First Report of Tomato yellow leaf curl virus in Louisiana

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (Geminiviridae) that causes a serious disease of tomato throughout the world. In 1997, the strain from Israel of TYLCV (TYLCV-IS) was found infecting tomatoes in Florida for the first time in the United States (1). During late spring of 2000, approximately 90% of the tomato plants (Lycopersicon esculentum) in a farm near New Orleans exhibited severe stunting, leaf cupping, and chlorosis. Symptoms were similar to those caused by TYLCV. Whiteflies (Bemisia tabaci biotype B) were present in the field but in relatively low numbers. The effect on yield reduction varied from negligible (late infections) to 100% (early infections). Six selected plants showing symptoms were assayed by polymerase chain reaction (PCR) using begomovirus-specific primers. Capsicum frutescens infected with an isolate of Texas pepper virus from Costa Rica was used as positive control. DNA was extracted using Plant DNAzol Reagent (GIBCO BRL). PCR was conducted using degenerate primers AV494/AC1048 that amplify the core coat protein region of most begomoviruses (2). PCR yielded a DNA fragment of approximately 550 bp, suggesting that a begomovirus was associated with the disease. The amplified DNA of one field isolate was cloned and the nucleotide (nt) sequence determined. Sequence comparisons with other begomoviruses in the GenBank Database indicated that the Louisiana isolate shared 100% nt identity with TYLCV-IS (GenBank Accession X76319). Successful transmission (100%) to Bonny Best tomato were obtained with four groups of 10 whiteflies each (B. tabaci biotype B) that fed on TYLCV-IS infected tomato plants. Acquisition and transmission feedings were for 2 days. In all cases, the virus was diagnosed by the ability to reproduce typical TYLCV-like symptoms in tomato and PCR. The virus was also successfully graft-transmitted to tomato cv. Bonny Best, Nicotiana benthamiana, and tomatillo (Physalis ixocarpa) using scions from tomato plants infected with a whitefly transmitted virus isolate. This is the first report of TYLCV-IS in Louisiana. References: (1) J. E. Polston et al. Plant Dis. 83:984–988, 1999. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288–1293, 1996.

Download Full-text

First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽

10.1094/pd-90-0379c ◽

2006 ◽

Vol 90 (3) ◽

pp. 379-379 ◽

Cited By ~ 13

Author(s):

K. S. Ling ◽

A. M. Simmons ◽

R. L. Hassell ◽

A. P. Keinath ◽

J. E. Polston

Keyword(s):

South Carolina ◽

The United States ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Pcr Products ◽

Primer Sequence ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text

First Report of Tomato yellow leaf curl virus on Tomato Crops in Greece

Plant Disease ◽

10.1094/pdis.2001.85.6.678c ◽

2001 ◽

Vol 85 (6) ◽

pp. 678-678 ◽

Cited By ~ 13

Author(s):

A. D. Avgelis ◽

N. Roditakis ◽

C. I. Dovas ◽

N. I. Katis ◽

C. Varveri ◽

...

Keyword(s):

Disease Incidence ◽

Rflp Analysis ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Comparisons ◽

Tomato Plants ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodies to TYLCV-European (Adgen Ltd). The serological results were confirmed by PCR using two pairs of primers, universal degenerate (1) and MA 13 and MA 17 (2), amplifying different parts of the virus genome. The restriction fragment length polymorphism (RFLP) analysis (AluI, HaeIII, and TaqI) of the 541 bp amplicon obtained with the degenerate primers showed patterns similar to TYLCV-Is (Israeli species). The second pair of primers gave the expected 348 bp product, which was sequenced. Sequence comparisons revealed 99% identity with TYLCV-Is (EMBL no. X15656, X76319). The resulting sequence was at least 97.7% identical to sequences of TYLCV isolates from the Dominician Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Portugal (EMBL no. AF105975), Iran (EMBL no. AJ13271), and Spain (EMBL no. AF071228). The disease appeared for the first time in 1992 in Tymbaki, but was limited to very few plants in one glasshouse. However, the cause was not determined. To our knowledge, this is the first report of TYLCV of the Begomovirus genus in Greece. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) J. Navas-Castillo et al. J. Virol. Methods 75:195, 1998.

Download Full-text

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽

10.1094/pdis-03-12-0258-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1229-1229 ◽

Cited By ~ 3

Author(s):

Y. H. Ji ◽

Z. D. Cai ◽

X. W. Zhou ◽

Y. M. Liu ◽

R. Y. Xiong ◽

...

Keyword(s):

Common Bean ◽

Large Population ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Alignments ◽

First Report ◽

Sequence Identity ◽

Leaf Curl Virus ◽

Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Download Full-text

First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽

10.1094/pdis-09-18-1558-pdn ◽

2019 ◽

Vol 103 (6) ◽

pp. 1437-1437 ◽

Cited By ~ 2

Author(s):

M. Granier ◽

L. Tomassoli ◽

A. Manglli ◽

M. Nannini ◽

M. Peterschmitt ◽

...

Keyword(s):

Resistance Gene ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Virus Recombinant ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

First Report of Tomato Yellow Leaf Curl Virus in Greenhouse Tomatoes in Kentucky

Plant Health Progress ◽

10.1094/php-2008-0819-01-rs ◽

2008 ◽

Vol 9 (1) ◽

pp. 12 ◽

Cited By ~ 3

Author(s):

P. B. de Sá ◽

K. W. Seebold ◽

P. Vincelli

Keyword(s):

Pathogen Detection ◽

The United States ◽

Tomato Yellow Leaf ◽

The State ◽

Yellow Leaf ◽

Greenhouse Production ◽

Tomato Plants ◽

Detection Approach ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), genus Begomovirus in the family Geminiviridae, was identified for the first time in the United States in Florida in 1997 and since then has been reported in other states on tomato in greenhouse and in field production environments. During 2005 symptoms typical of geminivirus infection were observed on tomato plants grown in a greenhouse production system in Jefferson Co., KY. A nucleic acid-based pathogen detection approach was used and TYLCV infection was confirmed in tomato plants collected from the greenhouse and in symptomless Acalypha ostryifolia growing outside the greenhouse. To our knowledge, A. ostryifolia has not been previously described as a host of this virus. This find raises concerns regarding the introduction of TYLCV to the state in infected transplants or in viruliferous whiteflies transported on infested plants, and its potential impact on economically important crops in the state. Accepted for publication 17 June 2008. Published 19 August 2008.

Download Full-text

First Report of Tomato Yellow Leaf Curl Virus in Réunion Island

Plant Disease ◽

10.1094/pdis.1999.83.3.303b ◽

1999 ◽

Vol 83 (3) ◽

pp. 303-303 ◽

Cited By ~ 22

Author(s):

M. Peterschmitt ◽

M. Granier ◽

R. Mekdoud ◽

A. Dalmon ◽

O. Gambin ◽

...

Keyword(s):

Tomato Yellow Leaf ◽

Economic Losses ◽

Enzyme Linked Immunosorbent Assay ◽

Yield Reduction ◽

Yellow Leaf ◽

Degenerate Primers ◽

Capsid Protein Gene ◽

Pcr Product ◽

Leaf Curl Virus ◽

Leaf Curl

In September 1997, stunting, reduced leaf size, leaf curling, and yellow margins were observed on tomato plants on a farm on the south coast of Réunion, a French island belonging to the Mascarenes archipelago. To our knowledge, these symptoms appeared to be characteristic of a tomato yellow leaf curl virus (TYLCV) infection. Diseased plants gave positive reactions with a triple antibody sandwich-enzyme-linked immunosorbent assay (TAS-ELISA), using ADGEN antibodies specific for begomoviruses (1). The serological results were confirmed by polymerase chain reaction (PCR) with a pair of degenerate primers—MP16, 5′-CCTCTAGATAATATTAC(C/T)(G/T)(G/A)(A/T)(T/G)G(G/A)CC-3′ and MP82, 5′-CGGAATTC(T/C)TGNAC(C/T)TT(G/A)CANGGNCC(T/C)T C(G/A)CA-3′—designed by Malla Padidam (ILTAB, San Diego, CA) to amplify a region of the A component of begomoviruses, between the intergenic conserved nonanucleotide sequence (TAATATTAC) and the first 5′ quarter of the capsid protein gene. A 500-bp PCR product was obtained from a symptomatic plant but not from a healthy looking one. After cloning the PCR product in a pGEM-T Easy vector (Promega, Madison, WI) and sequencing it with plasmid-specific primers (SP6, T7), the sequence was compared with the sequences of the NCBI data base, with the use of BLAST. Nineteen sequences among those producing the highest scoring segment pairs were compared with each other and with the 500-bp PCR product from Réunion by the Clustal method of MegAlign (DNASTAR, London). The Réunion sequence (AJ010790) was at least 94% similar to sequences of TYLCV isolates from the Dominican Republic (AF024715), Cuba (AJ223505), and Israel (X15656, X76319 for the mild clone). Based on these results, it appeared that the analyzed tomato plant was infected by a geminivirus isolate belonging to the Israeli species of TYLCV. A preliminary survey was carried out from December 1997 to April 1998 in both outdoor and protected tomato crops. Infected plants were detected by TAS-ELISA in 52 of the 123 locations visited. Severe economic losses were observed: 14 locations with 60 to 100% yield reduction and 11 locations with 40 to 60% yield reduction. All the infected samples were collected in the leeward coast, which is the driest region of the island. Although Bemisia tabaci (Gennadius) has been recorded since 1938 in Réunion (2), it has been observed on tomato crops only since 1997 and population levels were low compared with those of Trialeurodes vaporariorum Westwood. During the first six months of 1998, B. tabaci was found on Euphorbia heterophylla L., Lantana camara L., Solanum melongena L., S. nigrum L., and Phaseolus vulgaris L. These host plants often occur near infected tomato crops. References: (1) S. Macintosh et al. Ann. Appl. Biol. 121:297, 1992. (2) L. Russell and J. Etienne. Proc. Entomol. Soc. Wash. 87:202, 1985.

Download Full-text

First Report of Tomato yellow leaf curl virus-Is (TYLCV-Is) in the Canary Islands

Plant Disease ◽

10.1094/pdis.2000.84.9.1046c ◽

2000 ◽

Vol 84 (9) ◽

pp. 1046-1046 ◽

Cited By ~ 4

Author(s):

I. Font ◽

P. Martínez-Culebras ◽

C. Jordá

Keyword(s):

Canary Islands ◽

Restriction Pattern ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Capsid Protein Gene ◽

Gran Canaria ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

In autumn of 1999 and winter-spring 2000, tomato (Lycopersicon) crops grown in the Regions of Las Palmas de Gran Canaria and Tenerife (Canary Islands) showed upward curling of leaves, yellowing of leaf margins, crumpling of new leaves, reduction of leaflet area, and stunting of shoots. These symptoms were similar to those described for tomato yellow leaf curl disease. Symptomatic samples were collected from Las Palmas de Gran Canaria (33 samples) and Tenerife (45 samples) for polymerase chain reaction (PCR) identification analysis. The degenerate primers pair of Begomovirus (AV494/AC1048) (3) was used to amplify the “core” region of the capsid protein gene. Two tomato plants experimentally infected with Tomato yellow leaf curl virus-Is (TYLCVIs) or TYLCV-Sar served as positive controls. Electrophoretic analysis of all samples showed a single fragment of the expected size (550 bp). To identify the type of TYLCV (TYLCV-Sar or TYLCV-Is), the PCR products were digested by endonucleases (AluI, HaeIII, HpaII, RsaI, Sau3A, TaqI, DdeI, and ScrFI). Twenty-six samples from Las Palmas de Gran Canaria showed the same restriction pattern of TYLCV-Sar, and seven samples from Las Palmas de Gran Canaria and all 45 samples from Tenerife showed the same restriction pattern of TYLCV-Is. These results confirm that TYLCV-Sar and TYLCV-Is are present in Las Palmas de Gran Canaria and TYLCV-Is is present in Tenerife. The presence of TYLCV-Is in Morocco (2) and TYLCV-Sar in the Canary Islands and Morocco has been recently described (1). However, this is the first report of TYLCV-Is in the Canary Islands. References: (1) F. Monci et al. Plant Dis. 84:490, 2000. (2) M. Peterschmitt et al. Plant Dis. 83:1074, 1999. (3) S. D. Wyatt et al. Phytopathology 86:1288, 1996.

Download Full-text

First Report of Tomato yellow leaf curl virus in Acalypha australis in China

Plant Disease ◽

10.1094/pdis-10-12-0922-pdn ◽

2013 ◽

Vol 97 (3) ◽

pp. 430-430 ◽

Cited By ~ 5

Author(s):

Y. H. Ji ◽

H. Zhang ◽

K. Zhang ◽

G. Li ◽

S. Lian ◽

...

Keyword(s):

Tomato Yellow Leaf ◽

Jiangsu Province ◽

Yellow Leaf ◽

Degenerate Primers ◽

Circular Dna ◽

First Report ◽

Weed Hosts ◽

Total Dna ◽

Leaf Curl Virus ◽

Leaf Curl

Whitefly-transmitted geminiviruses (WTGs) can cause serious damage to many crops in China, so an investigation of weed hosts of WTGs was carried out in Jiangsu Province, China, in 2012. Fifty-seven symptomless samples of Acalypha australis L., a common weed known as Asian copperleaf, were randomly collected from seven tomato fields in Nanjing and Lianyungang, Jiangsu Province, from July to September. Total DNA of each sample was extracted and PCR was performed using degenerate primers PA and PB to amplify a specific region covering the AV2 gene of DNA-A and part of the adjacent intergenic region (1). DNA fragments were successfully amplified from 27 out of 57 samples and PCR amplicons of 16 samples were sequenced. Alignment results showed that the nucleotide sequence identities ranged from 98 to 100% with Tomato yellow leaf curl virus (TYLCV) accessions. The full-length viral circular DNA genome was amplified using primer pair 1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and 1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) which were designed based on the known sequences amplified by PA and PB. The complete genome sequence (GenBank Accession No. JX910534) was 2,781 nucleotides in length and had 99 to 100% sequence identity with TYLCV accessions (GU434142, GU111505). The dot immunobinding assay using monoclonal antibody against TYLCV confirmed the 27 weed samples positive by PCR were infected by TYLCV. These results demonstrated that A. australis is a host of TYLCV that might play an important role in viral epidemics in tomato fields in China. TYLCV-infected A. australis did not show typical symptoms like leaf curl, chlorosis, and stunting and thus appears to be a symptomless host. In our investigation, the infection rate ranged from 14 to 79% depending on the field sampled, suggesting that the weed may be an important reservoir of TYLCV, especially during the non-tomato planting period. To our knowledge, this is the first report of A. australis as a host of TYLCV in China. Reference: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994.

Download Full-text

First Report of Tomato yellow leaf curl virus in Mississippi

Plant Disease ◽

10.1094/pdis.2001.85.12.1287c ◽

2001 ◽

Vol 85 (12) ◽

pp. 1287-1287 ◽

Cited By ~ 8

Author(s):

D. M. Ingram ◽

A. Henn

Keyword(s):

Leaf Size ◽

The United States ◽

Tomato Yellow Leaf ◽

Production Operation ◽

Yellow Leaf ◽

Pcr Assay ◽

Tomato Production ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (family Geminiviridae) that causes severe chlorosis, stunting, and cupping of leaves in tomato (Lycopersicon esculentum) throughout the world. The disease was first reported in the United States in Florida in 1997 (2). In 2000, TYLCV was confirmed as the cause of severe chlorosis, stunting, and cupping of leaves in tomato in Louisiana (3). In January of 2001, mild symptoms consistent with TYLCV were observed in a greenhouse-tomato production operation in east-central Mississippi. Whiteflies (Bremisia tabaci) were present in the greenhouse during the previous month, but in relatively low numbers. Symptom severity slightly increased over time with chlorosis in the terminal, reduction in terminal leaf size, and upward cupping of leaves observed. Approximately 4% of plants in the greenhouse developed symptoms. Yield reductions are thought to be negligible since the tomato plants harbored most fruit for that growing season. Terminal growth was halted, and no additional flower production was observed. No symptoms were observed on mature fruit; however, fruit set after leaf symptoms developed remained stunted. A representative sample of symptomatic tissue was submitted to an independent lab (Agdia, Inc., Elkhart, IN), screened for whitefly-transmitted geminiviruses, and the results were positive. Additional symptomatic tomato tissue was submitted to the University Diagnostics Lab, University of Florida, Gainesville, and was observed for viral inclusion bodies. This test was positive for TYLCV based on morphology of virus particles located in the nucleus of tomato cells (1). Total DNA was extracted from the symptomatic plants for polymerase chain reaction (PCR) assay (2). Results from the PCR assay indicated the presence of TYLCV in symptomatic tomato tissue. The strain of the virus was not determined. To our knowledge, this is the first report of TYLCV in Mississippi. References: (1) B. Pico et al. Sci. Hortic. 67:151, 1996. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) R. A. Valderde et al. Plant Dis. 85:230, 2001.

Download Full-text

Introduction of the Exotic Monopartite Tomato yellow leaf curl virus into West Coast Mexico

Plant Disease ◽

10.1094/pd-90-1360a ◽

2006 ◽

Vol 90 (10) ◽

pp. 1360-1360 ◽

Cited By ~ 19

Author(s):

J. K. Brown ◽

A. M. Idris

Keyword(s):

United States ◽

The United States ◽

Tomato Yellow Leaf ◽

Caribbean Region ◽

Yellow Leaf ◽

Fresh Market ◽

Tomato Production ◽

Tomato Plants ◽

Leaf Curl Virus ◽

Leaf Curl

Leaf curl symptoms that are reminiscent of begomovirus (genus Begomovirus, family Geminiviridae) infection were observed widespread in the tomato crop during the early fall 2005 through the spring 2006 growing seasons in Sinaloa State, Mexico. Symptoms were widespread in three major valleys (Culiacan, Guasave, and Los Mochis) that are largely dedicated to fresh-market tomato production for the U.S. market from October to June. Symptoms included stunting of leaves, shortened internodes, distortion of leaf margins, and green vein banding. Fruit set was reduced significantly (as much as 90%) on the portion of the plant that developed above the point of symptom expression. Tomato fields were heavily infested with the B biotype of the whitefly Bemisia tabaci (Genn.) vector and no other insect vectors were noted in the fields. Total DNA was extracted from six symptomatic tomato plants (two from each valley) and used as template to amplify, clone, and sequence the core region of the begomovirus CP. BLAST analysis of begomovirus sequences available in the NCBI GenBank database indicated the closest match was the Old World monopartite begomovirus Tomato yellow leaf curl virus (TYLCV) from Israel (Accession No. X15656) at 97.8% shared nucleotide (nt) identity. The full-length genome was amplified for each of six isolates using TempliPhi (Amersham Biosciences, Piscataway, NJ) and cloned into the pGEM7 vector (Promega, Madison, WI). The complete DNA genome sequence was determined for eight clones by primer walking. Cloned TempliPhi products sequenced represented two to three isolates from each valley. Results indicated that the isolates (n = 8) were 98.9 to 100% identical (Accession No. DQ631892) to each other, and they shared 98% identity with TYLCV isolates reported from the Caribbean Region and Florida. This highly virulent begomovirus of tomato, originating in Israel, was first reported in Mexico from 1996 to 1997 when it was identified in tomato plants in the Yucatan Peninsula (1) (>1,500 miles from Sinaloa). The latter report followed the introduction of TYLCV in tomato seedlings from Florida into several eastern U.S. states (3,4) and then into Puerto Rico (2). The introduction of TYLCV into Sinaloa where tomato production is highly concentrated is significant because the region supplies the majority (as much as 93%) of fresh-market tomatoes to the western United States from October to June (>$750 million dollars). Of equal importance is the immediate proximity of the pandemic to California where more than 90% of the processing tomatoes in the United States are grown. References: (1) J. T. Ascencio-Ibáñez et al. Plant Dis. 83:1178, 1999. (2) J. Bird et al. Plant Dis. 85:1028, 2001. (3) M. T. Momol et al. Plant Dis 83:487, 1999. (4) J. E. Polston and P. K. Anderson, Plant Dis. 81:1358, 1997.

Download Full-text