scholarly journals Surface Colonization, Penetration, and Lesion Formation on Grapes Inoculated Fresh or After Cold Storage with Single Airborne Conidia of Botrytis cinerea

Plant Disease ◽  
1999 ◽  
Vol 83 (10) ◽  
pp. 917-924 ◽  
Author(s):  
Sonja Coertze ◽  
Gustav Holz
Keyword(s):  
Relative Humidity ◽  
Botrytis Cinerea ◽  
Cold Storage ◽  
Single Cells ◽  
Disease Incidence ◽  
High Relative Humidity ◽  
Lesion Formation ◽  
Surface Colonization ◽  
Table Grapes ◽  
Airborne Conidia

Infection of grapes by different densities of airborne conidia of Botrytis cinerea was investigated on table grapes (cultivar Dauphine) harvested ripe (16°Brix) and inoculated fresh, or after SO2 treatment and 8-week storage at -0.5°C. Berries were detached at each inoculation and dusted with dry conidia in a settling tower. Following inoculation, the fresh berries were incubated for 24 h at high relative humidity (≥93%), or were overlaid with wet sterile paper towels. Cold-stored berries were incubated at high relative humidity. The effect of conidial density on surface colonization, penetration, and lesion formation was determined by surface sterilization, isolation, and freezing studies on fresh berries. Only symptom expression was determined on cold-stored berries. Fluorescence microscopy of skin segments showed that conidia were consistently deposited as single cells, and not in pairs or groups, on berry surfaces. Individual conidia, at all densities tested, readily infected the cold-stored berries and formed separate lesions after 2 days. Although the cold-stored berries were highly susceptible, lesion numbers were not related to conidial density at low inoculum dosages (0.67 to 2.60 conidia per mm2 berry surface). Lesion numbers tended to increase exponentially at higher dosages (3.24 to 3.88 conidia per mm2 berry surface). Individual conidia, however, did not induce any disease symptoms on fresh berries. Removal of the pathogen after 24-h incubation from the surface of fresh berries by ethanol, and subsequent incubation of excised skin segments revealed that, irrespective of the conidial density or the wetness regime, less than 2% of skin segments were penetrated. Furthermore, increasing densities of conidia did not lead to higher rates of surface colonization and skin penetration. The low incidence of disease caused on fresh berries and high disease incidence induced after prolonged cold storage indicated that infection was not governed by conidial density on berry surfaces, but by the level of host resistance.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals Germination and Establishment of Infection on Grape Berries by Single Airborne Conidia of Botrytis cinerea

Plant Disease ◽  
2001 ◽  
Vol 85 (6) ◽  
pp. 668-677 ◽  
Author(s):  
S. Coertze ◽  
G. Holz ◽  
A. Sadie
Keyword(s):  
Botrytis Cinerea ◽  
Incubation Period ◽  
Skin Penetration ◽  
Grape Berry ◽  
High Rate ◽  
Disease Symptoms ◽  
Surface Colonization ◽  
Grape Berries ◽  
Table Grapes ◽  
Infection Mode

Table grapes (cv. Dauphine) at different phenological stages were dusted in a settling tower with dry conidia of Botrytis cinerea. The berries were incubated for periods of 3 to 96 h at high relative humidity (RH; ±93% RH, moist berries), or were covered with a film of water (wet berries). Germination of the solitary conidia, appressorium formation, stilbene and suberin induction by germlings, and germling viability were examined by fluorescence microscopy after each incubation period. Isolation and freezing studies were conducted to determine surface colonization (berries left unsterile) and penetration (surface-disinfested berries). Symptoms were determined on berries incubated at a specific wetness regime, kept dry for 10 days, and then incubated for 4 days at high RH. Microscopic observations indicated that germination was delayed on immature berries, but proceeded at a high rate on mature berries. Growth was invariably restricted on moist berries. Attempted penetration was always direct. Stilbene and suberin were generally induced early and were intense on berries at the pea-size and bunch closure stages. Dieback of conidia and germlings occurred at a significantly higher rate on wet than moist berries, and was more pronounced on immature than on mature berries. The segment isolation and freezing studies showed that infections in grape berry cheeks established by this infection mode were few. Extended incubation periods did not lead to substantially higher rates of surface colonization and skin penetration. Disease symptoms did not develop during the 14-day period on the berries transferred to dry perspex chambers, irrespective of phenological stage, incubation period, or wetness regime. According to these findings, this mode of infection should not contribute to a gradual build-up of secondary inoculum in the vineyard, and to B. cinerea epiphytotics.

scholarly journals 808 PB 144 EFFECTIVNESS OF AEROSOL SPRAYS FOR CONTROLLING ROT IN TABLE GRAPES

HortScience ◽  
1994 ◽  
Vol 29 (5) ◽  
pp. 549a-549
Author(s):  
M. Ahmed Ahmedullah
Keyword(s):  
Sulfur Dioxide ◽  
Relative Humidity ◽  
Vitis Vinifera ◽  
Aerosol Particles ◽  
High Relative Humidity ◽  
Viable Alternative ◽  
Thompson Seedless ◽  
Storage Size ◽  
Table Grapes ◽  
And Control

Fruit of Vitis vinifera cvs. Flame Seedless, Thompson Seedless and Black Monukka were fumigated with 4, 6 and 8 Deccodione Smoke Tables (DST) for 30 minutes. Fruit was stored at 32 F and high relative humidity. Decay control index, freshness of stems and bleaching around the capstem were recorded at 4, 8, 12 and 16 weeks of storage. Size of the aerosol particles was determined using an electrical aerosol analyzer. Fruit was analysed for Deccodione residues. Lower rates of the fungicide gave unsatisfactory decay control. Eight DSTs successfully controlled decay upto a period of 14 weeks. There was no bleaching of pigments commonly associated with sulfur dioxide fumigation. Majority of the aerosol particles were between 0.18 and 0.32 micrometers. Deccodione residues on the fruit were within the acceptable limits established for Deccodione. There was no perceptible difference in taste between treated and control fruit. This method of decay control could provide a viable alternative to sulfur dioxide fumigation.

scholarly journals Relative humidity during cold storage on Postharvest quality of 'Niagara Rosada' table grapes

2015 ◽  
Vol 45 (3) ◽  
pp. 386-391 ◽  
Author(s):  
Josuel Alfredo Vilela Pinto ◽  
Márcio Renan Weber Schorr ◽  
Fabio Rodrigo Thewes ◽  
Deiverson Luiz Ceconi ◽  
Vanderlei Both ◽  
...  
Keyword(s):  
Weight Loss ◽  
Relative Humidity ◽  
Shelf Life ◽  
Cold Storage ◽  
Titratable Acidity ◽  
Soluble Solids ◽  
Postharvest Quality ◽  
Table Grapes ◽  
Niagara Rosada

This study aimed to evaluate the effect of different levels of relative humidity (RH) on the maintenance of Postharvest quality of 'Niagara Rosada' table grapes after cold storage at 0.5°C for 21 days. A completely randomized design was used, with five replicates of 18 clusters per treatment. The selected levels of relative humidity were 85, 90, 95 and 100%, obtained by means of electronic humidity controllers. The fruits were evaluated in relation to rot incidence, berry cracking, browning rate, respiratory rate, titratable acidity, soluble solids, resistance to abscission, berry drop and weight loss. The evaluations were assessed at 20 days of storage and after two and four days of shelf-life (20°C; 85% RH). The results showed that as higher as relative humidity, higher is rot incidence and that the variables rachis browning and weight loss were inversely related to relative humidity. Resistance to abscission at the end of storage was higher when humidity ranged between 90 and 95%, but it was not affected after transfer to shelf-life from cold storage. Relative humidity ranging between 90 and 95% offer the best conditions to maintain the Postharvest quality of 'Niagara Rosada' table grapes

scholarly journals Identification of epiphytic yeasts and bacteria with potential for biocontrol of grey mold disease on table grapes caused by Botrytis cinerea

2018 ◽  
Vol 16 (1) ◽  
pp. e1002 ◽  
Author(s):  
Kazem Kasfi ◽  
Parissa Taheri ◽  
Behrooz Jafarpour ◽  
Saeed Tarighi
Keyword(s):  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Gray Mold ◽  
Antagonistic Activity ◽  
Antagonistic Effect ◽  
Bacterial Isolates ◽  
Thompson Seedless ◽  
Grape Berries ◽  
Table Grapes

The objective of this study was to identify grapevine epiphytic yeasts and bacteria for biocontrol of Botrytis cinerea on grapes. Antagonistic yeasts and bacteria were isolated from the epiphytic flora associated with grape berries and leaves cv. ‘Thompson seedless’ from vineyards in Iran and identified by sequencing the conserved genomic regions. A total of 130 yeast and bacterial isolates from the surface of grapevine were screened in vitro for determining their antagonistic effect against B. cinerea and used to control postharvest gray mold. Among the 130 isolates, five yeasts and four bacterial isolates showed the greatest antagonistic activity in vitro against B. cinerea. Two yeasts species including Meyerozyma guilliermondii and Candida membranifaciens had high antagonistic capability against the pathogen. Also, 4 bacterial isolates belonging to Bacillus sp. and Ralstonia sp. showed significant biocontrol effect against B. cinerea. The isolates were capable of producing volatile and non-volatile substances, which suppressed the pathogen growth. The antagonistic activity of selected yeasts and bacteria against the pathogen was investigated on wounded berries of ‘Thompson seedless’. On small clusters with intact berries, all of the antagonistic isolates considerably reduced the decay on grape berries and inhibition of gray mold incidence on fruits treated by these isolates was less than 50%, except for the isolate N1, which had higher capability in inhibiting the disease incidence. These results suggest that antagonist yeasts and bacteria with potential to control B. cinerea on grape can be found in the microflora of grape berries and leaves.

Effect of long-term cold storage of the predatory mite Neoseiulus californicus at high relative humidity on post-storage biological traits

BioControl ◽  
2012 ◽  
Vol 57 (5) ◽  
pp. 635-641 ◽  
Author(s):  
Noureldin Abuelfadl Ghazy ◽  
Takeshi Suzuki ◽  
Maqsood Shah ◽  
Hiroshi Amano ◽  
Katsumi Ohyama
Keyword(s):  
Relative Humidity ◽  
Cold Storage ◽  
Predatory Mite ◽  
High Relative Humidity ◽  
Neoseiulus Californicus ◽  
Biological Traits

scholarly journals Characterizing the Brown Spot Pathosystem in Late-Harvest Table Grapes (Vitis vinifera L.) in the California Central Valley

Plant Disease ◽  
2016 ◽  
Vol 100 (11) ◽  
pp. 2204-2210 ◽  
Author(s):  
Cassandra L. Swett ◽  
Tyler Bourret ◽  
W. Douglas Gubler
Keyword(s):  
Vitis Vinifera ◽  
Cold Storage ◽  
Disease Incidence ◽  
Central Valley ◽  
Table Grape ◽  
Brown Spot ◽  
Postharvest Disease ◽  
Vitis Vinifera L ◽  
Disease Etiology ◽  
Table Grapes

Brown spot, caused by Cladosporium spp., is becoming a problematic postharvest disease of late season table grape (Vitis vinifera) in the California central valley, and management is hindered by knowledge gaps in disease etiology and epidemiology. Brown spot is herein described as a pre- and postharvest dry rot typified by an external brown to black spot or black mycelium which encases the placenta. Isolates in the Cladosporium herbarum and C. cladosporioides species complexes were recovered from 85 and 5% of brown-spot affected berries, respectively. Five isolates in the C. herbarum species complex, representing three phylogenetically distinct species (C. limoniforme, C. ramotenellum, and C. tenellum), and one C. cladosporioides isolate all caused brown spot symptoms under cold-storage conditions, with and without mechanical wounding. Isolate virulence was similar (P > 0.05) based on disease incidence and severity on intact berries but severity varied on wounded berries (P < 0.001). Surface disinfestation reduced severity of cluster rot development following 2 weeks in cold storage (P = 0.027) but incidence was not affected (P = 0.17). This work provides foundational information on brown spot pathosystem etiology and biology in late-harvest table grape, which can be used to improve management.

scholarly journals ALTERNATIVES TO SULFUR DIOXIDE FUMIGATION FOR TABLE GRAPE STORAGE

HortScience ◽  
1996 ◽  
Vol 31 (6) ◽  
pp. 919
Author(s):  
A. Ahmedullah
Keyword(s):  
Sulfur Dioxide ◽  
Relative Humidity ◽  
Aerosol Particles ◽  
Table Grape ◽  
High Relative Humidity ◽  
Table Grapes ◽  
Evaluation Time ◽  
Fumigation Chamber

Clusters of four varieties of table grapes were packed in TKV lugs and fumigated with 4, 6, or 8 Deccodione Smoke Tables (DST) for a period of 30 minutes in a fumigation chamber. After fumigation, inoculum of Botrytis cineraria was placed among the berries in the clusters in predetermined locations. Fruit was stored at 0C and high relative humidity for up to 16 weeks. Fruit was examined at 4, 8, 12, and 16 weeks of storage. Decay control index, freshness of stems, and bleaching of pigments around the capstem was recorded at each evaluation time. Size of aerosol particles was determined. Satisfactory control of decay was obtained with 8 DSTs. Lower doses failed to give satisfactory decay control. Bleaching of capstems typically seen with sulfur dioxide fumigation was not noticed with DST fumigation.

Sign in / Sign up

Export Citation Format

Share Document