato in Belgium

During August of 2006, a sample of a tomato plant (Solanum lycopersicum, formerly Lycopersicum esculentum) from a greenhouse in Belgium was received for diagnosis. The plant showed severe growth reduction and the young leaves were chlorotic and distorted. In the greenhouse, the disease had been spreading slowly along the row. These observations suggested the presence of a viroid infection, and reverse transcriptase (RT)-PCR with two sets of universal pospiviroid primers (Pospi1-RE/FW and Vid-FW/RE; 3) yielded amplicons of the expected size (approximately 196 and 360 bp). Sequence analysis of the larger PCR product revealed that the genome was 358 nt and 100% identical to two isolates of Potato spindle tuber viroid (PSTVd) previously submitted to the NCBI GenBank (Accession Nos. AJ583449 from the United Kingdom and AY962324 from Australia). A pathogen associated with the symptomatic tomato plants was therefore identified as PSTVd. Tracing the origin of the infection revealed the following information: during November of 2005, 8-day-old tomato seedlings raised from seed by a Dutch nursery were transferred to a small part of the greenhouse of the Belgian grower; 7 to 8 weeks later, the plants were transplanted to their final destination; during May of 2006, the grower first observed growth reduction in a single plant; several weeks later, similar symptoms were observed in two more plants in the same row close to the first symptomatic plant; and by September, there were approximately 20 symptomatic tomato plants, all located in two adjacent rows. The viroid outbreak was fully eradicated by destroying all tomato plants in the affected rows as well as in two adjacent rows at both sides. The absence of further infections was confirmed by testing approximately 1,200 tomato plants in pooled samples for PSTVd by RT-PCR (2) and real-time RT-PCR (1). The origin and the method of introduction and spread of the viroid remain unclear. References: (1) N. Boonham et al. J. Virol. Methods 116:139, 2004. (2) R. A. Mumford et al. Plant Pathol. 53:242, 2004. (3) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

Download Full-text

First Report of Natural Infection of Greenhouse Tomatoes by Potato spindle tuber viroid in the United States

Plant Disease ◽

10.1094/pdis-07-10-0516 ◽

2010 ◽

Vol 94 (11) ◽

pp. 1376-1376 ◽

Cited By ~ 9

Author(s):

K.-S. Ling ◽

D. Sfetcu

Keyword(s):

United States ◽

Potato Spindle Tuber Viroid ◽

The United States ◽

Mechanical Transmission ◽

Rt Pcr ◽

Tomato Plants ◽

First Report ◽

Viroid Infection ◽

Plant Pathol ◽

Greenhouse Tomatoes

In April 2009, a large number of tomato plants (Solanum lycopersicum L.) grown in a commercial greenhouse facility near Los Angles, CA exhibited general plant stunting (short internodes) and foliar symptoms that included distortion, chlorosis, and scattered necrotic spotting. Over time, the leaves began to exhibit a purple color and curling. Diseased plants were often elongated and frail with spindly shoots. The disease resulted in a significant yield loss due to reduced fruit size. Disease symptoms described above are generally different from those of Pepino mosaic virus (PepMV) infection, which causes yellow mosaic or patches on leaves and marbling of fruits. The disease was initially localized in certain areas in a greenhouse despite using a number of cultural management efforts including vigorous scouting, roguing of diseased plants, and strict hygiene and cleaning practices. The disease was also observed in neighboring greenhouses by the spring of 2010. A standard panel of tests for common tomato viruses and viroids were conducted using the appropriate serological or PCR assays. Reverse transcription (RT) PCR analysis of nine symptomatic plants with pospiviroid-specific primers, Pospil-RE and Pospil-FW (3), produced an amplicon of the expected size (~196 bp) while three healthy looking tomato plants did not. Subsequently, full viroid genomic sequences were obtained through RT-PCR with primer sets specific for Potato spindle tuber viroid (PSTVd), 3H1/2H1 (2), as well as for the pospiviroid genus, MTTVd-F and MTTVd-R (1). Sequences obtained from direct sequencing of amplicons or cloned PCR products from one isolate were identical and consisted of a full viroid genome of 358 nt, which was named PSTVd-CA1 (GenBank Accession No. HM753555). BLASTn queries of the NCBI database showed that this isolate had a high sequence identity (98%) to other PSTVd isolates (i.e., EF044304, X52037, and Y09577). The disease was reproducible upon mechanical transmission (1) on three tomato ‘Moneymaker’ plants, which expressed symptoms that were similar to those on the source plants. Recovery of PSTVd on the inoculated tomato plants was confirmed by RT-PCR and sequencing. Because of its susceptibility to viroid infection, tomato ‘Moneymaker’ plants are commonly used as indicators for the study of pospiviroids, including PSTVd. Natural PSTVd infection on greenhouse tomatoes has been reported in Europe (3) and New Zealand. Although a number of reports in the United States have been published on naturally occurring PSTVd infections of potatoes, to our knowledge, this is the first report of a natural PSTVd infection on tomatoes in the United States. The exact source of the PSTVd inoculum in the current disease outbreak is unknown, but it could have been introduced from infected potato or ornamental plants (4) or through infected tomato seeds. The disease epidemic might have been enhanced by frequent hands-on activities in greenhouse tomato production and the environmental conditions (high temperature and intense lighting) in the greenhouse that favor symptom expression. References: (1) K.-S. Ling and W. Zhang, Plant Dis. 93:1216, 2009. (2). A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (3) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004. (4) J. Th. J. Verhoeven et al. Plant Pathol. 59:3, 2010.

Download Full-text

First Report of Tomato apical stunt viroid in the Symptomless Hosts Lycianthes rantonnetii and Streptosolen jamesonii in the Netherlands

Plant Disease ◽

10.1094/pdis-94-6-0791a ◽

2010 ◽

Vol 94 (6) ◽

pp. 791-791 ◽

Cited By ~ 11

Author(s):

J. Th. J. Verhoeven ◽

M. Botermans ◽

C. C. C. Jansen ◽

J. W. Roenhorst

Keyword(s):

The Netherlands ◽

Reverse Transcription ◽

Ornamental Plants ◽

Sequence Variant ◽

Growth Reduction ◽

Rt Pcr ◽

Tomato Plants ◽

Stunt Viroid ◽

Two Samples ◽

Plant Pathol

In 2009, in the framework of surveying for pospiviroids, samples of various ornamental plants from the Netherlands were tested by reverse transcription (RT)-PCR with the primer pairs Pospi1-RE/FW and Vid-RE/FW (2). With primer pair Pospi1-RE/FW, amplicons of the expected size were obtained in two samples of symptomless plants of Lycianthes rantonnetii and Streptosolen jamesonii. Sequencing of the amplicons, which were expected to correspond with partial pospiviroid genomes, showed identities of 100 and 98% to the sequence of Tomato apical stunt viroid (TASVd), NCBI GenBank Accession No. AM777161 (3). For the amplification of the complete viroid genomes, RT-PCRs were performed with primer pair CEVd-FW/RE (1). Sequencing of these amplicons yielded sequences of 364 nt and identities to TASVd AM777161 of 100 and 98.1%, respectively. Therefore, both isolates were identified as TASVd. The sequence variant from S. jamesonii was submitted to the NCBI GenBank as No. GU911351. In addition, both isolates were mechanically inoculated to four tomato plants (Solanum lycopersicum) of cv. Moneymaker. All inoculated plants developed chlorosis and growth reduction after 4 weeks and TASVd infections were confirmed in a bulked sample by RT-PCR with primer pair CEVd-FW/RE after 6 weeks. Hence, two more ornamental host plant species have been identified that may act as symptomless sources of pospiviroid inoculum. References: (1) N. Önelge. Turk. J. Agric. For. 21:419, 1997. (2) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004. (3) J. Th. J. Verhoeven et al. Plant Dis. 92:973, 2008.

Download Full-text

First Report of Potato spindle tuber viroid in Cape Gooseberry (Physalis peruviana) from Turkey and Germany

Plant Disease ◽

10.1094/pdis-93-3-0316a ◽

2009 ◽

Vol 93 (3) ◽

pp. 316-316 ◽

Cited By ~ 18

Author(s):

J. Th. J. Verhoeven ◽

M. Botermans ◽

J. W. Roenhorst ◽

J. Westerhof ◽

E. T. M. Meekes

Keyword(s):

Potato Spindle Tuber Viroid ◽

Rt Pcr ◽

Physalis Peruviana ◽

Source Of Infection ◽

Pcr Product ◽

Pcr Products ◽

Mother Plants ◽

Tomato Chlorotic Dwarf Viroid ◽

Plant Pathol ◽

Cape Gooseberry

Since the recent identification of Potato spindle tuber viroid (PSTVd) in vegetatively propagated ornamental plant species (4), many growers have asked to have their mother plants tested for this viroid. In December of 2007, a grower from Turkey submitted cuttings of cape gooseberry (Physalis peruviana) to be tested for PSTVd. Initial testing by real-time reverse transcription (RT)-PCR according to Boonham et al. (1) indicated the presence of either Mexican papita viroid, PSTVd, or Tomato chlorotic dwarf viroid in four samples. To identify the viroid(s) present, isolated RNA from these samples was used for RT-PCR (2), and products of the expected full genome size for the three viroids were amplified from each sample. One of the PCR products was sequenced (GenBank Accession No. EU862230) and analysis of the 357 nt sequence indicated it was most related to PSTVd sequences belonging to the so-called ‘Oceanian’ strain of the viroid (3), with 99.7% identity to GenBank Accession No. AY962324. Therefore, the viroid was identified as PSTVd. Pathogenicity of this PSTVd genotype was demonstrated when 4 weeks after mechanical inoculation with sap extracts seedlings of tomato cv. Money-maker showed the expected viroid symptoms of chlorosis and stunting, and the presence of the viroid in these plants was confirmed by RT-PCR (2). In March of 2008, by use of RT-PCR (2) and sequencing of the PCR product (GenBank Accession No. EU862231), PSTVd was identified in young seedlings of P. peruviana from a German grower. The German isolate differed at only three nucleotide positions from the Turkish isolate. The identification of PSTVd in young seedlings indicates that seeds had been source of infection, whereas in the case of the PSTVd infected cuttings from Turkey, the infection originated from infected mother plants. To our knowledge, these are the first reports of PSTVd in P. peruviana. Although infected P. peruviana plants did not show symptoms, they might act as sources of inoculum for crops like potato and tomato, which may suffer serious damage. References: (1) N. Boonham et al. J. Virol. Methods 116:139, 2004. (2) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (3) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004. (4) J. Th. J. Verhoeven et al. Plant Pathol. 57:399, 2008.

Download Full-text

First Reports of Potato spindle tuber viroid on Solanum jasminoides and of Tomato apical stunt viroid on Solanum rantonnetti in Poland

Plant Disease ◽

10.1094/pdis-04-13-0382-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1663-1663 ◽

Cited By ~ 2

Author(s):

E. Hennig ◽

J. Pięcińska ◽

N. Borodynko ◽

B. Hasiów-Jaroszewska

Keyword(s):

Rna Extraction ◽

Ornamental Plants ◽

Pcr Amplification ◽

Potato Spindle Tuber Viroid ◽

Positive Sample ◽

Rt Pcr ◽

Specific Primer ◽

Tomato Plants ◽

Stunt Viroid ◽

Pcr Product

Potato spindle tuber viroid (PSTVd) has a quarantine status in the EU whereas Tomato apical stunt viroid (TASVd) is listed in the EPPO Alert list. During 2007 to 2012 surveys for the presence of PSTVd in 299 ornamental plants of the family Solanaceae (including Solanum jasminoides, S. rantonnetti, Brugmansia sp. and Petunia sp.) were carried out in Poland. The availability of a Pospiviroid genus-specific primer pair (1), which allows for the detection of the most prevalent viroids in ornamental plants by RT-PCR, has facilitated surveys of ornamental plants for pospiviroids. Fifteen S. rantonnetti and twenty-one S. jasminoides plants were sampled randomly and tested. Samples originated from seven different Polish provinces. Total RNA extraction was performed from plant leaves using Master Pure RNA Purification Kit (Epicentre). The obtained RNAs were further used for RT-PCR amplification using SuperScript One-Step RT-PCR System with PlatinumTaq DNA Polymerase (Invitrogen) kit according to the manufacturer's instructions. The Pospiviroid genus-specific primer set Vir1 5′CTTCAGTTGTTTCCACCGGGTAG 3′ /Vir2 5′TTCCTGTGGTGCACTCCTGACC 3′ (1), was used to amplify a 262-bp RT-PCR product. In addition, three positive samples were tested using PSTVd specific primers 3H1 5′ ATCCCCGGGGAAACCTGGAGCGAAC3′ /2H1 5′CCCTGAAGCGCTCCTCCGAG 3′ (2,4) that amplified the 360-bp product. The presence of RT-PCR products of the expected size was confirmed in two S. jasminoides samples using both primer pairs. One positive sample of S. jasminoides in the testing season 2007/2008 was collected in Zachodniopomorskie Province. The second sample was collected in 2009 in the Lubuskie region. The obtained products were cloned into pGEM-Teasy vector and sequenced using M13F and M13R primers. The sequence comparison using MEGA5 software (3) revealed that both isolates were identical to each other and shared 98 to 100% sequence identity with other PSTVd isolates described to date. The obtained sequence was deposited in the GenBank database (Accession No. KC707563). In addition, in 20 samples of Solanaceae spp. collected in 2012, the presence of an RT-PCR product of 262 bp, typical for Pospiviroids, was shown in one sample of S. rantonnetti collected in Lubuskie Province. Sequencing of the PCR product identified TASVd, and the sequence has been deposited in GenBank (KC707564). Sap derived from PSTVd- and TASVd-positive samples was used to mechanically inoculate tomato plants (variety Moneymaker). In total, 25 plants were inoculated with PSTVd and 25 with TASVd. After 3 weeks, most of the tomato plants displayed growth reduction and distortion. Inoculated tomato plants were sampled and tested by RT-PCR for the presence of viroids and all obtained products were subjected to sequencing. The obtained sequences were identical with original ones. The viroids detected in the two Solanum sp. appeared to be efficiently transmitted to tomato, as 80% of the inoculated plants tested positive by RT-PCR. These results suggest that ornamental plants might act as a source of inocula for tomato or potato crops even if they do not display any visible symptoms. TASVd-infected S. rantonnetti was introduced to Poland from the Netherlands, while the origin of the PSTVd positive S. jasminoides is uncertain. Official eradication measures were imposed due to the detection of viroids in ornamental plants in Poland. References: (1) R. A. Mumford et al. OEPP/EPPO Bulletin 30:431, 2000. (2) OEPP/EPPO Bulletin PM 7/33(1), 34:257, 2004. (3) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (4) H. L. Weidemann and U. Buchta. Potato Res. 41:1, 1998.

Download Full-text

First Report of Potato spindle tuber viroid Naturally Infecting Greenhouse Tomatoes in North Carolina

Plant Disease ◽

10.1094/pdis-07-12-0679-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 148-148 ◽

Cited By ~ 11

Author(s):

K.-S. Ling ◽

R. Li ◽

D. R. Panthee ◽

R. G. Gardner

Keyword(s):

North Carolina ◽

Real Time ◽

Potato Spindle Tuber Viroid ◽

Seed Sample ◽

Rt Pcr ◽

Tomato Plants ◽

First Report ◽

Viroid Infection ◽

Leaf Tissues ◽

The U.S

In spring 2012, a severe disease was observed on a limited number of tomato plants (Solanum lycopersicum L.) in a research greenhouse facility in western North Carolina. The first symptoms noted were downward curling of the terminal leaves accompanied by a rough puckered darker green texture. This was followed in time by greater distortion of the leaves with pale green on leaf margins. Older leaves with symptoms developed necrosis, with necrotic spots and streaks appearing on a few fruits. On some of these affected fruits, stems, peduncles, pedicels, and sepals also showed symptoms. Infected plants were badly stunted, and fruits in the upper parts of plants displaying severe symptoms remained very small. In just a few months, the disease spread to other tomato plants inside the greenhouse. A survey in May 2012 showed a disease incidence of 18% (156 symptomatic plants out of a total of 864) in this greenhouse. Initial screenings for possible viruses using ELISA (Agdia, Elkhart, IN), as well as a reverse transcription (RT)-PCR panel of 15 common tomato viruses in our laboratory were negative. Because of the symptoms and negative results for viruses, a viroid infection was suspected. Total plant RNA was prepared using TRIzol reagent (Invitrogen, Carlsbad, CA) from leaf tissues of eight diseased plants and one seed sample. Using real-time RT-PCR developed against Potato spindle tuber viroid (PSTVd) and some related pospiviroids (1), positive signals were observed with a mean Ct = 13.24 for leaf tissues and Ct = 19.91 for the seed sample. To obtain a full viroid genome, RT-PCR using two different sets of primers, one specific for PSTVd (PSTVd-F and PSTVd-R) (2), and a universal primer set for pospiviroids (MTTVd-F and MTTVd-R) (3) was performed. RT-PCR generated amplicons with expected size of ~360 bp from all eight leaf and one seed samples, but not from a healthy control. PCR products were cloned using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA). A total of 22 full genomic sequences were obtained. A multi-sequence alignment generated a consensus sequence of 360 nt, designated as NC12-01 (GenBank Accession No. JX280944). BLASTn search in the NCBI database revealed the highest sequence identity of 96.9% to Australian (AY962324) and UK (AJ583449) isolates of PSTVd and 95.9% identity to the tomato isolate of PSTVd-CA1 (HM753555). Similar disease symptoms were observed on two ‘Rutgers’ tomato plants 2 weeks post mechanical inoculation and the presence of PSTVd was confirmed by real-time RT-PCR (1). A mock-inoculated plant did not show any symptoms. In the U.S., natural infection of PSTVd on tomato was first identified in California in 2010 (3). To our knowledge, this is the first report of a natural occurrence of PSTVd on tomato in the eastern U.S. The diseased plants were contained, properly disposed of, and eradicated in this location. The broader geographic distribution of PSTVd on tomato in the U.S., and the potential latent infection in potato and a number of ornamentals (4), emphasizes the need for better plant and seed health tests for viroids on these plants. References: (1) N. Boonham et al. J. Virol. Methods 116:139, 2004. (2) H. Bostan et al. J. Virol. Methods 116:189, 2004. (3) K.-S. Ling and D. Sfetcu. Plant Dis. 94:1376, 2010. (4) R. A. Owens and J. Th. J. Verhoeven. The Plant Health Instructor. DOI: 10.1094/PHI-I-2009-0804-01, 2009.

Download Full-text

Accumulation of short interfering RNAs characteristic of RNA silencing precedes recovery of tomato plants from severe symptoms of Potato spindle tuber viroid infection

Journal of General Plant Pathology ◽

10.1007/s10327-003-0083-6 ◽

2004 ◽

Vol 70 (1) ◽

pp. 50-53 ◽

Cited By ~ 26

Author(s):

Teruo Sano ◽

Yoko Matsuura

Keyword(s):

Rna Silencing ◽

Potato Spindle Tuber Viroid ◽

Tomato Plants ◽

Viroid Infection

Download Full-text

Rasta Disease of Tomato in Ghana is Caused by the Pospiviroids Potato spindle tuber viroid and Tomato apical stunt viroid

Plant Disease ◽

10.1094/pdis-10-18-1751-re ◽

2019 ◽

Vol 103 (7) ◽

pp. 1525-1535 ◽

Cited By ~ 1

Author(s):

Ozgur Batuman ◽

Ö. Cem Çiftçi ◽

Michael K. Osei ◽

Sally A. Miller ◽

Maria R. Rojas ◽

...

Keyword(s):

Potato Spindle Tuber Viroid ◽

Unknown Etiology ◽

Rt Pcr ◽

Tomato Cultivar ◽

Tomato Plants ◽

Tomato Seedlings ◽

Stunt Viroid ◽

Fta Cards ◽

Polymerase Chain ◽

Susceptible Tomato

Rasta is a virus-like disease of unknown etiology affecting tomato (Solanum lycopersicum) plants in Ghana. Symptoms include stunting; epinasty, crumpling, and chlorosis of leaves; and necrosis of leaf veins, petioles, and stems. Leaf samples with rasta symptoms were collected from commercial tomato fields in Ghana in October 2012 and applied to FTA cards, and RNA extracts were prepared. Reverse-transcription polymerase chain reaction (RT-PCR) tests with primers for Columnea latent viroid, which causes rasta-like symptoms in tomato plants in Mali, were negative, whereas tests with degenerate viroid primer pairs were inconclusive. However, tomato seedlings (Early Pak 7) mechanically inoculated with RNA extracts of 10 of 13 samples developed rasta-like symptoms. In RT-PCR tests with RNA from leaves of the 10 symptomatic seedlings and primers for Potato spindle tuber viroid (PSTVd) or Tomato apical stunt viroid (TASVd), the expected size (approximately 360 bp) of DNA fragment was amplified from eight and two seedlings, respectively. Sequence analyses confirmed that these fragments were from PSTVd and TASVd isolates, and revealed a single PSTVd haplotype and two TASVd haplotypes. The PSTVd and TASVd isolates from Ghana had high nucleotide identities (>94%) with isolates from other geographic regions. In a host range study, PSTVd and TASVd isolates from Ghana induced rasta symptoms in the highly susceptible tomato cultivar Early Pak 7 and mild or no symptoms in Glamour, and symptomless infections in a number of other solanaceous species. PSTVd and TASVd isolates were seed associated and possibly seed transmitted.

Download Full-text

First Report of Tomato spotted wilt virus in Brugmansia suaveolens in Korea

Plant Disease ◽

10.1094/pdis-02-14-0173-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1283-1283

Author(s):

S.-K. Choi ◽

I.-S. Cho ◽

G.-S. Choi ◽

J.-Y. Yoon

Keyword(s):

Mosaic Virus ◽

Tomato Spotted Wilt Virus ◽

Korean Isolate ◽

Rt Pcr ◽

First Report ◽

Tomato Spotted Wilt ◽

Pcr Product ◽

Brugmansia Suaveolens ◽

Plant Pathol ◽

Wilt Virus

Brugmansia suaveolens, also known as angel's trumpet, is a semi-woody shrub or a small tree. Because flowers of B. suaveolens are remarkably beautiful and sweetly fragrant, B. suaveolens is grown as ornamentals outdoors year-round in the tropics and subtropics, and as potted plants in temperate regions (1). In February 2013, virus-like symptoms including mosaic symptoms followed by distortion of leaves were observed in a potted B. suaveolens in a nursery in Chung-Nam Province, Korea. Symptomatic leaves were analyzed for the presence of several ornamental viruses including Cucumber mosaic virus (CMV), Tobacco mosaic virus (TMV), Tomato bush stunt virus (TBSV), and Tomato spotted wilt virus (TSWV) by immune-strip diagnostic kits that were developed by our laboratory. Positive controls and extract from healthy leaves of B. suaveolens as a negative control were included in each immune-strip assay. TSWV was detected serologically from the naturally infected B. suaveolens, but CMV, TBSV, and TMV were not detected from the B. suaveolens. The presence of TSWV (named TSWV-AT1) was confirmed by commercially available double-antibody sandwich (DAS)-ELISA kits (Agdia, Elkhart, IN). TSWV-AT1 was mechanically transmitted from the ELISA-positive B. suaveolens to Capsicum annuum and Nicotiana glutinosa, respectively. Inoculated C. annuum showed chlorotic rings in the inoculated leaves and inoculated N. glutinosa produced mosaic and systemic necrosis in the inoculated leaves after 7 days inoculation, respectively, which were consistent with symptoms caused by TSWV (2). To confirm further TSWV-AT1 infection, reverse transcription (RT)-PCR was performed using the One-Step RT-PCR (Invitrogen, Carlsbad, CA) with TSWV-specific primers, TSWV-NCP-For and TSWV-NCP-Rev (3), designed to amplify a 777-bp cDNA of the nucleocapsid protein (NCP) gene. Total RNAs from naturally infected B. suaveolens, symptomatic C. annuum, and N. glutinosa were extracted using RNeasy Plant Mini Kit (Qiagen, Valencia, CA). Total RNAs obtained from a Korean isolate of TSWV (Accession No. JF730744) and healthy B. suaveolens were used as positive and negative controls, respectively. The expected size of the RT-PCR product was amplified from symptomatic B. suaveolens, C. annuum, and N. glutinosa but not from healthy leaves of B. suaveolens. The amplified RT-PCR product from TSWV-AT1 was directly sequenced using BigDye Termination kit (Applied Biosystems, Foster City, CA). Multiple alignment of the TSWV-AT1 NCP sequence (AB910533) with NCP sequences of other TSWV isolates using MEGA5 software (4) revealed 99.0% aa identity with an Korean TSWV isolate (AEB33895) originating from tomato. These results provide additional confirmation of TSWV-AT1 infection. It is known that high-value ornamentals may act also as reservoirs for TSWV that can infect other ornamentals and cultivated crops, because TSWV has a very broad host range (2). Elaborate inspections for TSWV and other viruses are necessary for production of healthy B. suaveolens, since the popularity and economic importance of this ornamental plant is increasing. To our knowledge, this is the first report of TSWV in B. suaveolens in Korea. References: (1) Anonymous. OEPP/EPPO Bull. 34:271, 2004. (2) G. Parrella et al. J. Plant Pathol. 85:227, 2003. (3) B.-N. Chung et al. Plant Pathol. J. 28:87, 2012. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011.

Download Full-text

First Report on the Occurrence of Grapevine leafroll-associated virus 7 and 9 in Chilean Grapevines

Plant Disease ◽

10.1094/pdis-92-8-1252c ◽

2008 ◽

Vol 92 (8) ◽

pp. 1252-1252 ◽

Cited By ~ 10

Author(s):

E. A. Engel ◽

P. Escobar ◽

C. Montt ◽

S. Gómez-Talquenca ◽

P. D. T. Valenzuela

Keyword(s):

Amino Acid ◽

Mixed Infection ◽

Amino Acid Identity ◽

Microarray Hybridization ◽

Rt Pcr ◽

Specific Primers ◽

Hybridization Pattern ◽

Acid Identity ◽

Pcr Product ◽

Plant Pathol

Grapevine is one of the oldest horticultural crops and represents a highly valuable agricultural commodity. So far, nine distinct Grapevine leafroll-associated viruses (GLRaVs) within the Closteroviridae family have been found to be associated with grapevine leafroll disease (3). Previous studies have demonstrated a high incidence of GLRaV-1, -2, and -3 in Chile (2). To determine if other GLRaVs were present, 21 dormant cane samples were screened with a comprehensive 70-mer oligonucleotide microarray designed to simultaneously detect all grapevine viruses with total or partial genomic sequence available. The array contained 570 unique probes designed against specific regions of more than 40 viral genomes (E. Engel et al., 15th ICVG [Abstr.], 2006). One sample (cv. Black Seedless) showing a microarray hybridization pattern compatible with a mixed infection of GLRaV-7 and GLRaV-1 was analyzed by ELISA using GLRaV-7 specific antibodies (Agritest, Valenzano, Italy) and reverse transcription (RT)-PCR using virus-specific primers LR7-F: 5′- TAT ATC CCA ACG GAG ATG GC -3′ and LR7-R: 5′- ATG TTC CTC CAC CAA AAT CG -3′ (based on GenBank Accession No. Y15987). The serological analysis confirmed the presence of GLRaV-7 with further confirmation by the RT-PCR product of 502 bp corresponding to a fragment of the HSP70h gene that was cloned and sequenced. The Chilean GLRaV-7 sequence (GenBank Accession No. EU334662) showed 94% nucleotide and 95% amino acid identity when compared with a corresponding region of another GLRaV-7 isolate from Albania (GenBank Accession No. Y15987). GLRaV-1 infection was confirmed by ELISA (Bioreba AG, Reinach, Switzerland) and RT-PCR. A second sample (cv. Tintorera) showing microarray hybridization pattern compatible with a mixed infection of GLRaV-9 and Grapevine virus A (GVA) was analyzed by RT-PCR using virus-specific primers LR9-F: 5′- CGG CAT AAG AAA AGA TGG CAC -3′ and LR9-R: 5′- TCA TTC ACC ACT GCT TGA AC -3′ (1). The RT-PCR product of 393 bp corresponding to a fragment of the HSP70h gene was cloned and sequenced (GenBank Accession No. EU334663), showing 94% nucleotide and 95% amino acid identity when compared with a corresponding region of another GLRaV-9 isolate from the United States (GenBank Accession No. AY297819). Since there are no commercial antibodies available for GLRaV-9 detection, a second pair of primers, LR9-F1: 5′- AAA GGT TTC TGC TGG TTA CC -3′ and LR9-R1: 5′- CTT TCA GAA CAG TCC TCC TC -3′ that amplified a fragment of ORF1a was also used. The 301-bp product was cloned and sequenced (GenBank Accession No. EU588989) showing 93.7% nucleotide and 98% amino acid identity when compared with a corresponding region of another GLRaV-9 isolate (GenBank Accession No. AY297819). GVA infection was confirmed by ELISA (Bioreba AG) and RT-PCR. To our knowledge, this is the first report of GLRaV-7 and GLRaV-9 in Chile. Further studies will help determine the effect and incidence of these viruses in Chilean grapevines. References: (1) R. Alkowni et al. J. Plant Pathol. 86:123, 2004. (2) N. Fiore et al. J. Plant Pathol. 90:125, 2008. (3) G. P. Martelli and E. Boudon-Padieu. Options Méditerr. B55, 2006.

Download Full-text