Severe Outbreak of the Emerging Soybean Viruses in Korea: An Increasing Threat

2014 ◽  
Vol 15 (3) ◽  
pp. 122-123 ◽  
Author(s):  
Jang-Kyun Seo ◽  
Ja-Yeon Park ◽  
Hae-Ryun Kwak ◽  
Mi-Kyeong Kim ◽  
Moon Nam ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Large Scale ◽  
Soybean Mosaic Virus ◽  
Nationwide Survey ◽  
Rt Pcr ◽  
Specific Primers ◽  
Pcr Products ◽  
Yellow Mottle ◽  
Current Incidence

To determine the current incidence of Soybean yellow mottle mosaic virus (SYMMV), Soybean yellow common mosaic virus (SYCMV), and Soybean mosaic virus (SMV) in Korea, a nationwide survey was performed in 2013. A total of 417 soybean samples with typical virus symptoms were collected from 9 large-scale soybean-cultivated areas. To identify viruses from the collected samples, RT-PCR was performed using specific primers for SMV, SYMMV, or SYCMV. To confirm the RT-PCR results, PCR products were purified and sequenced. 22 July 2014. 18 August 2014.

scholarly journals Duplex-RT-PCR assay for the simultaneous detection and discrimination of Brome mosaic virus and Cocksfoot mottle virus in cereal plants

2021 ◽  
Author(s):  
Katarzyna Trzmiel
Keyword(s):  
Mosaic Virus ◽  
Simultaneous Detection ◽  
Brome Mosaic Virus ◽  
Mottle Virus ◽  
Grass Species ◽  
Replicase Gene ◽  
Rt Pcr ◽  
Pcr Products ◽  
Cereal Plants ◽  
Cocksfoot Mottle Virus

AbstractBrome mosaic virus (BMV) and cocksfoot mottle virus (CfMV) are pathogens of grass species including all economically important cereals. Both viruses have been identified in Poland therefore they create a potential risk to cereal crops. In this study, a duplex—reverse transcription—polymerase chain reaction (duplex-RT-PCR) was developed and optimized for simultaneous detection and differentiation of BMV and CfMV as well as for confirmation of their co-infection. Selected primers CfMVdiag-F/CfMVdiag-R and BMV2-F/BMV2-R amplified 390 bp and 798 bp RT-PCR products within coat protein (CP) region of CfMV and replicase gene of BMV, respectively. Duplex-RT-PCR was successfully applied for the detection of CfMV-P1 and different Polish BMV isolates. Moreover, one sample was found to be co-infected with BMV-ML1 and CfMV-ML1 isolates. The specificity of generated RT-PCR products was verified by sequencing. Duplex-RT-PCR, like conventional RT-PCR, was able to detect two viruses occurring in plant tissues in very low concentration (as low as 4.5 pg/µL of total RNA). In contrast to existing methods, newly developed technique offers a significant time and cost-saving advantage. In conclusion, duplex-RT-PCR is a useful tool which can be implemented by phytosanitary services to rapid detection and differentiation of BMV and CfMV.

scholarly journals First Report of Yam mild mosaic virus in Yam in Guangxi Province, China

Plant Disease ◽  
2011 ◽  
Vol 95 (10) ◽  
pp. 1320-1320 ◽  
Author(s):  
C. Zou ◽  
J. Meng ◽  
Z. Li ◽  
M. Wei ◽  
J. Song ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Viral Genome ◽  
Terminal Region ◽  
Mild Mosaic ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Germplasm Exchange ◽  
First Report ◽  
Pcr Products ◽  
Mild Mosaic Virus

Yams (Dioscorea spp.) are widely grown in China as vegetables and herbal medicine. However, studies on viral diseases on yams are still limited. As a pilot project of a government initiative for improving yam productivity, a small study was conducted in Guangxi, a southern province of China, on viral disease in yams. Incidence of virus-like disease for the three extensively grown D. alata cultivars, GH2, GH5, and GH6, were 12 to 40%, 12 to 29%, and 11 to 25%, respectively, as found in a field survey with a five-plot sampling method in 2010. A total of 112 leaf samples showing mosaic or mottling or leaves without symptoms were collected from the cvs. GH2, GH5, GH6, and seven additional cultivars (D. alata cvs. GY2, GY23, GY47, GY69, GY62, GY72, and D. batatas cv. Tiegun). To determine if the symptoms were caused by Yam mild mosaic virus (YMMV; genus Potyvirus, family Potyviridae), total RNA was extracted from leaves with a commercial RNA purification kit (TIANGEN, Beijing, China), and reverse-transcription (RT)-PCR was conducted with a YMMV-specific primer pair (4) that amplifies the 3′-terminal portion of the viral genome. A PCR product with the predicted size of 262 bp was obtained from samples of GH5 (number testing positive of total number of leaves = 5 of 12), GH6 (24 of 42), and GY72 (1 of 1), but not from asymptomatic leaves. PCR products from a GH5 sample (YMMV-Nanning) and a GH6 sample (YMMV-Luzhai) were cloned and sequenced using an ABI PRISM 3770 DNA Sequencer. The two PCR products were 97% identical at nucleotide (nt) level and with the highest homology (89% identity) to a YMMV isolate (GenBank Accession No. AJ305466). To further characterize the isolates, degenerate primers (2) were used to amplify viral genome sequence corresponding to the C-terminal region of the nuclear inclusion protein b (NIb) and the N-terminal region of the coat protein (CP). These 781-nt fragments were sequenced and a new primer, YMMV For1 (5′-TTCATGTCGCACAAAGCAGTTAAG-3′) corresponding to the NIb region, was designed and used together with primer YMMV UTR 1R to amplify a fragment that covers the complete CP region of YMMV by RT-PCR. These 1,278-nt fragments were sequenced (GenBank Accession Nos. JF357962 and JF357963). CP nucleotide sequences of the YMMV-Nanning and YMMV-Luzhai isolates were 94% similar, while amino acid sequences were 99% similar. BLAST searches revealed a nucleotide identity of 82 to 89% and a similarity of 88 to 97% for amino acids to sequences of YMMV isolates (AF548499 and AF548519 and AAQ12304 and BAA82070, respectively) in GenBank. YMMV is known to be prevalent on D. alata in Africa and the South Pacific, and has recently been identified in the Caribbean (1) and Colombia (3). To our knowledge, this is the first report of the natural occurrence of YMMV in China and it may have implications for yam production and germplasm exchange within China. References: (1) M. Bousalem and S. Dallot. Plant Dis. 84:200, 2000. (2) D. Colinet et al. Phytopathology 84:65, 1994. (3) S. Dallot et al. Plant Dis. 85:803, 2001. (4) R. A. Mumford and S. E. Seal. J. Virol. Methods 69:73, 1997.

scholarly journals Alternanthera mosaic virus Found in Scutellaria, Crossandra, and Portulaca spp. in Florida

Plant Disease ◽  
2006 ◽  
Vol 90 (6) ◽  
pp. 833-833 ◽  
Author(s):  
C. A. Baker ◽  
L. Breman ◽  
L. Jones
Keyword(s):  
Electron Microscopy ◽  
United States ◽  
Mosaic Virus ◽  
Plant Species ◽  
The United States ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
Indicator Plants ◽  
Partial Identity ◽  
Pcr Products

In the fall of 1998, the Division of Plant Industry (DPI) received vegetative propagations of Scutellaria longifolia (skullcap) with symptoms of foliar mosaic, chlorotic/necrotic ringspots, and wavy line patterns from a nursery in Manatee County. Flexuous particles approximately 500 nm long were found with electron microscopy. The plants tested positive for Papaya mosaic virus (PaMV) in an enzyme-linked immunosorbent assay (ELISA) test with antiserum to PaMV (Agdia, Elkhart, IN). However, in immunodiffusion tests (antiserum from D. Purcifull, University of Florida), this virus gave a reaction of partial identity indicating it was related but not identical to PaMV (1). The original infected plants were kept in a greenhouse. In January 2005, a specimen of Crossandra infundibuliformis (firecracker plant) with mosaic symptoms was submitted to the DPI from a nursery in Alachua County. Inclusions found with light microscopy and particles found with electron microscopy indicated that this plant was infected with a potexvirus. This was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) with primers designed to detect members of the virus family Potexviridae (3). These plants reacted positive to PaMV antiserum in ELISA and gave a reaction of partial identity to PaMV in immunodiffusion. A specimen of Portulaca grandiflora (moss rose) with distorted leaves found at a local retail store was also tested and gave the same results. Leaves from each of the three plant species were rubbed onto a set of indicator plants using Carborundum and potassium phosphate buffer. Total RNA was extracted from symptomatic indicator plants of Nicotiana benthamiana. RT-PCR (3) was performed, and PCR products were sequenced directly. Sequences of approximately 700 bp were obtained for all three plant species and showed 98% identity with each other. BLAST search results showed that these sequences were 93% identical to an Alternanthera mosaic virus (AltMV) sequence at the nucleotide level but only 76% identical to PaMV. The amino acid sequences were 98 and 82% identical to AltMV and PaMV, respectively. The PCR products of the virus from Scutellaria sp. were cloned, resequenced, and the sequence was entered into the GenBank (Accession No. DQ393785). The bioassay results matched those found for AltMV in Australia (2) and the northeastern United States (4), except that the Florida viruses infected Datura stramonium and Digitalis purpurea (foxglove). The virus associated with the symptoms of these three plants appears to be AltMV and not PaMV. AltMV has been found in ornamental plants in Australia, Italy, and the United States (Pennsylvania, Maryland, and now Florida). Since this virus is known to infect several plants asymptomatically and can be easily confused with PaMV serologically, it is likely that the distribution of this virus is much wider than is known at this time. References: (1) L. L. Breman. Plant Pathology Circular No. 396. Fla. Dept. Agric. Consum. Serv. DPI, 1999. (2) A. D. W. Geering and J. E. Thomas. Arch Virol 144:577, 1999. (3) A. Gibbs et al. J Virol Methods 74:67, 1998. (4) J. Hammond et al. Arch Virol. 151:477, 2006.

scholarly journals First Report of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia

Plant Disease ◽  
2021 ◽  
Author(s):  
Ahmed Sabra ◽  
Mohammed Ali Al Saleh ◽  
I. M. Alshahwan ◽  
Mahmoud A. Amer
Keyword(s):  
Saudi Arabia ◽  
Mosaic Virus ◽  
Solanum Lycopersicum ◽  
Tomato Mosaic Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
First Report ◽  
Pcr Products ◽  
Dark Green ◽  
Leaf Symptoms

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia References: Luria N, et al., 2017. PLoS ONE 12(1): 1-19. Salem N, et al., 2015. Archives of Virology 161(2): 503-506. Fig. 1. Symptoms caused by ToBRFV showing irregular brown spots, deformation, yellowing spots on fruits (A, B, C) and bubbling and mottling, mosaic with dark green wrinkled and narrowing on leaf (D).

scholarly journals First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 561-561 ◽  
Author(s):  
S. Khankhum ◽  
P. Bollich ◽  
R. A. Valverde
Keyword(s):  
Common Bean ◽  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Ringspot Virus ◽  
Wild Plants ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
First Report ◽  
Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

scholarly journals Occurrence of Stone Fruit Viruses in Plum Orchards in Latvia

2013 ◽  
Vol 67 (2) ◽  
pp. 116-123
Author(s):  
Alina Gospodaryk ◽  
Inga Moročko-Bičevska ◽  
Neda Pūpola ◽  
Anna Kāle
Keyword(s):  
Mosaic Virus ◽  
Large Scale ◽  
Ringspot Virus ◽  
Stone Fruit ◽  
Detection Methods ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
Detection Rates ◽  
Arabis Mosaic Virus ◽  
Das Elisa

To evaluate the occurrence of nine viruses infecting Prunus a large-scale survey and sampling in Latvian plum orchards was carried out. Occurrence of Apple mosaic virus (ApMV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), Apple chlorotic leaf spot virus (ACLSV), and Plum pox virus (PPV) was investigated by RT-PCR and DAS ELISA detection methods. The detection rates of both methods were compared. Screening of occurrence of Strawberry latent ringspot virus (SLRSV), Arabis mosaic virus (ArMV), Tomato ringspot virus (ToRSV) and Petunia asteroid mosaic virus (PeAMV) was performed by DAS-ELISA. In total, 38% of the tested trees by RT-PCR were infected at least with one of the analysed viruses. Among those 30.7% were infected with PNRSV and 16.4% with PDV, while ApMV, ACLSV and PPV were detected in few samples. The most widespread mixed infection was the combination of PDV+PNRSV. Observed symptoms characteristic for PPV were confirmed with RT-PCR and D strain was detected. Comparative analyses showed that detection rates by RT-PCR and DAS ELISA in plums depended on the particular virus tested. The results obtained in this study revealed that commonly grown plum cultivars in Latvia are infected with economically important stone fruit viruses and highlight the need to implement a programme to produce and propagate virus-free planting material.

scholarly journals First Report of Soybean mosaic virus and Soybean yellow mottle mosaic virus in Vigna angularis

Plant Disease ◽  
2018 ◽  
Vol 102 (3) ◽  
pp. 689-689 ◽  
Author(s):  
Y. Yoon ◽  
S. Lim ◽  
Y.-W. Jang ◽  
B.-S. Kim ◽  
D. H. Bae ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Soybean Mosaic Virus ◽  
Vigna Angularis ◽  
First Report ◽  
Yellow Mottle
Sign in / Sign up

Export Citation Format

Share Document