First Report of Tomato yellow leaf curl virus-Is (TYLCV-Is) in the Canary Islands

In autumn of 1999 and winter-spring 2000, tomato (Lycopersicon) crops grown in the Regions of Las Palmas de Gran Canaria and Tenerife (Canary Islands) showed upward curling of leaves, yellowing of leaf margins, crumpling of new leaves, reduction of leaflet area, and stunting of shoots. These symptoms were similar to those described for tomato yellow leaf curl disease. Symptomatic samples were collected from Las Palmas de Gran Canaria (33 samples) and Tenerife (45 samples) for polymerase chain reaction (PCR) identification analysis. The degenerate primers pair of Begomovirus (AV494/AC1048) (3) was used to amplify the “core” region of the capsid protein gene. Two tomato plants experimentally infected with Tomato yellow leaf curl virus-Is (TYLCVIs) or TYLCV-Sar served as positive controls. Electrophoretic analysis of all samples showed a single fragment of the expected size (550 bp). To identify the type of TYLCV (TYLCV-Sar or TYLCV-Is), the PCR products were digested by endonucleases (AluI, HaeIII, HpaII, RsaI, Sau3A, TaqI, DdeI, and ScrFI). Twenty-six samples from Las Palmas de Gran Canaria showed the same restriction pattern of TYLCV-Sar, and seven samples from Las Palmas de Gran Canaria and all 45 samples from Tenerife showed the same restriction pattern of TYLCV-Is. These results confirm that TYLCV-Sar and TYLCV-Is are present in Las Palmas de Gran Canaria and TYLCV-Is is present in Tenerife. The presence of TYLCV-Is in Morocco (2) and TYLCV-Sar in the Canary Islands and Morocco has been recently described (1). However, this is the first report of TYLCV-Is in the Canary Islands. References: (1) F. Monci et al. Plant Dis. 84:490, 2000. (2) M. Peterschmitt et al. Plant Dis. 83:1074, 1999. (3) S. D. Wyatt et al. Phytopathology 86:1288, 1996.

Download Full-text

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽

10.1094/pdis-03-12-0258-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1229-1229 ◽

Cited By ~ 3

Author(s):

Y. H. Ji ◽

Z. D. Cai ◽

X. W. Zhou ◽

Y. M. Liu ◽

R. Y. Xiong ◽

...

Keyword(s):

Common Bean ◽

Large Population ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Alignments ◽

First Report ◽

Sequence Identity ◽

Leaf Curl Virus ◽

Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Download Full-text

First Report of Tomato yellow leaf curl virus on Tomato Crops in Greece

Plant Disease ◽

10.1094/pdis.2001.85.6.678c ◽

2001 ◽

Vol 85 (6) ◽

pp. 678-678 ◽

Cited By ~ 13

Author(s):

A. D. Avgelis ◽

N. Roditakis ◽

C. I. Dovas ◽

N. I. Katis ◽

C. Varveri ◽

...

Keyword(s):

Disease Incidence ◽

Rflp Analysis ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Comparisons ◽

Tomato Plants ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodies to TYLCV-European (Adgen Ltd). The serological results were confirmed by PCR using two pairs of primers, universal degenerate (1) and MA 13 and MA 17 (2), amplifying different parts of the virus genome. The restriction fragment length polymorphism (RFLP) analysis (AluI, HaeIII, and TaqI) of the 541 bp amplicon obtained with the degenerate primers showed patterns similar to TYLCV-Is (Israeli species). The second pair of primers gave the expected 348 bp product, which was sequenced. Sequence comparisons revealed 99% identity with TYLCV-Is (EMBL no. X15656, X76319). The resulting sequence was at least 97.7% identical to sequences of TYLCV isolates from the Dominician Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Portugal (EMBL no. AF105975), Iran (EMBL no. AJ13271), and Spain (EMBL no. AF071228). The disease appeared for the first time in 1992 in Tymbaki, but was limited to very few plants in one glasshouse. However, the cause was not determined. To our knowledge, this is the first report of TYLCV of the Begomovirus genus in Greece. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) J. Navas-Castillo et al. J. Virol. Methods 75:195, 1998.

Download Full-text

First Report of Tomato Yellow Leaf Curl Virus in Réunion Island

Plant Disease ◽

10.1094/pdis.1999.83.3.303b ◽

1999 ◽

Vol 83 (3) ◽

pp. 303-303 ◽

Cited By ~ 22

Author(s):

M. Peterschmitt ◽

M. Granier ◽

R. Mekdoud ◽

A. Dalmon ◽

O. Gambin ◽

...

Keyword(s):

Tomato Yellow Leaf ◽

Economic Losses ◽

Enzyme Linked Immunosorbent Assay ◽

Yield Reduction ◽

Yellow Leaf ◽

Degenerate Primers ◽

Capsid Protein Gene ◽

Pcr Product ◽

Leaf Curl Virus ◽

Leaf Curl

In September 1997, stunting, reduced leaf size, leaf curling, and yellow margins were observed on tomato plants on a farm on the south coast of Réunion, a French island belonging to the Mascarenes archipelago. To our knowledge, these symptoms appeared to be characteristic of a tomato yellow leaf curl virus (TYLCV) infection. Diseased plants gave positive reactions with a triple antibody sandwich-enzyme-linked immunosorbent assay (TAS-ELISA), using ADGEN antibodies specific for begomoviruses (1). The serological results were confirmed by polymerase chain reaction (PCR) with a pair of degenerate primers—MP16, 5′-CCTCTAGATAATATTAC(C/T)(G/T)(G/A)(A/T)(T/G)G(G/A)CC-3′ and MP82, 5′-CGGAATTC(T/C)TGNAC(C/T)TT(G/A)CANGGNCC(T/C)T C(G/A)CA-3′—designed by Malla Padidam (ILTAB, San Diego, CA) to amplify a region of the A component of begomoviruses, between the intergenic conserved nonanucleotide sequence (TAATATTAC) and the first 5′ quarter of the capsid protein gene. A 500-bp PCR product was obtained from a symptomatic plant but not from a healthy looking one. After cloning the PCR product in a pGEM-T Easy vector (Promega, Madison, WI) and sequencing it with plasmid-specific primers (SP6, T7), the sequence was compared with the sequences of the NCBI data base, with the use of BLAST. Nineteen sequences among those producing the highest scoring segment pairs were compared with each other and with the 500-bp PCR product from Réunion by the Clustal method of MegAlign (DNASTAR, London). The Réunion sequence (AJ010790) was at least 94% similar to sequences of TYLCV isolates from the Dominican Republic (AF024715), Cuba (AJ223505), and Israel (X15656, X76319 for the mild clone). Based on these results, it appeared that the analyzed tomato plant was infected by a geminivirus isolate belonging to the Israeli species of TYLCV. A preliminary survey was carried out from December 1997 to April 1998 in both outdoor and protected tomato crops. Infected plants were detected by TAS-ELISA in 52 of the 123 locations visited. Severe economic losses were observed: 14 locations with 60 to 100% yield reduction and 11 locations with 40 to 60% yield reduction. All the infected samples were collected in the leeward coast, which is the driest region of the island. Although Bemisia tabaci (Gennadius) has been recorded since 1938 in Réunion (2), it has been observed on tomato crops only since 1997 and population levels were low compared with those of Trialeurodes vaporariorum Westwood. During the first six months of 1998, B. tabaci was found on Euphorbia heterophylla L., Lantana camara L., Solanum melongena L., S. nigrum L., and Phaseolus vulgaris L. These host plants often occur near infected tomato crops. References: (1) S. Macintosh et al. Ann. Appl. Biol. 121:297, 1992. (2) L. Russell and J. Etienne. Proc. Entomol. Soc. Wash. 87:202, 1985.

Download Full-text

Spread of Tomato yellow leaf curl virus Sar from the Mediterranean Basin: Presence in the Canary Islands and Morocco

Plant Disease ◽

10.1094/pdis.2000.84.4.490d ◽

2000 ◽

Vol 84 (4) ◽

pp. 490-490 ◽

Cited By ~ 16

Author(s):

F. Monci ◽

J. Navas-Castillo ◽

J. L. Cenis ◽

A. Lacasa ◽

A. Benazoun ◽

...

Keyword(s):

Canary Islands ◽

Sequence Data ◽

Random Amplified Polymorphic Dna ◽

Nucleotide Sequences ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Gran Canaria ◽

Two Samples ◽

Leaf Curl Virus ◽

Leaf Curl

Severe outbreaks of tomato yellow leaf curl disease occurred during summer and autumn 1999 in tomato (Lycopersicon esculentum Mill.) crops in the Vecindario Region of Gran Canaria (Canary Islands, Spain) and Agadir (southwestern Atlantic coast of Morocco). Symptoms of the disease included upward curling of leaflet margins, reduction of leaflet area, and yellowing of young leaves, as well as stunting and flower abortion. High populations of whiteflies, Bemisia tabaci Gen., were present on tomatoes in Agadir, and analysis of adult individuals by random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) identified them as the biotype Q. Samples were collected from symptomatic tomato plants: 5 plants from Gran Canaria and 22 from three areas in Agadir, (7 from Agadir/1, 12 from Agadir/2, and 3 from Agadir/3) in the Koudya Region. Samples were analyzed for Tomato yellow leaf curl virus (TYLCV) Sar or Is (genus Begomovirus, family Geminiviridae) infection by squash blot hybridization under high stringency conditions with digoxigenin-labeled DNA probes specific to TYLCV-Sar or -Is, as described previously (1,3). The TYLCV-Sar probe hybridized to the five samples from Gran Canaria, and the TYLCV-Is probe hybridized to the 22 samples from Agadir. The TYLCV-Sar probe also hybridized to the three samples from Agadir/3. Primer pairs MA-14/MA-15 and MA-30/MA-31, designed for specific amplification of the intergenic region (IR) of TYLCV-Sar or -Is reported from Spain, respectively (1), were used in PCR to amplify one sample each from Gran Canaria, Agadir/1, and Agadir/3. A fragment of the expected size was obtained from the samples from Gran Canaria and Agadir/3 using MA14/MA15 (342 bp) and from the two samples from Agadir using MA30/MA31 (357 bp). PCR products were directly sequenced (GenBank Accession nos. AF215819 to AF215822). The nucleotide sequences of the IR fragments amplified from the Gran Canaria and Agadir/3 sample using MA-14/MA-15 indicated their closest relationship (99.0 and 96.7% identity, respectively) was to the corresponding region of a TYLCV-Sar isolate reported from Spain (GenBank Accession no. L27708). The nucleotide sequences of the IR fragments amplified from the Agadir/1 and Agadir/3 samples using MA-30/MA-31 indicated their closest relationship (98.1% identity) was to the corresponding region of the TYLCV-Is isolate reported from Spain (GenBank Accession no. AF071228). Based on the hybridization and sequence data, we conclude that the symptomatic plants from Gran Canaria were infected by TYLCV-Sar, those from Agadir/1 and Agadir/2 were infected by TYLCV-Is, and those from Agadir/3 had mixed infections with TYLCV-Is and TYLCV-Sar. The presence of TYLCV-Is in Morocco has been described recently (2). However, this is the first report of TYLCV-Sar in the Canary Islands and Morocco and extends its geographic range beyond the Iberian Peninsula and Italy. References: (1) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (2) M. Peterschmitt et al. Plant Dis. 83:1074, 1999. (3) S. Sánchez-Campos et al. Phytopathology 89:1038, 1999.

Download Full-text

First Report of Tomato yellow leaf curl virus in Acalypha australis in China

Plant Disease ◽

10.1094/pdis-10-12-0922-pdn ◽

2013 ◽

Vol 97 (3) ◽

pp. 430-430 ◽

Cited By ~ 5

Author(s):

Y. H. Ji ◽

H. Zhang ◽

K. Zhang ◽

G. Li ◽

S. Lian ◽

...

Keyword(s):

Tomato Yellow Leaf ◽

Jiangsu Province ◽

Yellow Leaf ◽

Degenerate Primers ◽

Circular Dna ◽

First Report ◽

Weed Hosts ◽

Total Dna ◽

Leaf Curl Virus ◽

Leaf Curl

Whitefly-transmitted geminiviruses (WTGs) can cause serious damage to many crops in China, so an investigation of weed hosts of WTGs was carried out in Jiangsu Province, China, in 2012. Fifty-seven symptomless samples of Acalypha australis L., a common weed known as Asian copperleaf, were randomly collected from seven tomato fields in Nanjing and Lianyungang, Jiangsu Province, from July to September. Total DNA of each sample was extracted and PCR was performed using degenerate primers PA and PB to amplify a specific region covering the AV2 gene of DNA-A and part of the adjacent intergenic region (1). DNA fragments were successfully amplified from 27 out of 57 samples and PCR amplicons of 16 samples were sequenced. Alignment results showed that the nucleotide sequence identities ranged from 98 to 100% with Tomato yellow leaf curl virus (TYLCV) accessions. The full-length viral circular DNA genome was amplified using primer pair 1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and 1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) which were designed based on the known sequences amplified by PA and PB. The complete genome sequence (GenBank Accession No. JX910534) was 2,781 nucleotides in length and had 99 to 100% sequence identity with TYLCV accessions (GU434142, GU111505). The dot immunobinding assay using monoclonal antibody against TYLCV confirmed the 27 weed samples positive by PCR were infected by TYLCV. These results demonstrated that A. australis is a host of TYLCV that might play an important role in viral epidemics in tomato fields in China. TYLCV-infected A. australis did not show typical symptoms like leaf curl, chlorosis, and stunting and thus appears to be a symptomless host. In our investigation, the infection rate ranged from 14 to 79% depending on the field sampled, suggesting that the weed may be an important reservoir of TYLCV, especially during the non-tomato planting period. To our knowledge, this is the first report of A. australis as a host of TYLCV in China. Reference: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994.

Download Full-text

First Report of Tomato yellow leaf curl virus in Louisiana

Plant Disease ◽

10.1094/pdis.2001.85.2.230d ◽

2001 ◽

Vol 85 (2) ◽

pp. 230-230 ◽

Cited By ~ 11

Author(s):

R. A. Valverde ◽

P. Lotrakul ◽

A. D. Landry ◽

J. E. Boudreaux

Keyword(s):

The United States ◽

Tomato Yellow Leaf ◽

Yield Reduction ◽

Yellow Leaf ◽

Degenerate Primers ◽

Tomato Plants ◽

First Report ◽

Biotype B ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (Geminiviridae) that causes a serious disease of tomato throughout the world. In 1997, the strain from Israel of TYLCV (TYLCV-IS) was found infecting tomatoes in Florida for the first time in the United States (1). During late spring of 2000, approximately 90% of the tomato plants (Lycopersicon esculentum) in a farm near New Orleans exhibited severe stunting, leaf cupping, and chlorosis. Symptoms were similar to those caused by TYLCV. Whiteflies (Bemisia tabaci biotype B) were present in the field but in relatively low numbers. The effect on yield reduction varied from negligible (late infections) to 100% (early infections). Six selected plants showing symptoms were assayed by polymerase chain reaction (PCR) using begomovirus-specific primers. Capsicum frutescens infected with an isolate of Texas pepper virus from Costa Rica was used as positive control. DNA was extracted using Plant DNAzol Reagent (GIBCO BRL). PCR was conducted using degenerate primers AV494/AC1048 that amplify the core coat protein region of most begomoviruses (2). PCR yielded a DNA fragment of approximately 550 bp, suggesting that a begomovirus was associated with the disease. The amplified DNA of one field isolate was cloned and the nucleotide (nt) sequence determined. Sequence comparisons with other begomoviruses in the GenBank Database indicated that the Louisiana isolate shared 100% nt identity with TYLCV-IS (GenBank Accession X76319). Successful transmission (100%) to Bonny Best tomato were obtained with four groups of 10 whiteflies each (B. tabaci biotype B) that fed on TYLCV-IS infected tomato plants. Acquisition and transmission feedings were for 2 days. In all cases, the virus was diagnosed by the ability to reproduce typical TYLCV-like symptoms in tomato and PCR. The virus was also successfully graft-transmitted to tomato cv. Bonny Best, Nicotiana benthamiana, and tomatillo (Physalis ixocarpa) using scions from tomato plants infected with a whitefly transmitted virus isolate. This is the first report of TYLCV-IS in Louisiana. References: (1) J. E. Polston et al. Plant Dis. 83:984–988, 1999. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288–1293, 1996.

Download Full-text

First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽

10.1094/pd-90-0379c ◽

2006 ◽

Vol 90 (3) ◽

pp. 379-379 ◽

Cited By ~ 13

Author(s):

K. S. Ling ◽

A. M. Simmons ◽

R. L. Hassell ◽

A. P. Keinath ◽

J. E. Polston

Keyword(s):

South Carolina ◽

The United States ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Pcr Products ◽

Primer Sequence ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text

First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽

10.1094/pdis-09-18-1558-pdn ◽

2019 ◽

Vol 103 (6) ◽

pp. 1437-1437 ◽

Cited By ~ 2

Author(s):

M. Granier ◽

L. Tomassoli ◽

A. Manglli ◽

M. Nannini ◽

M. Peterschmitt ◽

...

Keyword(s):

Resistance Gene ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Virus Recombinant ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

First report of natural infection of tomato yellow leaf curl virus on cucumber in China

Journal of Plant Pathology ◽

10.1007/s42161-020-00649-5 ◽

2020 ◽

Vol 102 (4) ◽

pp. 1371-1371

Author(s):

Feng Zhu ◽

Qin-Qin Zhang ◽

Peng-Xiang Zhu ◽

Qi-Ping Zhang ◽

Meng-Yao Cao ◽

...

Keyword(s):

Natural Infection ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus

Plant Disease ◽

10.1094/pdis.1999.83.12.1176d ◽

1999 ◽

Vol 83 (12) ◽

pp. 1176-1176 ◽

Cited By ~ 28

Author(s):

J. Reina ◽

G. Morilla ◽

E. R. Bejarano ◽

M. D. Rodríguez ◽

D. Janssen

Keyword(s):

Capsicum Annuum ◽

Blot Hybridization ◽

Tomato Yellow Leaf ◽

Southern Spain ◽

Yellow Leaf ◽

First Report ◽

Spanish Isolate ◽

Leaf Curl Virus ◽

Pepper Plants ◽

Leaf Curl

Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

Download Full-text