scholarly journals Evidence of a Naturally Occurring Recombinant Between Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in Spain

Plant Disease ◽  
2001 ◽  
Vol 85 (12) ◽  
pp. 1289-1289 ◽  
Author(s):  
F. Monci ◽  
J. Navas-Castillo ◽  
E. Moriones
Keyword(s):  
Common Bean ◽  
Sequence Data ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Stem Loop ◽  
Direct Dna Sequencing ◽  
Chain Reactions ◽  
Field Samples ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV, formerly TYLCV-Is) and Tomato yellow leaf curl Sardinia virus (TYLCSV, formerly TYLCV-Sar) are geminivirus species of the genus Begomovirus that cause the disease known as tomato yellow leaf curl. In Spain, TYLCV and TYLCSV have coexisted in field and greenhouse tomato (Lycopersicon esculentum) crops since 1996 (2). TYLCV is also the causal agent of the leaf crumple disease of common bean (Phaseolus vulgaris) (1), a species that TYLCSV is unable to infect (2). Analysis of field samples from common bean plants affected by leaf crumple disease collected in Almería (southeastern Spain) during 1999 showed that, unexpectedly, several samples hybridized with TYLCV- and TYLCSV-specific probes prepared to the intergenic region (IR) as previously described (1). Polymerase chain reactions (PCR) performed with total nucleic acids extracted from one of these samples (ES421/99) using primer pairs specific to the IR of TYLCV (MA-30/MA-31) or TYLCSV (MA-14/MA-15) (1) gave no amplification product. However, the combination of MA-30 (5′ end of TYLCV IR) and MA-15 (3′ end of TYLCSV IR) produced a PCR DNA product of the expected size (351 bp). Direct DNA sequencing of this product (GenBank Accession No. AF401478) indicated the presence of a chimeric IR in ES421/99. Comparison of the obtained sequence with those available for isolates reported from Spain showed that the 5′ side (149 nt) from the stem-loop structure conserved in the IR of all geminiviruses was 99% identical to the corresponding region of TYLCV (GenBank Accession No. AF071228) and only 62% identical to TYLCSV (GenBank Accession No. Z25751). In contrast, the 3′ side (124 nt) from the stem-loop was 98% identical to the corresponding region of TYLCSV and only 57% identical to TYLCV. The 33-nt region involved in the stem-loop was 100% identical to TYLCV and showed one nucleotide change in the loop with respect to TYLCSV. Therefore, this DNA sequence data showed evidence of the occurrence in ES421/99 of a natural recombination between TYLCV and TYLCSV. The biological and epidemiological consequences of the presence of this new interspecific recombinant have yet to be determined. References: (1) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (2) S. Sánchez-Campos et al. Phytopathology 89:1038, 1999.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Whitefly-mediated transmission and subsequent acquisition of highly similar and naturally occurring Tomato yellow leaf curl virus variants

2021 ◽  
Author(s):  
Wendy Marchant ◽  
Saurabh Gautam ◽  
Bhabesh Dutta ◽  
Rajagopalbab Srinivasan
Keyword(s):  
Amino Acids ◽  
Mixed Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Plant Interactions ◽  
Tomato Plants ◽  
Individual Host ◽  
Field Samples ◽  
Leaf Curl Virus ◽  
Leaf Curl

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (“variant #2” and “variant #4”) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants’ concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than variant#2 in tomato plants. Despite differences in variants’ accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly-infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

Evaluation of common bean lines for their reaction to tomato yellow leaf curl virus-Ir2

2011 ◽  
Vol 30 (2) ◽  
pp. 163-167 ◽  
Author(s):  
Razieh Montazeri Hedesh ◽  
Masoud Shams-Bakhsh ◽  
Javad Mozafari
Keyword(s):  
Common Bean ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Tomato Yellow Leaf Curl Virus-Is Causes a Novel Disease of Common Bean and Severe Epidemics in Tomato in Spain

Plant Disease ◽  
1999 ◽  
Vol 83 (1) ◽  
pp. 29-32 ◽  
Author(s):  
Jesús Navas-Castillo ◽  
Sonia Sánchez-Campos ◽  
Juan Antonio Díaz ◽  
Elisa Sáez-Alonso ◽  
Enrique Moriones
Keyword(s):  
Common Bean ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Economic Losses ◽  
Yellow Leaf ◽  
Fresh Market ◽  
First Report ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Field surveys were conducted in the autumn of 1997 in the main tomato (Lycopersicon esculentum)-growing regions of southern Spain following a severe tomato yellow leaf curl epidemic in tomato. Tomato yellow leaf curl virus (TYLCV)-Is was found to have spread to all regions and to coexist with TYLCV-Sr, which has been present since 1992. TYLCV-Is was also shown to be the causal agent of bean leaf crumple, a novel disease that has caused severe economic losses in fresh-market common bean (Phaseolus vulgaris) crops of southern Spain since September 1997. The disease was reproduced by infecting beans with cloned TYLCV-Is obtained from infected tomato plants collected in Almería. This is the first report of bean leaf crumple disease and the first report of a geminivirus in bean from Spain.

scholarly journals Pepper (Capsicum annuum) Is a Dead-End Host for Tomato yellow leaf curl virus

2005 ◽  
Vol 95 (9) ◽  
pp. 1089-1097 ◽  
Author(s):  
G. Morilla ◽  
D. Janssen ◽  
S. García-Andrés ◽  
E. Moriones ◽  
I. M. Cuadrado ◽  
...  
Keyword(s):  
Common Bean ◽  
Capsicum Annuum ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Severe Damage ◽  
Mild Strain ◽  
Dead End ◽  
Leaf Curl Virus ◽  
First Time ◽  
Leaf Curl

Tomato yellow leaf curl (TYLC) is one of the most devastating pathogens affecting tomato (Lycopersicon esculentum) worldwide. The disease is caused by a complex of begomovirus species, two of which, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), are responsible for epidemics in Southern Spain. TYLCV also has been reported to cause severe damage to common bean (Phaseolus vulgaris) crops. Pepper (Capsicum annuum) plants collected from commercial crops were found to be infected by isolates of two TYLCV strains: TYLCV-Mld[ES01/99], an isolate of the mild strain similar to other TYLCVs isolated from tomato crops in Spain, and TYLCV-[Alm], an isolate of the more virulent TYLCV type strain, not previously reported in the Iberian Peninsula. In this work, pepper, Nicotiana benthamiana, common bean, and tomato were tested for susceptibility to TYLCV-Mld[ES01/99]and TYLCV-[Alm] by Agrobacterium tumefaciens infiltration, biolistic bombardment, or Bemisia tabaci inoculation. Results indicate that both strains are able to infect plants of these species, including pepper. This is the first time that infection of pepper plants with TYLCV clones has been shown. Implications of pepper infection for the epidemiology of TYLCV are discussed.

scholarly journals Spread of Tomato yellow leaf curl virus Sar from the Mediterranean Basin: Presence in the Canary Islands and Morocco

Plant Disease ◽  
2000 ◽  
Vol 84 (4) ◽  
pp. 490-490 ◽  
Author(s):  
F. Monci ◽  
J. Navas-Castillo ◽  
J. L. Cenis ◽  
A. Lacasa ◽  
A. Benazoun ◽  
...  
Keyword(s):  
Canary Islands ◽  
Sequence Data ◽  
Random Amplified Polymorphic Dna ◽  
Nucleotide Sequences ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Gran Canaria ◽  
Two Samples ◽  
Leaf Curl Virus ◽  
Leaf Curl

Severe outbreaks of tomato yellow leaf curl disease occurred during summer and autumn 1999 in tomato (Lycopersicon esculentum Mill.) crops in the Vecindario Region of Gran Canaria (Canary Islands, Spain) and Agadir (southwestern Atlantic coast of Morocco). Symptoms of the disease included upward curling of leaflet margins, reduction of leaflet area, and yellowing of young leaves, as well as stunting and flower abortion. High populations of whiteflies, Bemisia tabaci Gen., were present on tomatoes in Agadir, and analysis of adult individuals by random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) identified them as the biotype Q. Samples were collected from symptomatic tomato plants: 5 plants from Gran Canaria and 22 from three areas in Agadir, (7 from Agadir/1, 12 from Agadir/2, and 3 from Agadir/3) in the Koudya Region. Samples were analyzed for Tomato yellow leaf curl virus (TYLCV) Sar or Is (genus Begomovirus, family Geminiviridae) infection by squash blot hybridization under high stringency conditions with digoxigenin-labeled DNA probes specific to TYLCV-Sar or -Is, as described previously (1,3). The TYLCV-Sar probe hybridized to the five samples from Gran Canaria, and the TYLCV-Is probe hybridized to the 22 samples from Agadir. The TYLCV-Sar probe also hybridized to the three samples from Agadir/3. Primer pairs MA-14/MA-15 and MA-30/MA-31, designed for specific amplification of the intergenic region (IR) of TYLCV-Sar or -Is reported from Spain, respectively (1), were used in PCR to amplify one sample each from Gran Canaria, Agadir/1, and Agadir/3. A fragment of the expected size was obtained from the samples from Gran Canaria and Agadir/3 using MA14/MA15 (342 bp) and from the two samples from Agadir using MA30/MA31 (357 bp). PCR products were directly sequenced (GenBank Accession nos. AF215819 to AF215822). The nucleotide sequences of the IR fragments amplified from the Gran Canaria and Agadir/3 sample using MA-14/MA-15 indicated their closest relationship (99.0 and 96.7% identity, respectively) was to the corresponding region of a TYLCV-Sar isolate reported from Spain (GenBank Accession no. L27708). The nucleotide sequences of the IR fragments amplified from the Agadir/1 and Agadir/3 samples using MA-30/MA-31 indicated their closest relationship (98.1% identity) was to the corresponding region of the TYLCV-Is isolate reported from Spain (GenBank Accession no. AF071228). Based on the hybridization and sequence data, we conclude that the symptomatic plants from Gran Canaria were infected by TYLCV-Sar, those from Agadir/1 and Agadir/2 were infected by TYLCV-Is, and those from Agadir/3 had mixed infections with TYLCV-Is and TYLCV-Sar. The presence of TYLCV-Is in Morocco has been described recently (2). However, this is the first report of TYLCV-Sar in the Canary Islands and Morocco and extends its geographic range beyond the Iberian Peninsula and Italy. References: (1) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (2) M. Peterschmitt et al. Plant Dis. 83:1074, 1999. (3) S. Sánchez-Campos et al. Phytopathology 89:1038, 1999.

scholarly journals Recombination profiles between Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in laboratory and field conditions: evolutionary and taxonomic implications

2012 ◽  
Vol 93 (12) ◽  
pp. 2712-2717 ◽  
Author(s):  
Salvatore Davino ◽  
Laura Miozzi ◽  
Stefano Panno ◽  
Luis Rubio ◽  
Mario Davino ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Rolling Circle Replication ◽  
Rolling Circle ◽  
Field Samples ◽  
Taxonomic Implications ◽  
Transcription Complexes ◽  
Leaf Curl Virus ◽  
Recombination Breakpoints ◽  
Leaf Curl

Tomato yellow leaf curl Sardinia virus and Tomato yellow leaf curl virus have co-existed in Italian tomato crops since 2002 and have reached equilibrium, with plants hosting molecules of both species plus their recombinants being the most frequent case. Recombination events are studied in field samples, as well as in experimental co-infections, when recombinants were detected as early as 45 days following inoculation. In both conditions, recombination breakpoints were essentially absent in regions corresponding to ORFs V2, CP and C4, whereas density was highest in the 3′-terminal portion of ORF C3, next to the region where the two transcription units co-terminate. The vast majority of breakpoints were mapped at antisense ORFs, supporting speculation that the rolling-circle replication mechanism, and the existence of sense and antisense ORFs on the circular genome, may result in clashes between replication and transcription complexes.

scholarly journals Identification of Tomato yellow leaf curl virus Naturally Infecting Common Bean in Japan

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1447-1447 ◽  
Author(s):  
M. S. Shahid ◽  
K. T. Natsuaki
Keyword(s):  
Common Bean ◽  
Natural Infection ◽  
Rolling Circle Amplification ◽  
Restriction Enzymes ◽  
Tomato Yellow Leaf ◽  
Whole Genome Sequence ◽  
Yellow Leaf ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV; family Geminiviridae, genus Begomovirus) is a devastating pathogen vectored by the whitefly Bemisia tabaci causing significant yield losses to tomato crops in Japan since 1998 (2). So far, there has been no report of this virus infecting common bean (Phaseolus vulgaris; family Fabaceae) in Japan. But recently, TYLCV has been reported from P. vulgaris in Spain and China (1,3). P. vulgaris is a vegetable crop commonly grown during spring to summer in Japan. In the course of a study to assess virus incidence on P. vulgaris exhibiting yellowing and thickening symptoms with 20 to 30% incidence, four symptomatic and two healthy samples were collected in August, 2012 from a single mix-cropping field (where P. vulgaris was cultivated together with tomato [Solanum lycopercisum] crop and a high B. tabaci population density was observed on plants) in Komae, Japan. Meanwhile, the vector for one crop can transmit the disease to the next crop very easily. To identify possible begomovirus present in symptomatic P. vulgaris plants, total nucleic acids were extracted from plants with and without symptoms using PhytoPure Plant DNA Extration Kit (GE Amersham Biosciences, UK) and begomovirus replication was confirmed from symptomatic leaves in 3 out of 4 plants when hybridized with a specific non-radioactive probe to the coat protein region of TYLCV (5) using a Biotin DNA Labelling Kit (Fermentas). To confirm the identity of the virus detected, leaf samples were further tested by PCR using the TYLCV specific detection primers (TYF/TYR) corresponding to the V2/CP region and a DNA fragment of an expected size was obtained from the samples positive for TYLCV in Southern hybridizations (4). The PCR products were sequenced directly and these sequences showed the highest nucleotide sequence identity >99% to the TYLCV isolate AB116630 reported from Japan. Rolling circle amplification (RCA) was done on all samples to produce concatamers and with Sac I restriction enzyme an amplicon of ~2.7 kb was obtained and cloned into PUC118 vector (Takara, Japan). Multiple clones were obtained showing the same restriction pattern with different restriction enzymes, and three of them were randomly selected and sequenced by Macrogen (Japan). Sequence analysis showed all three clones were identical and one sequence (J18.11) was submitted to GenBank. This sequence (GenBank Accession No. KJ585666) was 2,774 nt long and displayed the arrangement of four ORFs (AC1, AC2, AC3, and AC4 in complementary sense) and two ORFs (AV2 and AV1) on virion sense) typical of the genome of a begomovirus. This whole genome sequence was compared with those of other reported begomoviruses and exhibited greater than 99% nt sequence identity to a previously reported TYLC sequence (JN183876). Efforts to identify the presence of an additional begomovirus components or DNA satellites either by PCR and/or RCA were negative, suggesting that this is a monopartite begomovirus and an isolate of TYLCV. This is the first report of a natural infection of TYLCV in P. vulgaris in Japan. The presence of TYLCV on P. vulgaris could therefore represent a serious threat for this valuable crop in Japan. Thus, it is important to develop an effective way to control this virus to reduce the further losses. References: (1) Y. H. Ji et al. Plant Dis. 96:1229, 2012. (2) K. Kato et al. Ann. Phytopathol. Soc. Jpn. 64:552, 1998. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) M. S. Shahid et al. J. Phytopahol. 161:205, 2013. (5) M. S. Shahid et al. Viruses 6:189, 2014.

Sign in / Sign up

Export Citation Format

Share Document