Expansion of the Host Range of Impatiens necrotic spot virus to Peppers

2005 ◽  
Vol 6 (1) ◽  
pp. 28 ◽  
Author(s):  
Rayapati A. Naidu ◽  
Carl M. Deom ◽  
John L. Sherwood
Keyword(s):  
Host Range ◽  
Western Flower Thrips ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Weed Species ◽  
Spot Virus ◽  
Horticultural Crops ◽  
Flower Thrips ◽  
Tobacco Thrips ◽  
The U.S

This study reports the occurrence of Impatiens necrotic spot virus (INSV) on pepper under greenhouse conditions. In recent years, INSV has been detected in crops like peanut, tobacco, and potato as well as several weed species. Because INSV is vectored by western flower thrips and tobacco thrips, its expanding host range could make it an economically important problem in agricultural and horticultural crops in the U.S. Accepted for publication 11 July 2005. Published 27 July 2005.

scholarly journals First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

Plant Disease ◽  
2010 ◽  
Vol 94 (12) ◽  
pp. 1507-1507 ◽  
Author(s):  
J. M. Crosslin ◽  
L. L. Hamlin
Keyword(s):  
Frankliniella Occidentalis ◽  
Solanum Tuberosum L ◽  
Consensus Sequence ◽  
Western Flower Thrips ◽  
Alternaria Solani ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Feeding Damage ◽  
Rt Pcr ◽  
Spot Virus

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5′ TAACACAACACAAAGCAAACC 3′ and reverse: 5′ CCAAATACTACTTTAACCGCA 3′) (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.

scholarly journals First Report of Frankliniella fusca as a Vector of Impatiens necrotic spot tospovirus

Plant Disease ◽  
2001 ◽  
Vol 85 (11) ◽  
pp. 1211-1211 ◽  
Author(s):  
R. A. Naidu ◽  
C. M. Deom ◽  
J. L. Sherwood
Keyword(s):  
New York ◽  
Frankliniella Occidentalis ◽  
Western Flower Thrips ◽  
Adult Emergence ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Flower Thrips ◽  
Access Period ◽  
Thrips Species ◽  
Transmission Studies

Of more than a dozen members of the genus Tospovirus, Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) are among the most damaging viruses found in North America (3). TSWV is a major problem in vegetable and field crops, whereas INSV is commonly encountered in the floriculture and nursery industries. TSWV is transmitted by several thrips species, of which the western flower thrips (WFT, Frankliniella occidentalis Pergande) is the most predominant vector. INSV has been reported to be transmitted only by WFT (1). To determine if tobacco thrips (TT, F. fusca Hinds) can transmit INSV, a virus-free culture of TT was reared on detached peanut cv. Florunner leaves in 0.5-liter polypropylene cups with closed lids at 25 ± 2°C with constant light. Fresh peanut leaves were exchanged every 2 to 3 days to maintain the thrips colony. For transmission studies, adult thrips were confined on peanut leaves for 24 h for oviposition and then the peanut leaves, sans adults thrips, were transferred to a new cup. Leaves were examined daily for larval emergence, and similarly aged first instar larvae (<12 h old) were given an acquisition access period of 24 to 48 h on INSV-infected detached leaves of Emilia sonchifolia. The larvae were subsequently transferred to healthy peanut leaves and reared until adult emergence. Groups of 10 adults per plant were given a 48-h inoculation access period on 10-day-old healthy E. sonchifolia seedlings. Thrips were subsequently killed, and the plants were maintained in a growth chamber at 28 ± 2°C, and with a 16/8 light/dark photoperiod. Transmission studies were repeated 10 times with different sources of infected plants and different batches of larvae following acquisition access periods. Seven to ten days after inoculation, plants developed symptoms consisting of chlorotic spots, mosaic, and mottling. The presence of INSV in these symptomatic plants was confirmed by ELISA using INSV ImmunoStrip Test (Agdia, Inc., Elkhart, IN) and by reverse transcription-polymerase chain reaction assay with primers specific to the INSV-NSs gene. Our results demonstrate that TT can serve as a vector of INSV. INSV has been reported in peanut in the southeastern United States (2). WFT and TT transmit TSWV in peanuts, with the latter being the predominant vector species in Georgia and other parts of the region. TT transmission of INSV is of concern because of the increased incidence in recent years of INSV in peanuts and the potential for synergistic or gene exchange between TSWV and INSV, since mixed infections with both viruses have been observed (4). References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) S. S. Pappu et al. Plant Dis. 83:966, 1999. (3). J. L. Sherwood et al. Pages 1034–1040 in: Encyclopedia of Plant Pathology. C. Maloy and T. D. Murray, eds. John Wiley and Sons, Inc., New York, 2001. (4) L. Wells et al. Phytopathology (Abstr.) 94:S94, 2001.

Characterization and Epidemiology of Outbreaks of Impatiens necrotic spot virus on Lettuce in Coastal California

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1050-1059 ◽  
Author(s):  
Yen-Wen Kuo ◽  
Robert L. Gilbertson ◽  
Tom Turini ◽  
Eric B. Brennan ◽  
Richard F. Smith ◽  
...  
Keyword(s):  
United States ◽  
Frankliniella Occidentalis ◽  
Spinacia Oleracea ◽  
Disease Outbreaks ◽  
Central Valley ◽  
The United States ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Weed Species ◽  
Spot Virus

California is the leading producer of lettuce (Lactuca sativa) for the United States and grows 77% of the country's supply. Prior to 2006, coastal California lettuce was only periodically and incidentally infected by a single tospoviruses species: Tomato spotted wilt virus (TSWV). However, beginning in 2006 and continuing through 2012, severe outbreaks of disease caused by Impatiens necrotic spot virus (INSV) have affected the coastal lettuce crop, though TSWV was also present. In contrast, TSWV was the only tospovirus associated with disease outbreaks in Central Valley lettuce during this period. Disease surveys conducted over two seasons (2008 and 2009) in 10 commercial fields (acreage of 6 to 20 ha) indicated that INSV was the only tospovirus associated with economically damaging disease outbreaks in lettuce in the coastal region, with incidences of 0.5 to 27% (mean = 5.7%). Molecular characterization of INSV isolates associated with these disease outbreaks revealed little genetic diversity and indicated that lettuce-infecting INSV isolates were nearly identical to those previously characterized from ornamental or other hosts from different locations in the United States and the world. Monitoring of thrips revealed moderate to large populations in all surveyed lettuce fields, and the majority of thrips identified from these fields were western flower thrips, Frankliniella occidentalis. There was significant positive correlation (r2 = 0.91, P = 0.003) between thrips populations and INSV incidence in the most commonly encountered type of commercial lettuce (romaine, direct seeded, conventional) included in this study. A reverse-transcription polymerase chain reaction assay developed for detection of INSV in thrips showed promise as a monitoring tool in the field. Surveys for INSV reservoir hosts in the coastal production area revealed that the weeds little mallow (Malva parvifolia) and shepherd's purse (Capsella bursa-pastoris) were commonly infected. M. parvifolia plants infected in the field did not show obvious symptoms, whereas plants of this species inoculated in the laboratory with INSV by sap transmission developed necrotic spots and chlorosis. Eleven other weed species growing in the lettuce production areas were found to be hosts of INSV. Coastal crops found to be infected with INSV included basil (Ocimum basilicum), bell pepper (Capsicum annuum), calla lily (Zantedeschia aethiopica), faba bean (Vicia faba), radicchio (Cichorium intybus), and spinach (Spinacia oleracea). Thus, it is likely that INSV was introduced into coastal California lettuce fields via viruliferous thrips that initially acquired the virus from other local susceptible plant species. Results of this study provide a better understanding of INSV epidemiology in coastal California and may help growers devise appropriate disease management strategies.

scholarly journals First Report of Impatiens necrotic spot virus in the Czech Republic

Plant Disease ◽  
2000 ◽  
Vol 84 (9) ◽  
pp. 1045-1045 ◽  
Author(s):  
J. Mertelik ◽  
V. Mokra ◽  
B. Gotzova ◽  
S. Gabrielova
Keyword(s):  
Czech Republic ◽  
Plant Species ◽  
Frankliniella Occidentalis ◽  
Impatiens Necrotic Spot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Necrotic Spot ◽  
Weed Species ◽  
Stellaria Media ◽  
Spot Virus ◽  
The Czech Republic

Impatiens necrotic spot virus (INSV) was found for the first time in the Czech Republic in 1999 in Columnea sp. and Curcuma sp. plants that were imported. They were grown in a garden among other ornamental crops. By June 2000, INSV was detected in 17 ornamental plant species in several gardening establishments never having received imported plants. Frankliniella occidentalis thrips were present at the sites of INSV infection. Natural INSV infection was found also in Stellaria media, which is an important weed species in our conditions. INSV was identified by enzyme-linked immunosorbent assay using polyclonal antibodies to INSV from Loewe Biochemica, Germany, and from Bioreba, Switzerland. The virus was transmitted in sap to Nicotiana benthamiana and Datura stramonium (1). Virus particles typical of a tospovirus were detected by electron microscopy. INSV is the second tospovirus member occurring in the Czech Republic. Tomato spotted wilt virus (TSWV) has occurred in this country since 1992 (2) and to date has been detected in more than 100 plant species including ornamentals, vegetables, and weeds. TSWV became a serious problem in glasshouse grown crops. From the epidemiological point of view the situation of INSV dissemination seems to be similar to that of TSWV. References: (1) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) J. Mertelik and V. Mokra. Acta Virol. 42:348, 1998.

scholarly journals Detection of a Severe Isolate of Impatiens Necrotic Spot Virus Infecting Lisianthus in Florida

Plant Disease ◽  
1997 ◽  
Vol 81 (11) ◽  
pp. 1334-1334 ◽  
Author(s):  
R. J. McGovern ◽  
J. E. Polston ◽  
B. K. Harbaugh
Keyword(s):  
Leaf Tissue ◽  
Impatiens Necrotic Spot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Mechanical Transmission ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Eustoma Grandiflorum ◽  
Systemic Necrosis ◽  
Low Incidence ◽  
Leaf Distortion

In May 1997, inclusions typical of a tospovirus were visualized by light microscopy in leaf tissue of lisianthus (Eustoma grandiflorum) exhibiting stunting, necrotic ringspots, leaf distortion, and systemic necrosis. Wilting and plant death were the final symptoms observed. Affected plants occurred at low incidence (<0.1%) in greenhouse-grown lisianthus in Manatee County, FL. Symptomatic tissue tested positive for impatiens necrotic spot virus (INSV) and negative for tomato spotted wilt virus (TSWV) with enzyme-linked immunosorbent assay (ELISA; Agdia, Elkhart, IN). Mechanical transmission of the virus to lisianthus and tomato was attempted by triturating 1 g of symptomatic leaf tissue in 7 ml of a buffer consisting of 0.01 M Tris and 0.01 M sodium sulfite, pH 7.3. Six plants of lisianthus cv. Maurine Blue and three of tomato (Lycopersicon esculentum) cv. Lanai at the second true-leaf stage were inoculated following abrasion of leaves with Carborundum. An equal number of controls were inoculated with buffer alone. Plants were maintained in a controlled environment chamber with a 12-h photoperiod, day/night temperatures of 21/16°C, and light intensity of 120 μE · s-l · m-2. Transmission rates were 100 and 0% to lisianthus and tomato, respectively. Chlorotic local lesions followed by chlorotic ringspots were observed in inoculated lisianthus leaves 4 days after inoculation. Stunting, leaf distortion, and necrotic ringspots appeared in noninoculated leaves of lisianthus plants within 3 to 4 weeks after inoculation. Buffer-inoculated lisianthus and all tomato plants remained symptomless and tested negative for INSV by ELISA. All symptomatic lisianthus tested positive for INSV by ELISA. The symptoms we observed in lisianthus due to infection by INSV were more severe than those previously reported in this host (1,2). The occurrence of such strains of INSV at high incidences could pose a significant threat for commercial lisianthus production. References: (1) M. K. Hausbeck et al. Plant Dis. 76:795, 1992. (2) H. T. Hsu and R. H. Lawson. Plant Dis. 75:292,1991.

scholarly journals First Report on the Multiplication of Tomato Spotted Wilt Tospovirus in Tobacco Thrips, Frankliniella fusca

Plant Disease ◽  
1998 ◽  
Vol 82 (11) ◽  
pp. 1282-1282 ◽  
Author(s):  
H. R. Pappu ◽  
J. W. Todd ◽  
A. K. Culbreath ◽  
M. D. Bandla ◽  
J. L. Sherwood
Keyword(s):  
Virus Replication ◽  
Virus Detection ◽  
Western Flower Thrips ◽  
Enzyme Linked Immunosorbent Assay ◽  
Vector Species ◽  
Flower Thrips ◽  
Tomato Spotted Wilt ◽  
Frankliniella Fusca ◽  
Tobacco Thrips ◽  
Individual Adult

In Georgia, tomato spotted wilt tospovirus (TSWV) causes significant losses in peanut, tobacco, tomato, and pepper. Transmission of TSWV in Georgia primarily is by tobacco thrips (TT), Frankliniella fusca (Hinds), and western flower thrips, F. occidentalis (Pergande), with TT being the predominant vector species in peanut (2). TSWV must be acquired at the larval stage for the adult to transmit the virus. Detection of NSs (a non-structural TSWV protein present only following virus replication) in thrips by enzyme-linked immunosorbent assay (ELISA) is a reliable indicator that the virus had multiplied in the vector and thus the vector is competent to transmit TSWV. While this has been accomplished with F. occidentalis (1), information is lacking for F. fusca, the predominant vector in Georgia and other states in the Southeast. Thus, the nature of the TSWV-TT association was investigated and the proportion of transmitters in a field population determined in 1,436 individual adult TT collected from sticky cards positioned in selected peanut fields in south Georgia. Additionally, 650 larvae collected from volunteer peanut plants were reared to adults in the laboratory and the resulting 295 adult TT were individually evaluated by ELISA. Of those collected from the sticky cards, NSs was detected in 8% of the adult insects, indicating that the virus had multiplied in TT. NSs was not detected in control TT that had no access to the virus. Of the adult TT that emerged from larvae collected from volunteer peanuts, 6.1% were positive for NSs. Our study provides the first immunological evidence that TSWV multiplies in TT. References: (1) M. D. Bandla et al. Phytopathology 84:1427, 1994. (2) J. R. Chamberlin et al. J. Econ. Entomol. 86:40, 1993.

scholarly journals First Report of Yellow Nutsedge (Cyperus esculentus) and Purple Nutsedge (C. rotundus) in Georgia Naturally Infected with Impatiens necrotic spot virus

Plant Disease ◽  
2004 ◽  
Vol 88 (7) ◽  
pp. 771-771 ◽  
Author(s):  
N. Martínez-Ochoa ◽  
S. W. Mullis ◽  
A. S. Csinos ◽  
T. M. Webster
Keyword(s):  
Southeastern United States ◽  
Impatiens Necrotic Spot Virus ◽  
Cyperus Esculentus ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
Black Shank ◽  
Purple Nutsedge ◽  
Yellow Nutsedge ◽  
Das Elisa

Impatiens necrotic spot virus (INSV), family Bunyaviridae, genus Tospovirus, is an emerging virus found mostly in ornamentals under greenhouse production. INSV has been detected in peanut (Arachis hypogaea L.) in Georgia and Texas (3) and recently in tobacco (Nicotiana tabacum L.) in the southeastern United States (2) but little is known about INSV distribution and impact on these crops. Noncrop plant hosts are likely to contribute to disease spread by serving as reservoirs for the virus and reproductive hosts for thrips (Frankliniella occidentalis Pergande), which transmit the virus. Yellow nutsedge, a native of North America, and purple nutsedge introduced from Eurasia, are considered serious weed problems in the southeastern United States. To date, there are no reports of natural INSV infections in these weeds. A survey was conducted at two research farms in Tift County, Georgia to determine if yellow and purple nutsedge plants were naturally infected with Tomato spotted wilt virus (TSWV) and INSV. The first field at the Black Shank Farm had been planted with flue-cured tobacco K-326 earlier in the year and fallow at the time of sampling. The second field at the Ponder Farm was planted at the time of sampling with yellow squash (Cucurbita pepo L.) and cabbage (Brassica oleracea L.). In early October 2002, 90 nutsedge plants were taken at random from each site. Leaf and root tissues of each of the nutsedge plants were tested for TSWV and INSV using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) alkaline phosphatase antisera kits (Agdia Inc., Elkhart, IN). No visible symptoms of INSV or TSWV were observed. Samples from the field at the Black Shank Farm resulted in 2 of 26 positive for INSV in purple nutsedge plants and 6 of 64 in yellow nutsedge plants. At the Ponder Farm, 3 of 12 were positive for INSV in purple nutsedge plants and 14 of 78 in yellow nutsedge plants. None of the samples in either site tested positive for TSWV. The DAS-ELISA positive samples were verified for INSV using reverse transcription-polymerase chain reaction (RT-PCR) as previously described by Dewey et al. (1). Total RNA extracts were obtained from the DAS-ELISA positive nutsedge samples using RNeasy extraction kits (Qiagen Inc., Valencia, CA). The RT-PCR was carried out with primer 1F: 5′-TCAAG(C/T) CTTC(G/T)GAA(A/G)GTGAT 3′ (1) and primer 2R: 5′-ATGAACAAAGCAAAGATTACC 3′ specific to the 3′ end of the INSV N gene open reading frame (GenBank Accession No. NC003624). DAS-ELISA negative tissues of Cyperus esculentus L. and Emilia sonchifolia (L.) DC and an E. sonchifolia DAS-ELISA positive for INSV were included in the reactions as controls. All of the DAS-ELISA positive nutsedge samples yielded an amplification product with the expected size of 298 bp when PCR products were resolved by agarose (0.7%) gel electrophoresis. The relatively high occurrence of INSV found in the sampled fields may explain the recent increase in incidence of INSV in susceptible field crops. Although yellow nutsedge is more common than purple nutsedge in North America, the potential for dispersal of INSV in both species could be significant because of the nature of nutsedge tuber survival and spreading capabilities. References: (1) R. A. Dewey et al. J. Virol. Methods 56:19, 1996. (2) N. Martínez-Ochoa et al. On-line publication. doi:10.1094/PHP-2003-0417-01-HN. Plant Health Progress, 2003. (3) S. S. Pappu et al. Plant Dis. 83:966,1999.

Sign in / Sign up

Export Citation Format

Share Document