First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F – 5’ AAGAGCGGCAGCTACAATAC 3’, CABYV RdRp-R – 5’ TGCCACATTCCGGTTCATAG 3’), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

Detection of Two Biotypes of Liriomyza chinensis (Diptera: Agromyzidae) in Japan

The larva of stone leek leafminer, Liriomyza chinensis (Kato), is known to infest alternately just below the epidermis and inner surface of hollow cylindrical leaves of allium crops, resulting in the formation of discontinuous linear mines (mine form: discontinuous). However, after the fall of 2016, a novel mine form of the same species (mine form: continuous) was detected in Welsh onion fields of Kyoto Prefecture, Japan. We hypothesized that these mine forms were associated with flies having different genetic backgrounds; hence, we compared the mine forms and the partial mtCOI gene of flies collected from Welsh onion fields from 2018 to 2019. The results demonstrated that the flies that emerged from different mine forms could be classified into two haplogroups, i.e., flies displaying a discontinuous mine form were of haplogroup A, whereas those that displayed continuous mines were of haplotype B. Additionally, using populations of these flies reared in the laboratory, we confirmed that the mine form of the larvae of haplotype A on Welsh onions was discontinuous, whereas that of haplotype B was continuous. We named the population that exhibited a discontinuous mine form as biotype A and the population displaying a continuous mine form as biotype B.

Insecticidal and inhibitory effects of Meliaceae and Asteraceae extracts to silverleaf whitefly

ABSTRACT Bemisia tabaci (Hemiptera: Aleyrodidae) is a polyphagous insect that causes direct and indirect damage on tomato. Spraying with synthetic insecticides is one of the main control tools for the whitefly; however, the abusive use of this tool can impact the environment and human beings. In this study we evaluated the bioactivity of extracts from plant species from Asteraceae and Meliaceae families on B. tabaci biotype B in tomato. A preliminary bioassay evaluated the effects of the extracts at 2% (w/v) on infestation and oviposition of this whitefly. Then, the nymphicidal and ovicidal effects of the chloroformic extract of Trichilia pallida - TP-Cl at six concentrations were performed. Finally, the TP-Cl LC50 was estimated. All extracts were repellent to the whitefly, except that ones from T. pallida (ethanolic) and Melia azedarach (hexanic), considered neutral at 24 h. All the extracts caused deterrence of oviposition. All concentrations of TP-Cl revealed nymphicidal activity and the highest ones provided the lowest egg viability averages. The estimated LC50 was 0.0955%. These results provide evidence for the potential of the extracts to be used as alternative control agents of B. tabaci biotype B in tomatoes.

Effect of varied soil moisture regimes on the growth and reproduction of two Australian biotypes of junglerice (Echinochloa colona)

Junglerice [Echinochloa colona (L.) Link] is a problematic weed in the northern grain region of Australia. Two pot experiments (Experiment 1 and Experiment 2) were conducted in a screen house to evaluate the growth and reproductive behavior of two biotypes (A, collected from a cotton (Gossypium hirsutum L.)–fallow; B, collected from a fence near a water channel) of E. colona in response to water stress (100%, 75%, 50%, and 25% water holding capacity [WHC]). Averaged across both biotypes, the plant height, biomass, and seed production of E. colona were reduced at 25% WHC compared with 100% WHC. However, E. colona still produced a considerable amount of seeds at 25% WHC (at least 365 seeds plant−1). Biotype A produced more seeds in the second experiment, while biotype B produced more seeds in the first experiment. In Experiment 2, at 100% WHC, biotype A produced more seeds (17,618 seeds plant−1) than biotype B (4,378 seeds plant−1), and similar observations were noticed for root biomass. Growth and seed production of E. colona at all moisture levels and environmental conditions ensure survival in an unpredictable environment and contribute to the weedy nature of this species. Results indicate that biotype A is more invasive than biotype B under favorable environmental conditions (100% WHC). This study suggests an enhanced competitive ability of some biotypes of E. colona in response to a range of environmental and soil moisture conditions in Australia. Under favorable environmental conditions, biotype A could be more problematic, as it has higher seed production than biotype B. Therefore, it is important to implement sustainable weed control methods for such biotypes in the early stages of crop growth to prevent loss of stored moisture.

Potential of Entomopathogenic Fungi as Biological Control Agents of Whitefly (Bemisia tabaci biotype B) (Genn.) (Hemiptera: Aleyrodidae)

The efficiency of isolates from entomopathogenic fungus Beauveria bassiana, Lecanicillium muscarium and Metarhizium rileyi in the control of eggs and third-instar nymphs of whitefly, Bemisia tabaci biotype B, was evaluated by pathogenicity and virulence tests, under laboratory conditions. For the pathogenicity tests, five leaflets of bean (Phaseolus vulgaris) plants containing 20 nymphs or 20 eggs of B. tabaci biotype B were used. The leaflets were immersed in suspension containing a concentration of 108 conidia/ml of each fungus isolate. Nymph mortality and egg viability were evaluated after seven days. The isolates that caused nymph mortality and egg viability above 80% were submitted to virulence tests, in order to estimate the lethal concentration (LC50) of each isolate. All isolates were pathogenic to eggs and third-instar nymphs of B. tabaci Biotype B. JAB07 of B. bassiana and LCMAP3790 of L. muscarium isolates presented the best results, with nymphs mortality of 96.68 ± 2.25% and 97.74 ± 1.56%, respectively. Additionally, JAB07 was the most virulent isolate, both for eggs and third-instar nymphs, with LC50 estimated of 0.012 and 0.006 × 103 conidia/ml, respectively. We suggest, future field trials are required in order to analyze the real efficiency of this isolate in the control of eggs and nymphs of B. tabaci biotype B in field conditions.

SELECTIVITY OF INSECTICIDES TO Encarsia hispida (Hymenoptera: Aphelinidae)

ABSTRACT The use of non-selective insecticides in agricultural production can reduce or eliminate biological agents that regulate insects that are undesirable to humans in production processes. Here, the toxicity of synthetic products on the parasitoid Encarsia hispida was evaluated, the host of which is the whitefly, Bemisia tabaci biotype B, found on cotton plants. The study was carried out using bioassays, in a completely randomized design in a factorial scheme. Pupae and adults of E. hispida were used in the bioassays, which had been sprayed with various chemicals (thiamethoxam, deltamethrin, imidacloprid, and pyriproxyfen) at different concentrations (1.0 g L-1, 1.0 mL L-1, 4.0 mL L-1, and 2.5 mL L-1). The control treatment was distilled water. Chemicals were topically placed in the dorsal region of the tegument of 1 and 3-day old pupae. Then, between 1 and 15-days of emergence of adult parasitoids, residual contact bioassay were used to determine the toxicity of the insecticides. The insecticides thiamethoxam and imidacloprid were harmless to the pupal stage of E. hispida, but were harmful to the adult stage. The insecticides deltamethrin and pyriproxyfen were harmful to both pupal and adult stages of E. hispida.

Predation and oviposition potential of Brazilian populations of the predatory mite Amblyseius tamatavensis (Acari: Phytoseiidae) on eggs of Bemisia tabaci (Insecta: Hemiptera)

Amblyseius tamatavensis has been reported from over 20 countries around the world, and is also widely distributed in Brazil. It has been reported as potentially useful for the control of Bemisia tabaci, a pest/vector insect of great economic importance worldwide. Some studies have reported some biological differences among phytoseiid populations. The objective of this work was to compare 14 populations of different regions of Brazil (from the states of Alagoas, Goiás, Minas Gerais and São Paulo; straight line distance between northern and southern extremes of 2,560 km) in relation to the predation and oviposition potential when fed with eggs of B. tabaci biotype B. The morphological characterization of these mites showed that the population from Olhos d'Agua das Flores (Alagoas state) and a population from mixed origin maintained in the laboratory for about 5 years were constituted by mites with larger dorsal and ventrianal shield dimensions and presented the highest rates of daily predation (respectively 7.9 and 7.0 eggs/ female) and oviposition (1.2 and 1.1 eggs/ female). A positive and significant relationship was observed between mean population predation and oviposition rates. The results suggest that subsequent efforts should focus on exploring the variability of mites of these two populations in relation to predation and oviposition potential, in order to select a new, more promising population to control B . tabaci biotype B.