scholarly journals Resistance to Monopartite Begomoviruses Associated with the Bean Leaf Crumple Disease in Phaseolus vulgaris Controlled by a Single Dominant Gene

2005 ◽  
Vol 95 (7) ◽  
pp. 819-826 ◽  
Author(s):  
Francisco Monci ◽  
Susana García-Andrés ◽  
José Antonio Maldonado ◽  
Enrique Moriones
Keyword(s):  
Phaseolus Vulgaris ◽  
Common Bean ◽  
Dominant Gene ◽  
Monopartite Begomoviruses ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Single Dominant Gene ◽  
Long Distance ◽  
Backcross Populations ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) and Tomato yellow leaf curl Málaga virus are monopartite begomoviruses (genus Begomovirus, family Geminiviridae) that infect common bean (Phaseolus vulgaris), causing bean leaf crumple disease (BLCD). This disease was found to be widespread in southern Spain and causes stunted growth, flower abortion, and leaf and pod deformation in common bean plants. Commercial yield losses of up to 100% occur. In the present study, we have identified and characterized a resistance trait to BLCD-associated viruses in the common bean breeding line GG12. This resistance resulted in a complete absence of BLCD symptoms under field conditions or after experimental inoculation. Our analysis showed that virus replication was not inhibited. However, a severe restriction to systemic virus accumulation occurred in resistant plants, suggesting that cell-to-cell or long-distance movement were impaired. In addition, recovery from virus infection was observed in resistant plants. The reaction of P. vulgaris lines GG12 (resistant) and GG14 (susceptible), and of F1, F2, and backcross populations derived from them, to TYLCV inoculation suggested that a single dominant gene conferred the BLCD resistance described here.

scholarly journals Inheritance of Resistance to Passionfruit Woodiness Virus in Common Bean (Phaseolus vulgaris L.)

HortScience ◽  
2000 ◽  
Vol 35 (5) ◽  
pp. 880-881 ◽  
Author(s):  
R. Provvidenti
Keyword(s):  
Phaseolus Vulgaris ◽  
Common Bean ◽  
Dominant Gene ◽  
Bean Common Mosaic Virus ◽  
Inheritance Of Resistance ◽  
Single Dominant Gene ◽  
Phaseolus Vulgaris L ◽  
Rooted Cuttings ◽  
Backcross Populations ◽  
Dark Green

Passionfruit woodiness virus (PWV) can infect bean (Phaseolus vulgaris L.), causing a light and dark green foliar mosaic, veinbanding, downward curling, and plant stunting. The intensity of these symptoms can vary with the strain of the virus and cultivar, but they resemble those caused by bean common mosaic virus. In genetic populations derived from crosses and backcrosses involving cultivars that are resistant (`Black Turtle 1', `Clipper', and `RedKote') or susceptible (`Black Turtle 2', `California Light Red Kidney', and `Pioneer'), a single dominant gene conferred resistance to an Australian strain PWV-K. To this gene, the symbol Pwv (Passionfruit woodiness virus) is tentatively assigned. In plants derived from rooted cuttings of backcross populations, the same factor also conditioned resistance to three other Australian strains, PWV-Mild, PWV-51, and PWV-Tip Blight.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Evaluation of common bean lines for their reaction to tomato yellow leaf curl virus-Ir2

2011 ◽  
Vol 30 (2) ◽  
pp. 163-167 ◽  
Author(s):  
Razieh Montazeri Hedesh ◽  
Masoud Shams-Bakhsh ◽  
Javad Mozafari
Keyword(s):  
Common Bean ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Tomato Yellow Leaf Curl Virus-Is Causes a Novel Disease of Common Bean and Severe Epidemics in Tomato in Spain

Plant Disease ◽  
1999 ◽  
Vol 83 (1) ◽  
pp. 29-32 ◽  
Author(s):  
Jesús Navas-Castillo ◽  
Sonia Sánchez-Campos ◽  
Juan Antonio Díaz ◽  
Elisa Sáez-Alonso ◽  
Enrique Moriones
Keyword(s):  
Common Bean ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Economic Losses ◽  
Yellow Leaf ◽  
Fresh Market ◽  
First Report ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Field surveys were conducted in the autumn of 1997 in the main tomato (Lycopersicon esculentum)-growing regions of southern Spain following a severe tomato yellow leaf curl epidemic in tomato. Tomato yellow leaf curl virus (TYLCV)-Is was found to have spread to all regions and to coexist with TYLCV-Sr, which has been present since 1992. TYLCV-Is was also shown to be the causal agent of bean leaf crumple, a novel disease that has caused severe economic losses in fresh-market common bean (Phaseolus vulgaris) crops of southern Spain since September 1997. The disease was reproduced by infecting beans with cloned TYLCV-Is obtained from infected tomato plants collected in Almería. This is the first report of bean leaf crumple disease and the first report of a geminivirus in bean from Spain.

scholarly journals Pepper (Capsicum annuum) Is a Dead-End Host for Tomato yellow leaf curl virus

2005 ◽  
Vol 95 (9) ◽  
pp. 1089-1097 ◽  
Author(s):  
G. Morilla ◽  
D. Janssen ◽  
S. García-Andrés ◽  
E. Moriones ◽  
I. M. Cuadrado ◽  
...  
Keyword(s):  
Common Bean ◽  
Capsicum Annuum ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Severe Damage ◽  
Mild Strain ◽  
Dead End ◽  
Leaf Curl Virus ◽  
First Time ◽  
Leaf Curl

Tomato yellow leaf curl (TYLC) is one of the most devastating pathogens affecting tomato (Lycopersicon esculentum) worldwide. The disease is caused by a complex of begomovirus species, two of which, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), are responsible for epidemics in Southern Spain. TYLCV also has been reported to cause severe damage to common bean (Phaseolus vulgaris) crops. Pepper (Capsicum annuum) plants collected from commercial crops were found to be infected by isolates of two TYLCV strains: TYLCV-Mld[ES01/99], an isolate of the mild strain similar to other TYLCVs isolated from tomato crops in Spain, and TYLCV-[Alm], an isolate of the more virulent TYLCV type strain, not previously reported in the Iberian Peninsula. In this work, pepper, Nicotiana benthamiana, common bean, and tomato were tested for susceptibility to TYLCV-Mld[ES01/99]and TYLCV-[Alm] by Agrobacterium tumefaciens infiltration, biolistic bombardment, or Bemisia tabaci inoculation. Results indicate that both strains are able to infect plants of these species, including pepper. This is the first time that infection of pepper plants with TYLCV clones has been shown. Implications of pepper infection for the epidemiology of TYLCV are discussed.

scholarly journals Identification of Tomato yellow leaf curl virus-Is in The Bahamas

Plant Disease ◽  
2000 ◽  
Vol 84 (5) ◽  
pp. 592-592 ◽  
Author(s):  
X. Sinisterra ◽  
C. P. Patte ◽  
S. Siewnath ◽  
J. E. Polston
Keyword(s):  
Dominican Republic ◽  
Infectious Clone ◽  
Monopartite Begomoviruses ◽  
Tomato Yellow Leaf ◽  
Common Source ◽  
Yellow Leaf ◽  
The Bahamas ◽  
Wide Range ◽  
Leaf Curl Virus ◽  
Leaf Curl

In December 1996, symptoms of stunting, curling, and marginal chlorosis of leaves, reduced leaf size, and marked reduction in number of fruits were first seen in tomato (Lycopersicon esculentum) plants on the island of North Andros, The Bahamas. Similar symptoms were observed for the first time during fall 1997 in tomatoes on the island of Eleuthera. Incidences of symptomatic plants were as high as 100% in some fields. Leaves from one symptomatic plant from each island were collected during April 1998. DNA was extracted from the samples and tested by polymerase chain reaction (PCR) amplification for the presence of one or more geminiviruses (2). Three sets of primers were used to amplify the extracts: PAL1c496 and PAL1v1978, which amplify an ≈1,100- or ≈1,300-bp DNA product from the A component of a wide range of bipartite and monopartite begomoviruses, respectively; primers PCRc154 and PBL1v2042, which amplify an ≈600-bp DNA fragment from the B component of a wide range of bipartite geminiviruses; and primers PCRc154 and PTYC1v2180 (5′ACTACCATGGCCGC-GCAGCGGAATAC3′), which preferentially amplify Tomato yellow leaf curl virus (TYLCV-Is) (1,2). DNA products of ≈1,300 and ≈780 bp were amplified with PAR1c496 and PAL1v1978 and PCRc154 and PTYC1v2180, respectively, from one sample from each island. No product was obtained from primers PCRc154 and PBL1v2042. The symptoms and PCR results are consistent for the presence of TYLCV. PCR products generated by primers PAL1c496 and PAL1v1978 from each sample were cloned into a pGEM-T Easy Vector (Promega, Madison, WI), and one clone from each was sequenced with vector primers. The sequences of the two 1,300-nt Bahamian clones were identical. The Bahamian clones shared 98.9% sequence homology with equivalent sequences of a TYLCV-Is clone from Florida, 99.2 and 99.4% homology with two TYLCV-Is clones from the Dominican Republic (GenBank Accession no. AF024715, and a full-length infectious clone submitted to GenBank), 98.7% homology with a clone from Cuba (GenBank Accession no. AJ223505), and 98.0% homology with the type sequence from Israel (GenBank Accession no. X15656). A deletion (28 or 29 nt) in the intergenic region was shared by clones from The Bahamas and Florida but was not present in clones from Cuba (AJ223505), the Dominican Republic (AF024715), Egypt (GenBank Accession no. L12219), Israel (X15656), Jamaica (GenBank Accession no. U84146), Lebanon (GenBank Accession no. AF160875), Mexico (GenBank Accession no. AF168709), and Spain (GenBank Accession no. AJ223505). TYLCV-Is appeared in The Bahamas and Florida at almost the same time (1). Because clones from both locations share an unusual deletion, there may be a common source for both introductions. This is the first report of TYLCV-Is in The Bahamas. Reference: (1) J. E. Polston et al. Plant Dis. 83:984, 1999. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals Inheritance of anthracnose resistance in common bean genotypes P.I. 207262 and AB 136

1997 ◽  
Vol 20 (1) ◽  
pp. 59-62 ◽  
Author(s):  
M.C. Gonçalves-Vidigal ◽  
Antônio A. Cardoso ◽  
Clibas Vieira ◽  
Luiz S. Saraiva
Keyword(s):  
Phaseolus Vulgaris ◽  
Common Bean ◽  
Resistance Genes ◽  
Dominant Gene ◽  
Colletotrichum Lindemuthianum ◽  
Single Dominant Gene ◽  
Anthracnose Resistance ◽  
Dominant Genes

Bean (Phaseolus vulgaris) lines P.I. 207262 and AB 136, both resistant to delta and kappa races of Colletotrichum lindemuthianum, were crossed with Michelite, Dark Red Kidney, and Perry Marrow, susceptible to both races, and with Cornell 49-242, resistant to delta and susceptible to kappa. F1 and F2 reactions demonstrated that P.I. 207262 carries duplicate dominant genes for resistance to the delta race; AB 136 carries a dominant gene. These resistance genes are independent of the Are gene from Cornell 49-242. With respect to the kappa race, F1 and F2 data showed that the resistance controlled by P.I. 207262 and by AB 136 depends on a single dominant gene. Complementary factors were involved with AB 136 resistance to the delta race and with P.I. 207262 resistance to kappa.

scholarly journals An anomalous detection of Tomato yellow leaf curl virus in tomato in New York State

Plant Disease ◽  
2021 ◽  
Author(s):  
Keith L. Perry
Keyword(s):  
New York ◽  
Nucleic Acid ◽  
New York State ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Total Nucleic Acid ◽  
Long Distance ◽  
Plant Materials ◽  
York State ◽  
Leaf Curl

In August 2020, a New York State vegetable grower sought assistance to identify a malady of tomato (Solanum lycopersicum). The plants were grown from saved seed that had been planted annually in NY and/or FL for over 15 years without significant disease problems, but the identity of the cultivar was not known. Submitted photos showed severely stunted plants with distorted leaves (crinkling, cupping, twisting); leaves were reduced in size and showed interveinal yellowing. Although the most likely explanation given the growing region was herbicide damage, the symptoms bore a striking resemblance to those presented by tomato yellow leaf curl (TYLCV)-infected tomato plants. TYLCV has not been reported from NY, as the whitefly vector (Bemisia tabaci) does not overwinter in the region. Stem tissue from a symptomatic plant was grafted onto a greenhouse grown rootstock of tomato breeding line 201231 (Cornell University); shoots emerging from grafted rootstocks showed symptoms consistent with those on the scion within 21 days of grafting. Total nucleic acid was extracted (Gambino et al. 2008), and a polymerase chain reaction (PCR) assay to detect TYLCV was performed using primers AV632 and AC1048 (Martínez-Culebras et al. 2001). Sanger sequencing of the expected size ~460 bp product from a representative sample showed 98% nucleotide identity with the sequence of over 52 isolates of TYLCV (blastn analysis using default parameters; Altschul et al. 1990). The total nucleic acid preparation was subjected to rolling circle ampification followed by restriction enzyme SphI digestion (Haible et al. 2006). An approximately 2.8 kb DNA fragment was resolved by agarose gel electrophoresis, gel purified, inserted into the cloning vector pUC19 and sequenced. Two clones yielded sequence of 2781 nt with only one nt mismatch (accession # MW373746, MW373747). BLAST analysis showed the sequence to be most closely related to TYLCV-IL from papaya in Texas (accession KX024647.1) with 99% identity (2752 of 2781 nt). Further inquiry revealed that the vegetable grower’s plants had been seeded and grown in Florida prior to transplanting in NY; Florida is a production region where the virus and vectors are endemic. Although the virus has been shown to be associated with seed (Pérez-Padilla et al. 2020) and seed transmission has been reported (Kil et al. 2016), this subject is controversial and the epidemiology of the disease is not consistent with a seed-transmitted virus (Rojas, et al. 2018). In this reported occurrence, the most plausible explanation is that the virus was introduced into NY with transplants. All of the field grown transplants of this cultivar were infected, but no local disease spread in NY was reported, nor were there reports of the vector. The significance of this report is to highlight the importance of phytosanitation in the movement of plants and plant materials. The long-distance movement of TYLCV via infected transplants in the US and globally is well-established. The presence of a pathogen may be transient and their establishment will depend on the epidemiology of the pathogen, in this case, the presence of the vector.

Sign in / Sign up

Export Citation Format

Share Document