Actividad antimicrobiana de hongos endofíticos aislados de Brugmansia suaveolens Bercht. & J. Presl

Natural products produced from endophyte fungi have a broad spectrum of biological activity and can be grouped into several categories. Antimicrobials constitute an important group of therapeutic agents, which can be produced and obtained from living organisms. The main objective of this study is to investigate the endophytic fungi and the leaves of Brugmansia suaveolens Bercht. & J. Presl as elicitors, aiming at the production of bioactive substances with antimicrobial properties. The extracts were prepared from 19 fungi isolated from the leaves of B. suaveolens Bercht. & J. Presl, used as a biotic elicitor. The extracts were obtained by fermentation in a submerged medium with the addition of leaves from its dry leaves, and the antimicrobial activity of its extracts was evaluated using the agar diffusion method. The results showed that 57% of the endophytic fungi showed antimicrobial activity after fermentation with the elicitor. It was observed that the antimicrobial activity was increased compared to control cultures. The leaves of B. suaveolens Bercht. & J. Presl presented bioactives that stimulated the production of a substance with antimicrobial activity by endophytic fungi, the study of such compounds showed promise to clarify the application potential of these bioactives.

Brugmansia suaveolens as a New Host for Root-Knot Nematode, Meloidogyne incognita, in Goiás State, Brazil

Brugmansia suaveolens (Humb. and Bonpl. ex Willd.) Bercht. and J. Presl, also called White Angel’s Trumpet is an ornamental plant known, for its medicinal properties and as an invasive weed (Kwak et al., 2021; Petricevich et al., 2020). It belongs to the Solanaceae family, with a center of origin in South America, and it is currently found all over the world (Petricevich et al., 2020). In February 2020, B. suaveolens plants cultivated in a single garden in Vianópolis region (16°56'60.0"S 48°29'16.0"W), Goiás state, Brazil were observed presenting yellowing symptoms, with descending branches death. When the roots were inspected, a large number of galls were found, typical of root-knot nematodes. Samples of soil and root were sent to a Nematology Laboratory (LabNema) at São Paulo State University, Jaboticabal Campus. Forty-one thousand six hundred eggs and second-stage juveniles (J2s) were extracted from 100 cm³ of soil and 7,600 eggs and J2s of Meloidogyne sp. per gram of root. Morphological, enzymatic, and molecular techniques were used to identify the species. The perineal pattern of the females (n = 15) had a high dorsal arch, with thick streaks and a trapezoidal shape. The male labial region (n = 15) had a trapezoidal shape with apparent annulations (Eisenback and Hirschmann, 1981; Nascimento et al., 2021; Taylor and Netscher, 1974). The morphological characteristics of adults were similar to those originally described for M. incognita (Kofoid and White, 1919) Chitwood 1949. The profile of the isoenzyme esterase was studied (n = 16) and the phenotype I1, characteristic of M. incognita, was found (Esbenshade and Triantaphyllou, 1985). Genomic DNA (N = 20) was obtained through DNA of females, extracted by Worm Lysis Buffer (WLB) (Carvalho et al., 2019). Two sets of primers were used, Finc-1: GGGATGTGTAAATGCTCCTG, Rinc-1: CCCGCTACACCCTCAACTTC (Randig et al., 2002) and Finc-4: GTGAGGATTCAGCTCCCCAG, Rinc-4: ACGAGGAACATACTTCTCCGTCC (Meng et al., 2004), specific for M. incognita, which amplified fragments of 399 and 955 bp, respectively, confirming the species. A pathogenicity test was conducted under greenhouse conditions. Six newly formed seedlings were transplanted individually into 10-liter pots containing autoclaved soil and, subsequently, each plant was inoculated with 3,000 eggs and J2s from the original population of M. incognita. After 120 days, White Angel’s Trumpet plants showed reduced development, yellow leaves, and many root galls with abundant egg masses on the roots, unlike the non-inoculated plants. Nematodes were extracted from roots. The average recovered reached 78,458 eggs and J2s per plant, corresponding to a reproductive factor (RF) of 26.15. A high RF provides an alert for B. suaveolens cultivation in areas with a history of root-knot nematode infestation. Moreover, this disease outbreak might serve as a source of inoculum for large-scale cultivated plants near the farm, which are generally good hosts for M. incognita. This is the first report presenting Angel’s Trumpet as host of root-knot nematode, M. incognita, in Brazil and the world.

First report of Colombian datura virus in Brugmansia suaveolens in Korea

Brugmansia suaveolens, known as angel’s trumpet, is a perennial ornamental shrub in the Solanaceae with large fragrant flowers. In June 2018, a leaf sample of B. suaveolens that showed virus-like symptoms including chlorotic spots, yellowing and mottle on leaves was collected from a greenhouse in Seongnam, South Korea for disease diagnosis (Supplementary Figure S1a, b). Disease incidence in the greenhouse was greater than 80% for about 2,000 B. suaveolens plants. To identify a causal virus, transmission electron microscopy (TEM) was used to analyze symptomatic leaf samples using leaf dips and thin section methods. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Supplementary Figure S1c, d). To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for three potyviruses that infect Brugmansia spp.: Colombian datura virus (CDV), Brugmansia mosaic virus (BruMV), and Brugmansia suaveolens mottle virus (BsMoV) (Lucinda et al, 2008; Park et al., 2014; Verma et al., 2014). The sample was positive only for CDV. CDV is transmitted by aphids in a nonpersistent manner and mechanical inoculation and can infect plants in the Solanaceae family including tomato and tobacco (Kahn and Bartels 1968; Schubert et al. 2006; Verhoeven et al. 1996) and has been designated a quarantine virus in Korea. Additional analysis of 13 symptomatic B. suaveolens plants from the infected greenhouse found that all samples except one were infected with CDV. To isolate CDV from B. suaveolens, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Nicotiana tabacum cv. BY via three single-lesion passages followed by propagation in N. benthamiana. For the bioassay of the CDV isolate (CDV-AT-Kr), sap from infected N. benthamiana was mechanically inoculated on 31 indicator plants, including B. suaveolens (Supplementary Table S2). CDV-AT-Kr induced chlorotic local lesions, necrotic local lesions, mottle, and/or mosaic systemically in 10 Nicotiana spp., and mottle and yellowing in tomato. On inoculated B. suaveolens, te mild mottle symptom was reproduced. No symptoms were observed in pepper or Datura stramonium. These results were confirmed by RT-PCR. To characterize CDV-AT-Kr genetically, the complete genome sequence of CDV-AT-Kr was obtained by RT-PCR using specific primers (Supplementary Table S3) and deposited in GenBank (accession no. MW075268). The CDV-AT-Kr RNA consists of 9,620 nt, encoding a polyprotein of 3,076 aa. BLASTn analysis showed that CDV-AT had maximum nucleotide identities of 98.9% at the complete genome level with a CDV isolate (accession no. JQ801448) from N. tabacum in the UK. To our knowledge, this is the first report of CDV infection in B. suaveolens in Korea and the second report in the world of the complete genome sequence. As B. suaveolens is cultivated by vegetative propagation, production and maintenance of virus-free, healthy B. suaveolens is needed. In addition, as new CDV hosts have been repeatedly reported (Pacifico et al., 2016; Salamon et al., 2015; Tomitaka et al., 2014; Verma et al., 2014), we are monitoring nationwide occurrence to prevent the spread of the virus to other crops.

Consumo de Brugmansia suaveolens (Trombeta de Anjo) e perturbação psíquica

A planta Brugmansia suaveolens (Humb. & Bonpl. ex Willd.) Sweet, conhecida popularmente como “Trombeta de Anjo”, é típica de regiões tropicais e sul americanas, incluindo o Brasil, e é famosa por suas propriedades alucinógenas, perturbadoras, sedativas, entre outras. Neste contexto, é utilizada em práticas ritualísticas, curativas e recreacionais. Dessa maneira, o presente estudo tem como objetivo analisar e discutir o consumo de B. suaveolens e o seu potencial de perturbação psíquica. Fez-se uma revisão bibliográfica integrativa, utilizando-se de artigos dos últimos 10 anos (2010-2020), com os descritores “Brugmansia suaveolens”, “Toxinas”, “Alucinações”, “Delirium”, “Síndrome Anticolinérgica Aguda”, “Escopolamina”, “Atropina”, “Chá de Trombeta”, “Trombeta de Anjo”, “Mududu”. A Brugmansia suaveolens apresenta propriedades antinociceptiva, nematicida e relaxante muscular e a toxicidade do seu consumo é dose dependente. Neste sentido, concentrações maiores de flores na infusão de água refletem em maiores concentrações de atropina e escopolamina, os quais inibem os receptores muscarínicos. Esta inibição é responsável pela toxicidade anticolinérgica, causando febre, alucinações, confusão, delírio, dentre outros sintomas. Conclui-se que a utilização de B. suaveolens apresenta riscos, devido ao seu alto potencial alucinógeno, e deve ser visto, portanto, com importância clínica.

Chemical Compounds, Pharmacological and Toxicological Activity of Brugmansia suaveolens: A Review

This study investigates updated information in different search engines on the distribution, phytochemistry, pharmacology, and toxicology of Brugmansia suaveolens (Solanaceae) using the extracts or chemical compounds at present. This plant has been used in traditional medicine in different cultures as a hallucinatory, analgesic, aphrodisiac, nematicide, sleep inducer, and muscle relaxant, as well as a treatment for rheumatism, asthma, and inflammation. The flowers, fruits, stems, and roots of the plant are used, and different chemical compounds have been identified, such as alkaloids, volatile compounds (mainly terpenes), coumarins, flavonoids, steroids, and hydrocarbons. The concentration of the different compounds varies according to the biotic and abiotic factors to which the plant is exposed. The toxic effect of the plant is mainly attributed to atropine and scopolamine, their averages in the flowers are 0.79 ± 0.03 and 0.72 ± 0.05 mg/g of dry plant, respectively. Pharmacological studies have shown that an aqueous extract exhibits the antinociceptive effect, at doses of 100 and 300 mg/kg i.p. in mice. On the other hand, the ethanolic extract at 1000 mg/L, showed a nematocidal activity in vitro of 64% against Meloidogyne incognita in 72 h. Likewise, it showed a 100% larvicidal activity at 12.5 mg/L against Ancylostoma spp. In another study, the lethal activity of shrimp in brine from an ethanolic extract showed an LC50 of 106 µg/mL at double serial concentrations of 1000–0 (µg/mL). Although there are pharmacological and phytochemical studies in the plant, they are still scarce, which has potential for the examination of the biological activity of the more than one hundred compounds that have been reported, many of which have not been evaluated.

EVALUACIÓN IN VITRO DE LA ACTIVIDAD OVICIDA DE EXTRACTOS DE PLANTAS CONTRA HAEMONCHUS CONTORTUS (TRICHOSTRONGYLIDAE)

La industria ovina es una rama en el ganado que ha estado creciendo a través de los años, sin embargo, el control de los parásitos gastrointestinales se considera una de las mayores barreras de esta práctica. En este sentido, Haemonchus contortus (Rudolphi, 1803) es um parásito hematófago que puede causar anemia severa, el desarrollo de paperas, y la muerte. Se sabe que el uso inapropiado de medicamentos alopáticos ha promovido la aparición de resistencia por parte de este parásito. Así, el presente estudio tuvo como objetivo evaluar la actividad ovicida de extractos de plantas contra H. contortus. Los huevos de H. contortus se obtuvieron a partir de muestras fecales de ovejas naturalmente infectadas y se purificaron mediante la modificación del método de Sheather. Los huevos purificados se sometieron a seis extractos alcohólicos, a concentraciones de 12,5 mg / mL, 25 mg / mL y 50 mg / mL. Las plantas evaluadas fueron Allamanda cathartica L., Musa sp, Nerium oleander L., Mirabilis jalapa L., Carica papaya L. y Brugmansia suaveolens (Humb. & Bonpl. ex Willd.) Bercht. Después de 168 h, se analizaron alıcuotas de 50 μL para determinar la presencia de huevos transformados en blastómero, embriones o larvas. Se observó que los extractos alcohólicos de N. oleander y M. jalapa fueron los más prometedores, ya que evitó el brote de larvas en todas las concentraciones ensayadas, presentando así un alto potencial para productos compuestos destinados a la descontaminación de pastoreo.