scholarly journals First Report of Tomato yellow leaf curl virus on Tomato Crops in Greece

Plant Disease ◽  
2001 ◽  
Vol 85 (6) ◽  
pp. 678-678 ◽  
Author(s):  
A. D. Avgelis ◽  
N. Roditakis ◽  
C. I. Dovas ◽  
N. I. Katis ◽  
C. Varveri ◽  
...  

In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodies to TYLCV-European (Adgen Ltd). The serological results were confirmed by PCR using two pairs of primers, universal degenerate (1) and MA 13 and MA 17 (2), amplifying different parts of the virus genome. The restriction fragment length polymorphism (RFLP) analysis (AluI, HaeIII, and TaqI) of the 541 bp amplicon obtained with the degenerate primers showed patterns similar to TYLCV-Is (Israeli species). The second pair of primers gave the expected 348 bp product, which was sequenced. Sequence comparisons revealed 99% identity with TYLCV-Is (EMBL no. X15656, X76319). The resulting sequence was at least 97.7% identical to sequences of TYLCV isolates from the Dominician Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Portugal (EMBL no. AF105975), Iran (EMBL no. AJ13271), and Spain (EMBL no. AF071228). The disease appeared for the first time in 1992 in Tymbaki, but was limited to very few plants in one glasshouse. However, the cause was not determined. To our knowledge, this is the first report of TYLCV of the Begomovirus genus in Greece. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) J. Navas-Castillo et al. J. Virol. Methods 75:195, 1998.

Plant Disease ◽  
2001 ◽  
Vol 85 (2) ◽  
pp. 230-230 ◽  
Author(s):  
R. A. Valverde ◽  
P. Lotrakul ◽  
A. D. Landry ◽  
J. E. Boudreaux

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (Geminiviridae) that causes a serious disease of tomato throughout the world. In 1997, the strain from Israel of TYLCV (TYLCV-IS) was found infecting tomatoes in Florida for the first time in the United States (1). During late spring of 2000, approximately 90% of the tomato plants (Lycopersicon esculentum) in a farm near New Orleans exhibited severe stunting, leaf cupping, and chlorosis. Symptoms were similar to those caused by TYLCV. Whiteflies (Bemisia tabaci biotype B) were present in the field but in relatively low numbers. The effect on yield reduction varied from negligible (late infections) to 100% (early infections). Six selected plants showing symptoms were assayed by polymerase chain reaction (PCR) using begomovirus-specific primers. Capsicum frutescens infected with an isolate of Texas pepper virus from Costa Rica was used as positive control. DNA was extracted using Plant DNAzol Reagent (GIBCO BRL). PCR was conducted using degenerate primers AV494/AC1048 that amplify the core coat protein region of most begomoviruses (2). PCR yielded a DNA fragment of approximately 550 bp, suggesting that a begomovirus was associated with the disease. The amplified DNA of one field isolate was cloned and the nucleotide (nt) sequence determined. Sequence comparisons with other begomoviruses in the GenBank Database indicated that the Louisiana isolate shared 100% nt identity with TYLCV-IS (GenBank Accession X76319). Successful transmission (100%) to Bonny Best tomato were obtained with four groups of 10 whiteflies each (B. tabaci biotype B) that fed on TYLCV-IS infected tomato plants. Acquisition and transmission feedings were for 2 days. In all cases, the virus was diagnosed by the ability to reproduce typical TYLCV-like symptoms in tomato and PCR. The virus was also successfully graft-transmitted to tomato cv. Bonny Best, Nicotiana benthamiana, and tomatillo (Physalis ixocarpa) using scions from tomato plants infected with a whitefly transmitted virus isolate. This is the first report of TYLCV-IS in Louisiana. References: (1) J. E. Polston et al. Plant Dis. 83:984–988, 1999. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288–1293, 1996.


Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.


Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.


Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  

Plant Disease ◽  
2000 ◽  
Vol 84 (9) ◽  
pp. 1046-1046 ◽  
Author(s):  
I. Font ◽  
P. Martínez-Culebras ◽  
C. Jordá

In autumn of 1999 and winter-spring 2000, tomato (Lycopersicon) crops grown in the Regions of Las Palmas de Gran Canaria and Tenerife (Canary Islands) showed upward curling of leaves, yellowing of leaf margins, crumpling of new leaves, reduction of leaflet area, and stunting of shoots. These symptoms were similar to those described for tomato yellow leaf curl disease. Symptomatic samples were collected from Las Palmas de Gran Canaria (33 samples) and Tenerife (45 samples) for polymerase chain reaction (PCR) identification analysis. The degenerate primers pair of Begomovirus (AV494/AC1048) (3) was used to amplify the “core” region of the capsid protein gene. Two tomato plants experimentally infected with Tomato yellow leaf curl virus-Is (TYLCVIs) or TYLCV-Sar served as positive controls. Electrophoretic analysis of all samples showed a single fragment of the expected size (550 bp). To identify the type of TYLCV (TYLCV-Sar or TYLCV-Is), the PCR products were digested by endonucleases (AluI, HaeIII, HpaII, RsaI, Sau3A, TaqI, DdeI, and ScrFI). Twenty-six samples from Las Palmas de Gran Canaria showed the same restriction pattern of TYLCV-Sar, and seven samples from Las Palmas de Gran Canaria and all 45 samples from Tenerife showed the same restriction pattern of TYLCV-Is. These results confirm that TYLCV-Sar and TYLCV-Is are present in Las Palmas de Gran Canaria and TYLCV-Is is present in Tenerife. The presence of TYLCV-Is in Morocco (2) and TYLCV-Sar in the Canary Islands and Morocco has been recently described (1). However, this is the first report of TYLCV-Is in the Canary Islands. References: (1) F. Monci et al. Plant Dis. 84:490, 2000. (2) M. Peterschmitt et al. Plant Dis. 83:1074, 1999. (3) S. D. Wyatt et al. Phytopathology 86:1288, 1996.


Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 430-430 ◽  
Author(s):  
Y. H. Ji ◽  
H. Zhang ◽  
K. Zhang ◽  
G. Li ◽  
S. Lian ◽  
...  

Whitefly-transmitted geminiviruses (WTGs) can cause serious damage to many crops in China, so an investigation of weed hosts of WTGs was carried out in Jiangsu Province, China, in 2012. Fifty-seven symptomless samples of Acalypha australis L., a common weed known as Asian copperleaf, were randomly collected from seven tomato fields in Nanjing and Lianyungang, Jiangsu Province, from July to September. Total DNA of each sample was extracted and PCR was performed using degenerate primers PA and PB to amplify a specific region covering the AV2 gene of DNA-A and part of the adjacent intergenic region (1). DNA fragments were successfully amplified from 27 out of 57 samples and PCR amplicons of 16 samples were sequenced. Alignment results showed that the nucleotide sequence identities ranged from 98 to 100% with Tomato yellow leaf curl virus (TYLCV) accessions. The full-length viral circular DNA genome was amplified using primer pair 1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and 1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) which were designed based on the known sequences amplified by PA and PB. The complete genome sequence (GenBank Accession No. JX910534) was 2,781 nucleotides in length and had 99 to 100% sequence identity with TYLCV accessions (GU434142, GU111505). The dot immunobinding assay using monoclonal antibody against TYLCV confirmed the 27 weed samples positive by PCR were infected by TYLCV. These results demonstrated that A. australis is a host of TYLCV that might play an important role in viral epidemics in tomato fields in China. TYLCV-infected A. australis did not show typical symptoms like leaf curl, chlorosis, and stunting and thus appears to be a symptomless host. In our investigation, the infection rate ranged from 14 to 79% depending on the field sampled, suggesting that the weed may be an important reservoir of TYLCV, especially during the non-tomato planting period. To our knowledge, this is the first report of A. australis as a host of TYLCV in China. Reference: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994.


Plant Disease ◽  
2002 ◽  
Vol 86 (12) ◽  
pp. 1404-1404 ◽  
Author(s):  
H. Delatte ◽  
B. Reynaud ◽  
J. M. Lett ◽  
M. Peterschmitt ◽  
M. Granier ◽  
...  

In April 2001, reduced leaf size, leaf curling, yellowing symptoms, and reduced yield were observed in tomato plants in the southwestern (Toliary, Morondava, Miandrivazo) and northern (Antsiranana) regions of Madagascar. Symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV, genus Begomovirus, family Geminiviridae). Large populations of Bemisia tabaci (Gennadius) were observed colonizing tomato, other crops, and weeds. Leaf samples were collected from tomato plants from 14 sites located in northern, central, and southern Madagascar. Two plant samples collected near Antsiranana, one sample near Morondava, and one sample near Toliary were positive in triple-antibody sandwich enzyme-linked immunosorbent assay using a begomovirus-specific antibody purchased from ADGEN (Nellies Gates, Auchincruive, Scotland, UK). A 500-bp product was amplified and cloned (2) from two leaf samples collected near Toliary and one near Morondava using a pair of degenerate primers that are expected to amplify a region of the A component of begomoviruses between the intergenic conserved nonanucleotide sequence and the first 200 nucleotides of the coat protein ORF. The sequences corresponding to the two Toliary samples (GenBank Accession Nos. AJ422123 and AJ422124) and the Morondava sample (GenBank No. AJ422125) showed the most significant alignments (NCBI, BLAST) with begomoviruses, Tobacco leaf curl virus from Zimbabwe (GenBank Accession No. AF 350330) and Tomato leaf curl virus from Tanzania (GenBank Accession No. U73498) with 76 to 77% nucleotide identity (Clustal method, MegAlign, DNASTAR, London) and South African cassava mosaic viruses (SACMV GenBank Accession Nos. AJ422132 and AF155806) and East African cassava mosaic viruses from Malawi (GenBank Accession Nos. AJ006459 and AJ006460) with 74 to 75.5% nucleotide identity. The low nucleotide identity suggests that the begomovirus isolated from tomato in Madagascar is a new species. Since the core region of the coat protein gene is a molecular marker for provisional classification of begomoviruses (1), this region was amplified for the Morondava isolate with degenerate primers. The 519nt core fragment obtained showed the most significant alignments with SACMV (GenBank Accession No. AF329227), Cassava geminivirus from Mozambique (GenBank Accession No. AF329240), and with TYLCV (GenBank Accession Nos. AB014346 and AF105975) with 81 to 82% nucleotide identity. According to the current taxonomic criteria (4), the begomovirus from Madagascar is a new one that is related to begomoviruses from the southern part of Africa and to TYLCV and is provisionally named Tomato yellow leaf curl Morondava virus (TYLCMV). Tomato yellow leaf curl disease was previously described in Madagascar by Reckhaus (3) who presumed that it was caused by TYLCV. Although symptoms in the tomato plant from which TYLCMV was isolated were similar to those induced by TYLCV, TYLCV was not detected in our samples. References: (1) J. K. Brown et al. Arch. Virol. 146:1581, 2001 (2) M. Peterschmitt et al. Plant Dis. 83:303, 1999. (3) P. Reckhaus, Maladies et ravageurs des cultures maraîchères: A l'exemple de Madagascar. GTZ, Weikersem, 1997. (4) M. H. V. van Regenmortel et al. Virus Taxonomy. Seventh Rep. Int. Comm. Taxon. Viruses. Academic Press, San Diego, 2000.


Plant Disease ◽  
2001 ◽  
Vol 85 (1) ◽  
pp. 84-87 ◽  
Author(s):  
N. E. Ahmed ◽  
H. O. Kanan ◽  
Y. Sugimoto ◽  
Y. Q. Ma ◽  
S. Inanaga

Confidor, an imidacloprid insecticide, was used in two applications at four rates (47.6, 71.4, 95.2, and 119 g a.i./ha) for indirectly controlling Tomato yellow leaf curl virus (TYLCV) in field plantings of tomato. This spray regimen was compared with standard applications of cypermethrins at 10- to 15-day intervals throughout the growing season. In three field trials, a combination of integrated pest management (IPM) practices and two applications of Confidor at the two highest rates immediately after planting and 6 weeks later, protected tomato plants against the disease until 12 weeks after sowing. All rates of Confidor reduced disease incidence compared with standard chemical control applied in an integrated strategy, and quantitative efficacy increased with increase of insecticide rate. In the three seasons, the mean incidence of TYLCV 12 weeks after sowing was 42.7% in plots not adopting IPM compared with 15.7% in those that did. Disease incidence was reduced by Confidor treatments to 2.2 to 17%. Confidor-treated plots consistently had higher yields than control plots, and the yields decreased with the decrease in the rate of Confidor application. Confidor offers several advantages over standard applications of cypermethrins to control TYLCV. When applied immediately after planting, its long-lasting systemic activity protected the crop against the disease during early stages of growth. In addition, it reduced the number of sprays and increased tomato yield.


Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 465-465 ◽  
Author(s):  
L. C. Papayiannis ◽  
A. Paraskevopoulos ◽  
N. I. Katis

Tomato yellow leaf curl is one of the most devastating virus diseases of tomato (Lycopersicon esculentum Mill) crops worldwide. Several whitefly-transmitted viruses are associated with the disease and all are assigned to the genus Begomovirus, family Geminiviridae. In Greece, Tomato yellow leaf curl virus (TYLCV) was first reported to infect greenhouse and open-field tomatoes in 2000 (2). During 2006, a survey was conducted in the southwestern part of Peloponnese (mainland) within the areas of Kyparissia and Filiatra (Perfecture of Messinia) to identify the prevalence and natural hosts of the disease. During this survey, yellow mosaic, severe leaf curling, and leaf crumple symptoms were observed in greenhouse bean plants (Phaseolus vulgaris) that were cultivated together with tomatoes showing typical TYLCV symptoms. In all affected greenhouses, the incidence of the disease ranged from 1 to 5% in beans and 90 to 100% in tomato plants. Both bean and tomato plants were highly infested with Bemisia tabaci (Gennadius) populations and produced unmarketable fruits. Twenty-four symptomatic bean plants were collected from four greenhouses that tested positive by triple-antibody sandwich-ELISA using TYLCV-specific antibodies purchased from NEOGEN, EUROPE, Ltd. DNA was extracted from all infected bean plants, and a 580-bp fragment of the coat protein gene was amplified by PCR using the TY(+)/TY(-) primer pair (1). Amplified fragments were then analyzed by restriction fragment length polymorphism with Ava II cutter enzyme. Two DNA fragments of 277 and 302 bp in agarose gels were produced from all isolates and the restriction pattern corresponded to TYLCV. The amplified DNA from four infected bean plants was cloned and sequenced. All four sequences were 100% identical (EMBL Accession No. AM418398) and showed 99% nucleotide identity to a TYLCV isolate from Italy (EMBL Accession No. DQ144621). To our knowledge, this is the first report of TYLCV infection of P. vulgaris, which is an important commercial crop in Messinia, Greece. Within the last decade, TYLCV has emerged as an important pathogen for several cultivated plants in many regions and different TYLCV variants have been reported to infect P. vulgaris (3). Bean is often used as an intercrop between tomato crops, and thus, infected plants may serve as a potential reservoir for virus survival and spread (4). References: (1) G. P. Accotto et al. Eur. J. Plant Pathol. 106:179, 2000. (2) A. D. Avgelis et al. Plant Dis. 85:678, 2001. (3) J. Morris et al. EPPO Bull. 32:41, 2002. (4) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.


2021 ◽  
Author(s):  
Wendy Marchant ◽  
Saurabh Gautam ◽  
Bhabesh Dutta ◽  
Rajagopalbab Srinivasan

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (“variant #2” and “variant #4”) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants’ concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than variant#2 in tomato plants. Despite differences in variants’ accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly-infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.


Sign in / Sign up

Export Citation Format

Share Document