First Report of Impatiens necrotic spot virus in Ornamental Plants in Hungary

Economically important viruses such as Tomato spotted wilt virus, genus Tospovirus, are transmissible mechanically and mainly by two thrips species (Thrips tabaci and Frankliniella occidentalis) in Hungary (1). Samples (31) of eight ornamental plant species (Catharanthus roseus, Cyclamen persicum, Dendranthema × grandiflorum, Eustoma grandiflorum, Gerbera sp., Impatiens walleriana, Ocimum basilicum, and Verbena hybrida) were studied. Symptoms including color breaking on flowers and necrotic symptoms on leaves were observed on four samples (C. persicum, I. walleriana, O. basilicum, and E. grandiflorum). Infection by Impatiens necrotic spot virus (INSV) was determined by double-antibody sandwich-ELISA and triple-antibody sandwich-ELISA using antisera obtained from Loewe (Sauerlach, Germany) and the DSMZ. Back inoculation with the F. occidentalis vector was also carried out to Lycopersicon esculentum as indicator plants. Back inoculation was also positive for INSV by symptoms and ELISA. The high amount of ornamental plant production together with the use of virus-infected propagation material and the increasing thrips vector populations may result in significantly increased establishment and distribution of INSV in Hungary. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997.

Download Full-text

Detection of a Severe Isolate of Impatiens Necrotic Spot Virus Infecting Lisianthus in Florida

Plant Disease ◽

10.1094/pdis.1997.81.11.1334b ◽

1997 ◽

Vol 81 (11) ◽

pp. 1334-1334 ◽

Cited By ~ 3

Author(s):

R. J. McGovern ◽

J. E. Polston ◽

B. K. Harbaugh

Keyword(s):

Leaf Tissue ◽

Impatiens Necrotic Spot Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Mechanical Transmission ◽

Necrotic Spot ◽

Spot Virus ◽

Eustoma Grandiflorum ◽

Systemic Necrosis ◽

Low Incidence ◽

Leaf Distortion

In May 1997, inclusions typical of a tospovirus were visualized by light microscopy in leaf tissue of lisianthus (Eustoma grandiflorum) exhibiting stunting, necrotic ringspots, leaf distortion, and systemic necrosis. Wilting and plant death were the final symptoms observed. Affected plants occurred at low incidence (<0.1%) in greenhouse-grown lisianthus in Manatee County, FL. Symptomatic tissue tested positive for impatiens necrotic spot virus (INSV) and negative for tomato spotted wilt virus (TSWV) with enzyme-linked immunosorbent assay (ELISA; Agdia, Elkhart, IN). Mechanical transmission of the virus to lisianthus and tomato was attempted by triturating 1 g of symptomatic leaf tissue in 7 ml of a buffer consisting of 0.01 M Tris and 0.01 M sodium sulfite, pH 7.3. Six plants of lisianthus cv. Maurine Blue and three of tomato (Lycopersicon esculentum) cv. Lanai at the second true-leaf stage were inoculated following abrasion of leaves with Carborundum. An equal number of controls were inoculated with buffer alone. Plants were maintained in a controlled environment chamber with a 12-h photoperiod, day/night temperatures of 21/16°C, and light intensity of 120 μE · s-l · m-2. Transmission rates were 100 and 0% to lisianthus and tomato, respectively. Chlorotic local lesions followed by chlorotic ringspots were observed in inoculated lisianthus leaves 4 days after inoculation. Stunting, leaf distortion, and necrotic ringspots appeared in noninoculated leaves of lisianthus plants within 3 to 4 weeks after inoculation. Buffer-inoculated lisianthus and all tomato plants remained symptomless and tested negative for INSV by ELISA. All symptomatic lisianthus tested positive for INSV by ELISA. The symptoms we observed in lisianthus due to infection by INSV were more severe than those previously reported in this host (1,2). The occurrence of such strains of INSV at high incidences could pose a significant threat for commercial lisianthus production. References: (1) M. K. Hausbeck et al. Plant Dis. 76:795, 1992. (2) H. T. Hsu and R. H. Lawson. Plant Dis. 75:292,1991.

Download Full-text

First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

Plant Disease ◽

10.1094/pdis-07-10-0542 ◽

2010 ◽

Vol 94 (12) ◽

pp. 1507-1507 ◽

Cited By ~ 7

Author(s):

J. M. Crosslin ◽

L. L. Hamlin

Keyword(s):

Frankliniella Occidentalis ◽

Solanum Tuberosum L ◽

Consensus Sequence ◽

Western Flower Thrips ◽

Alternaria Solani ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Feeding Damage ◽

Rt Pcr ◽

Spot Virus

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5′ TAACACAACACAAAGCAAACC 3′ and reverse: 5′ CCAAATACTACTTTAACCGCA 3′) (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.

Download Full-text

Distribution and Transmission of Iris yellow spot virus

Plant Disease ◽

10.1094/pdis.2001.85.8.838 ◽

2001 ◽

Vol 85 (8) ◽

pp. 838-842 ◽

Cited By ~ 67

Author(s):

A. Kritzman ◽

M. Lampel ◽

B. Raccah ◽

A. Gera

Keyword(s):

Frankliniella Occidentalis ◽

Thrips Tabaci ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

Onion Thrips ◽

Spot Virus ◽

Nucleocapsid Gene ◽

Thrips Species ◽

Mother Plants ◽

Thrips Population

Iris yellow spot virus (IYSV), a new tospovirus associated with a disease in onion (Allium cepa) that is known to growers in Israel as “straw bleaching,” was identified and further characterized by host range, serology, electron microscopy, and molecular analysis of the nucleocapsid gene. The transmissibility of IYSV by Thrips tabaci and Frankliniella occidentalis was studied. IYSV was efficiently transmitted by T. tabaci from infected to healthy onion seedlings and leaf pieces. Two biotypes of F. occidentalis, collected from two different locations in Israel, failed to transmit the virus. Surveys to relate the incidence of thrips populations to that of IYSV were conducted in onion fields. They revealed that the onion thrips T. tabaci was the predominant thrips species, and that its incidence was strongly related to that of IYSV. Forty-five percent of the thrips population collected from IYSV-infected onion and garlic fields in Israel transmitted the virus. IYSV was not transmitted to onion seedlings from infected mother plants through the seed, and was not located in bulbs of infected plants.

Download Full-text

First Report of Impatiens necrotic spot virus Infecting Lettuce in California

Plant Disease ◽

10.1094/pdis-92-8-1248a ◽

2008 ◽

Vol 92 (8) ◽

pp. 1248-1248 ◽

Cited By ~ 4

Author(s):

S. T. Koike ◽

Y.-W. Kuo ◽

M. R. Rojas ◽

R. L. Gilbertson

Keyword(s):

Frankliniella Occidentalis ◽

Disease Incidence ◽

Pcr Analysis ◽

Impatiens Necrotic Spot Virus ◽

Vegetable Crops ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

Monterey County

Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) is an important pathogen of ornamental plants in North America and Europe, particularly in the greenhouse industry (2,3). However, INSV is now emerging as a pathogen of vegetable crops. During the 2006 and 2007 growing seasons, lettuce (Lactuca sativa) in Monterey County, CA showed necrotic spotting, leaf chlorosis, and plant stunting typical of symptoms induced by Tomato spotted wilt virus (TSWV). Significant and damaging outbreaks of these disease symptoms were found in numerous romaine, greenleaf, redleaf, butterhead, and iceberg lettuce fields in Monterey and San Benito counties. Samples from symptomatic plants from 21 of 27 fields in Monterey County were negative when tested with TSWV immunostrips (Agdia, Elkhart, IN); however, tests of the TSWV-negative samples with INSV immunostrips were positive. In most fields where INSV was detected, disease development was limited to the edges of fields and disease incidence was <5%; however, some fields had incidences >50% and crop loss was experienced. The virus causing the tospovirus symptoms in the TSWV-negative lettuce was sap transmitted to Nicotiana benthamiana and lettuce, where it induced chlorosis and necrosis. Symptoms in N. benthamiana were consistent with INSV infection, and those in lettuce were similar to symptoms observed in the field. Immunostrip tests confirmed that symptomatic N. benthamiana and lettuce plants were infected with INSV. To further confirm the identity of this virus, reverse transcription (RT)-PCR analysis was conducted with an INSV primer pair that directs the amplification of a ~1.3-kb fragment from the small RNA of INSV (4). The 1.3-kb fragment was amplified from RNA from symptomatic lettuce plants that were INSV positive with immunostrips, and not from asymptomatic lettuce. A total of 38 of 54 samples showing tospovirus-like symptoms were confirmed to be infected with INSV by RT-PCR. Sequences of two representative 1.3-kb DNA fragments were 98 to 99% identical with sequences of INSV isolates from Japan, Italy, and The Netherlands (GenBank Accession Nos. AB109100, DQ425096, and X66972). Taken together with the previous identification of the INSV vector, the western flower thrips (Frankliniella occidentalis), in central California lettuce (1), these results confirm that INSV induced tospovirus symptoms in lettuce fields in Monterey County in 2007. To our knowledge, this is the first report of the occurrence of INSV infecting lettuce in California. References: (1) W. E. Chaney. Annu. Rep. California Lettuce Res. Board. 2006. (2) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (3) M. D. Law and J. W. Moyer. J. Gen. Virol. 71:933, 1990. (4) R. A. Naidu et al. Online publication. doi: 10.1094/PHP-2005-0727-01-HN. Plant Health Progress, 2005.

Download Full-text

First Report of Frankliniella fusca as a Vector of Impatiens necrotic spot tospovirus

Plant Disease ◽

10.1094/pdis.2001.85.11.1211c ◽

2001 ◽

Vol 85 (11) ◽

pp. 1211-1211 ◽

Cited By ~ 16

Author(s):

R. A. Naidu ◽

C. M. Deom ◽

J. L. Sherwood

Keyword(s):

New York ◽

Frankliniella Occidentalis ◽

Western Flower Thrips ◽

Adult Emergence ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Flower Thrips ◽

Access Period ◽

Thrips Species ◽

Transmission Studies

Of more than a dozen members of the genus Tospovirus, Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) are among the most damaging viruses found in North America (3). TSWV is a major problem in vegetable and field crops, whereas INSV is commonly encountered in the floriculture and nursery industries. TSWV is transmitted by several thrips species, of which the western flower thrips (WFT, Frankliniella occidentalis Pergande) is the most predominant vector. INSV has been reported to be transmitted only by WFT (1). To determine if tobacco thrips (TT, F. fusca Hinds) can transmit INSV, a virus-free culture of TT was reared on detached peanut cv. Florunner leaves in 0.5-liter polypropylene cups with closed lids at 25 ± 2°C with constant light. Fresh peanut leaves were exchanged every 2 to 3 days to maintain the thrips colony. For transmission studies, adult thrips were confined on peanut leaves for 24 h for oviposition and then the peanut leaves, sans adults thrips, were transferred to a new cup. Leaves were examined daily for larval emergence, and similarly aged first instar larvae (<12 h old) were given an acquisition access period of 24 to 48 h on INSV-infected detached leaves of Emilia sonchifolia. The larvae were subsequently transferred to healthy peanut leaves and reared until adult emergence. Groups of 10 adults per plant were given a 48-h inoculation access period on 10-day-old healthy E. sonchifolia seedlings. Thrips were subsequently killed, and the plants were maintained in a growth chamber at 28 ± 2°C, and with a 16/8 light/dark photoperiod. Transmission studies were repeated 10 times with different sources of infected plants and different batches of larvae following acquisition access periods. Seven to ten days after inoculation, plants developed symptoms consisting of chlorotic spots, mosaic, and mottling. The presence of INSV in these symptomatic plants was confirmed by ELISA using INSV ImmunoStrip Test (Agdia, Inc., Elkhart, IN) and by reverse transcription-polymerase chain reaction assay with primers specific to the INSV-NSs gene. Our results demonstrate that TT can serve as a vector of INSV. INSV has been reported in peanut in the southeastern United States (2). WFT and TT transmit TSWV in peanuts, with the latter being the predominant vector species in Georgia and other parts of the region. TT transmission of INSV is of concern because of the increased incidence in recent years of INSV in peanuts and the potential for synergistic or gene exchange between TSWV and INSV, since mixed infections with both viruses have been observed (4). References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) S. S. Pappu et al. Plant Dis. 83:966, 1999. (3). J. L. Sherwood et al. Pages 1034–1040 in: Encyclopedia of Plant Pathology. C. Maloy and T. D. Murray, eds. John Wiley and Sons, Inc., New York, 2001. (4) L. Wells et al. Phytopathology (Abstr.) 94:S94, 2001.

Download Full-text

First Report of Impatiens necrotic spot virus in Gentiana macrophylla in China

Plant Disease ◽

10.1094/pdis-09-10-0685 ◽

2011 ◽

Vol 95 (3) ◽

pp. 357-357 ◽

Cited By ~ 1

Author(s):

M. Ding ◽

Y. Yin ◽

Q. Fang ◽

S. Li ◽

Z. Zhang

Keyword(s):

Sandwich Elisa ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Natural Occurrence ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

Severe Stunting ◽

Gentiana Macrophylla

Large leaf gentian, Gentiana macrophylla Pall., known as Qin Jiao in Chinese, is a medicinal herb. Its root is most commonly used in Chinese traditional medicine to relieve rheumatic conditions and to remove damp-heat. During a survey in July 2009, large leaf gentian plants exhibiting foliar chlorotic and necrotic spots as well as severe stunting were collected in Lijiang County, Yunnan Province of China. Incidence of symptomatic plants ranged from 10 to 30% in the field. Symptomatic leaves from five different G. macrophylla plants were collected and tested for Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus, Watermelon silver mottle virus, Groundnut bud necrosis virus, Tomato chlorotic spot virus, and Groundnut ringspot virus by double-antibody sandwich-ELISA kits (Agdia Inc., Elkhart, IN). All tested samples were positive only for INSV. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic large leaf gentian plants leaves with a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-CTT TGC TTT TTA GAA CTG TGC A-3′) and reverse (5′-AGA GCA ATT GTG TCA CGA ATA T-3′) primers specific to the partial INSV nucleoprotein (N) gene (GenBank No. DQ425096). Amplicons of the expected size (approximately 760 bp) were obtained from all ELISA-positive samples. Three clones were sequenced and the partial nucleocapsid protein genes consensus sequences of these isolates were determined (GenBank No. HQ317133). Nucleotide sequences of large leaf gentian isolates shared 98 to 99% nucleotide identity with INSV sequences of isolates from China, Italy, Japan, United States, and the Netherlands (GenBank Nos. FN400772, GQ336989, DQ425096, AB109100, D00914, AB109100, and X66972). INSV is one of the most serious viral pathogens of ornamental plants in North America, Europe, and Asia (1–3). To our knowledge, this is the first report of natural occurrence of INSV in G. macrophylla in China. References: (1) S. T. Koike. Plant Dis. 92:1248, 2008. (2) E. K. Tóth et al. Plant Dis. 91:331, 2007. (3) Q. Zhang et al. Plant Dis. 94:915, 2010.

Download Full-text

Variation within Lactuca spp. for Resistance to Impatiens necrotic spot virus

Plant Disease ◽

10.1094/pdis-06-17-0790-re ◽

2018 ◽

Vol 102 (2) ◽

pp. 341-348 ◽

Cited By ~ 1

Author(s):

Ivan Simko ◽

Claire E. Richardson ◽

William M. Wintermantel

Keyword(s):

Host Plants ◽

Frankliniella Occidentalis ◽

The United States ◽

Impatiens Necrotic Spot Virus ◽

Insect Vector ◽

Necrotic Spot ◽

Spot Virus ◽

Susceptible Host ◽

Breeding Lines ◽

Plant Introductions

Lettuce (Lactuca sativa L.) production in coastal California, one of the major lettuce-producing areas of the United States, is regularly affected by outbreaks of Impatiens necrotic spot virus (INSV), a member of the genus Orthotospovirus. Transmission of INSV among lettuce crops in this growing region has been attributed predominantly to the western flower thrips (Frankliniella occidentalis). INSV is acquired by first- or second-instar thrips nymphs feeding on infected host plants (not necessarily lettuce). The virus replicates within the insect vector, and is transmitted to new plants by adult thrips as they feed on epidermal and mesophyll cells of susceptible host plants. All currently grown cultivars of lettuce are susceptible to the disease. Screening lettuce for resistance to INSV under field conditions is problematic because natural infections appear sporadically and the virus is not evenly distributed across infected fields. We have developed a greenhouse-based assay that uses viruliferous thrips in combination with mechanical inoculation that allows dependable, year-round screening for resistance. In all, 89 cultivars, breeding lines, and plant introductions of cultivated lettuce, together with 53 accessions from 11 other Lactuca spp., 4 accessions from two dandelion (Taraxacum) species, and 4 tomato (Solanum lycopersicum L.) lines were evaluated for resistance to INSV. All tested material was susceptible to INSV to varying degrees, with the exception of two tomato lines that carry the Sw-5 gene that confers resistance to Tomato spotted wilt virus, a virus closely related to INSV. In cultivated lettuce, a partial resistance to INSV was observed in cultivars Amazona, Ancora, Antigua, Commodore, Eruption, Iceberg, La Brillante, Merlot, Telluride, and Tinto. Limited comparison of the greenhouse-based screening results with the data from opportunistic evaluations of resistance on 775 lettuce accessions from six field trials indicates consistency of results from both greenhouse and field environments. The most resistant lettuce accessions are being incorporated into our breeding program for introgression of resistance into lettuce breeding lines.

Download Full-text

Detecting a Tospovirus in trapped thrips

New Zealand Plant Protection ◽

10.30843/nzpp.2009.62.4857 ◽

2009 ◽

Vol 62 ◽

pp. 408-408

Author(s):

R.A. Lister ◽

M-C. Nielsen ◽

M.M. Davidson ◽

J.D. Fletcher ◽

G.M. Timmerman-Vaughan

Keyword(s):

New Zealand ◽

Frankliniella Occidentalis ◽

Thrips Tabaci ◽

Universal Primers ◽

Impatiens Necrotic Spot Virus ◽

Spot Virus ◽

Wide Range ◽

Tospovirus Species ◽

Disease Epidemics ◽

Wilt Virus

Thrips vector tospoviruses which worldwide cause disease epidemics in a wide range of economically important crops Of the approximately 5000 species of thrips 11 are known to vector one or more of the 14 recognised Tospovirus species In New Zealand only three tospoviruses and two vectors have been recorded Frankliniella occidentalis and Thrips tabaci vector tomato spotted wilt virus (TSWV) while T tabaci vectors iris yellow spot virus (IYSV) and impatiens necrotic spot virus (INSV) is vectored primarily by F occidentalis Frankliniella occidentalis is also known to vector three other tospoviruses not yet recorded in New Zealand It was possible to detect the presence of a tospovirus (TSWV) from thrips (F occidentalis) trapped on sticky boards for 24 h and 1 2 3 or 4 weeks using ELISA and RTPCR techniques ELISA provides a rapid and economical screening technique provided antibodies are commercially available for a given tospovirus However the use of RTPCR may allow the development and use of universal primers to detect the presence of any Tospovirus which could then be further identified using specific Tospovirus primers

Download Full-text

Impatiens necrotic spot virus. [Distribution map].

Distribution Maps of Plant Diseases ◽

10.1079/dmpd/20073069781 ◽

2007 ◽

Author(s):

Keyword(s):

New York ◽

South Carolina ◽

Frankliniella Occidentalis ◽

Ornamental Plants ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Distribution Map ◽

Spot Virus ◽

Virus Distribution ◽

Distribution In Europe

Abstract A new distribution map is provided for Impatiens necrotic spot virus. Bunyaviridae: Tospovirus. Hosts: daisy (Chrysanthemum), balsam (Impatiens) and some other ornamental plants. Information is given on the geographical distribution in Europe (Austria, Belgium, Czech Republic, Finland, France (mainland France), Germany, Hungary, Italy (mainland Italy, Sicily), Netherlands, Poland, Portugal, Slovenia, Spain, UK (England and Wales)), Asia (Iran, Israel, Japan (Honshu)), North America (Canada (Alberta, British Columbia, Manitoba, Ontario, Quebec), Mexico, USA (Arkansas, California, Colorado, Connecticut, Delaware, Florida, Georgia, Idaho, Iowa, Kansas, Kentucky, Maine, Maryland, Massachusetts, Minnesota, Mississippi, Missouri, New Hampshire, New Jersey, New York, North Carolina, North Dakota, Ohio, Oklahoma, Oregon, Pennsylvania, South Carolina, Texas, Vermont, Virginia)), Central America and Caribbean (Costa Rica), South America (Chile), Oceania (New Zealand). It is vectored by Frankliniella occidentalis (Thysanoptera: Thripidae).

Download Full-text

First Report of Monarda didyma Infection with Impatiens necrotic spot virus in Washington State

Plant Health Progress ◽

10.1094/php-2007-1119-02-br ◽

2007 ◽

Vol 8 (1) ◽

pp. 38

Author(s):

Rayapati A. Naidu ◽

Olufemi J. Alabi ◽

Gandhi Karthikeyan ◽

Mark Nelson ◽

Anne Morrell

Keyword(s):

Washington State ◽

Ornamental Plant ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Spot Virus ◽

First Report ◽

Monarda Didyma ◽

Herbaceous Perennial

Monarda didyma is an herbaceous perennial widely used as a garden ornamental plant throughout USA. Infection of M. didyma by Impatiens necrotic spot virus (INSV) in commercial greenhouse settings has been reported only in Pennsylvania in 1992. Therefore, this is the first report of INSV infecting a M. didyma in the field. Accepted for publication 25 September 2007. Published 19 November 2007.

Download Full-text