scholarly journals Genetic Structure of the Population of Pepino mosaic virus Infecting Tomato Crops in Spain

2006 ◽  
Vol 96 (3) ◽  
pp. 274-279 ◽  
Author(s):  
Israel Pagán ◽  
María del Carmen Córdoba-Sellés ◽  
Llucia Martínez-Priego ◽  
Aurora Fraile ◽  
José M. Malpica ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Control Strategies ◽  
Triple Gene Block ◽  
Genetic Resistance ◽  
The United States ◽  
Pepino Mosaic Virus ◽  
Gene Block ◽  
Full Length Sequence ◽  
Different Strains ◽  
Rna Polymerase Gene

The population structure of Pepino mosaic virus (PepMV), which has caused severe epidemics in tomato in Spain since 2000, was analyzed. Isolates were characterized by the nucleotide sequence of the triple gene block and coat protein gene and, for a subset of isolates, a part of the RNA-dependent RNA polymerase gene. The full-length sequence of the genomic RNA of a Solanum muricatum isolate from Peru also was determined. In spite of high symptom diversity, the Spanish population of PepMV mostly comprised highly similar isolates belonging to the strain reported in Europe (European tomato strain), which has been the most prevalent genotype in Spain. The Spanish PepMV population was not structured spatially or temporally. Also, isolates highly similar to those from nontomato hosts from Peru (Peruvian strain) or to isolate US2 from the United States (US2 strain) were detected at lower frequency relative to the European strain. These two strains were detected in peninsular Spain only in 2004, but the Peruvian strain has been detected in the Canary Islands since 2000. These results suggest that PepMV was introduced into Spain more than once. Isolates from the Peruvian and US2 strains always were found in mixed infections with the European tomato strain, and interstrain recombinants were detected. The presence of different strains of the virus, and of recombinant isolates, should be considered for the development of control strategies based on genetic resistance.

scholarly journals A Thioredoxin Domain-Containing Protein Interacts with Pepino mosaic virus Triple Gene Block Protein 1

2018 ◽  
Vol 19 (12) ◽  
pp. 3747
Author(s):  
Matthaios Mathioudakis ◽  
Souheyla Khechmar ◽  
Carolyn Owen ◽  
Vicente Medina ◽  
Karima Ben Mansour ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Triple Gene Block ◽  
Polyclonal Antiserum ◽  
Post Inoculation ◽  
Mrna Levels ◽  
In Planta ◽  
Pepino Mosaic Virus ◽  
Gene Block ◽  
Triple Gene Block Protein

Pepino mosaic virus (PepMV) is a mechanically-transmitted tomato pathogen of importance worldwide. Interactions between the PepMV coat protein and triple gene block protein (TGBp1) with the host heat shock cognate protein 70 and catalase 1 (CAT1), respectively, have been previously reported by our lab. In this study, a novel tomato interactor (SlTXND9) was shown to bind the PepMV TGBp1 in yeast-two-hybrid screening, in vitro pull-down and bimolecular fluorescent complementation (BiFC) assays. SlTXND9 possesses part of the conserved thioredoxin (TRX) active site sequence (W__PC vs. WCXPC), and TXND9 orthologues cluster within the TRX phylogenetic superfamily closest to phosducin-like protein-3. In PepMV-infected and healthy Nicotiana benthamiana plants, NbTXND9 mRNA levels were comparable, and expression levels remained stable in both local and systemic leaves for 10 days post inoculation (dpi), as was also the case for catalase 1 (CAT1). To localize the TXND9 in plant cells, a polyclonal antiserum was produced. Purified α-SlTXND9 immunoglobulin (IgG) consistently detected a set of three protein bands in the range of 27–35 kDa, in the 1000 and 30,000 g pellets, and the soluble fraction of extracts of healthy and PepMV-infected N. benthamiana leaves, but not in the cell wall. These bands likely consist of the homologous protein NbTXND9 and its post-translationally modified derivatives. On electron microscopy, immuno-gold labelling of ultrathin sections of PepMV-infected N. benthamiana leaves using α-SlTXND9 IgG revealed particle accumulation close to plasmodesmata, suggesting a role in virus movement. Taken together, this study highlights a novel tomato-PepMV protein interaction and provides data on its localization in planta. Currently, studies focusing on the biological function of this interaction during PepMV infection are in progress.

scholarly journals Genetic Characterization of Pepino Mosaic Virus Isolates from Morocco

2019 ◽  
Vol 13 (1) ◽  
pp. 18-28
Author(s):  
Amal Souiri ◽  
Mustapha Zemzami ◽  
Hayat Laatiris ◽  
Saaid Amzazi ◽  
Moulay M. Ennaji
Keyword(s):  
Sequence Analysis ◽  
Mosaic Virus ◽  
Triple Gene Block ◽  
Cross Protection ◽  
Nucleotide Polymorphisms ◽  
High Sequence Identity ◽  
Tomato Production ◽  
Pepino Mosaic Virus ◽  
Gene Block ◽  
Shared Identity

Introduction: Throughout the past few years, Pepino Mosaic Virus (PepMV) has rapidly evolved from an emerging virus to endemic pathogen that causes significant losses in tomato crops worldwide. Reliable detection and molecular characterization are very important tools to support disease control. Cross-protection can also be an effective strategy, but the efficacy depends strongly on the genotype. The genetic composition of the PepMV population in Morocco has not yet been determined. Aims: The current study aims to genetically characterize twelve PepMV isolates (PepMV-MA), all from different Moroccan tomato production areas, by analyzing nucleotide sequences of a part of the RNA-dependent RNA polymerase (RdRp), Triple Gene Block (TGB) and Coat Protein (CP) genes. Results: The sequence analysis of the twelve PepMV-MA isolates shows minor nucleotide differences between them, which implies a homogenous population. The phylogenetic analysis, based on the comparison with the major genotypes, showed that Moroccan PepMV populations share a very high sequence identity, 98%, with the Chilean strain (CH2), while the shared identity with the European strains (EU) is only 85%. Interestingly, Moroccan isolates reveal specific single nucleotide polymorphisms, some of which lead to amino acids changes. These mutations have never been described before, suggesting distinct variants that may enhance aggressiveness and symptomatology. Conclusion: Our careful sequence analysis and genotype determination, which placing homogenous Moroccan PepMV strains into CH2 genotype, would be a prerequisite for deploying effective cross-protection strategies for controlling the pathogen in the field.

scholarly journals First Report of the US1 Strain of Pepino mosaic virus in Tomato in the Canary Islands, Spain

Plant Disease ◽  
2008 ◽  
Vol 92 (11) ◽  
pp. 1590-1590 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
M. C. Cebrián ◽  
C. Córdoba-Sellés ◽  
J. A. Herrera-Vásquez ◽  
C. Jordá
Keyword(s):  
Mosaic Virus ◽  
Canary Islands ◽  
Sequence Data ◽  
Triple Gene Block ◽  
Economic Losses ◽  
Sequence Information ◽  
Specific Primers ◽  
Pepino Mosaic Virus ◽  
First Report ◽  
Gene Block

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in 1974 on pepino (Solanum muricatum Ait.) in Peru. In 1999, PepMV was reported to be affecting tomato (Solanum lycopersicum L.) (3), and currently, the virus is distributed throughout many parts of the world causing economic losses in tomato crops. This virus induces not only a high variability of symptoms on infected plants, including distortion, chlorosis, mosaic, blistering, and filiformity on leaves and marbling on fruits, but also exhibits substantial genetic diversity. Five strains or genotypes of PepMV have been described, including European tomato (EU), Peruvian (PE), Chilean 2 (CH2), and two American strains, US1 (including CH1) and US2. No correlation has been found between different genotypes and symptom expression of PepMV infection. Studies have demonstrated that field populations of PepMV in Europe belong to EU and US2 or CH2 strains. Mixed infections between these strains and interstrain recombinant isolates are also found (1,2). In Spain, the PE strain was also described, but at a lower relative frequency than other strains (2). In February 2007 in the Canary Islands (Tenerife, Spain), a PepMV isolate (PepMV-Can1) showing the typical leaf symptoms of blistering and mosaic was collected. PepMV was first identified by double-antibody sandwich (DAS)-ELISA with specific antisera against PepMV (DSMZ GMBH, Baunschweig, Germany) according to the manufacturer's instructions. The serological identification was confirmed by reverse transcription (RT)-PCR with two pairs of PepMV-specific primers Pep3/Pep4 and CP-D/CP-R that amplify a fragment of the RNA dependent RNA polymerase (RdRp) gene and the complete coat protein (CP) gene, respectively (2). PCR products were purified and directly sequenced. The amplified RdRp fragment of PepMV-Can1 (GenBank Accession No. EU791618) showed 82% nt identity with the EU and PE strains (GenBank Accession Nos. AJ606360 and AM109896, respectively), but more than 98% identity with the US2 and US1 strains (GenBank Accession Nos. AY509927 and AY 509926, respectively). Sequence information obtained from the amplified CP fragment (GenBank Accession No. EU797176) showed 99% nt identity with US1 and less than 83% with EU, PE, CH2 (GenBank Accession No. DQ000985), and US2. To confirm these results, specific primers for the triple gene block (TGB) were designed using the sequence data from GenBank Accession Nos. AY509926, AY509927, DQ000985, AJ606360, and AM109896. (PepTGB-D:5′ GATGAAGCTGAACAACATTTC 3′ and PepTGB-R: 5′ GGAGCTGTATTRGGATTTGA 3′). A 1,437-bp fragment (GenBank Accession No. EU797177) was obtained, sequenced, and compared with the published sequences, showing 98% nt identity with the US1 strain and less than 86% with the other strains of PepMV. The highest sequence identity in all the studied regions of the PepMV-Can1 isolate was with the US1 strain of PepMV. To our knowledge, this is not only the first report of an isolate of the US1 strain in the Canary Islands (Spain), but also the first report of the presence of this genotype in a different location than its original report (North America). References: (1) I. Hanssen et al. Eur. J. Plant Pathol. 121:131, 2008. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) R. A. R. Van der Vlugt et al. Plant Dis. 84:103, 2000.

scholarly journals Multifaceted Capsid Proteins: Multiple Interactions Suggest Multiple Roles for Pepino mosaic virus Capsid Protein

2014 ◽  
Vol 27 (12) ◽  
pp. 1356-1369 ◽  
Author(s):  
Matthaios M. Mathioudakis ◽  
Luis Rodríguez-Moreno ◽  
Raquel Navarro Sempere ◽  
Miguel A. Aranda ◽  
Ioannis Livieratos
Keyword(s):  
Mosaic Virus ◽  
Rna Silencing ◽  
Defense Mechanism ◽  
Triple Gene Block ◽  
Potato Virus X ◽  
Pepino Mosaic Virus ◽  
Multifunctional Protein ◽  
Gene Block

Pepino mosaic virus (PepMV) (family Alphaflexiviridae, genus Potexvirus) is a mechanically transmitted tomato pathogen that, over the last decade, has evolved from emerging to endemic worldwide. Here, two heat-shock cognate (Hsc70) isoforms were identified as part of the coat protein (CP)/Hsc70 complex in vivo, following full-length PepMV and CP agroinoculation. PepMV accumulation was severely reduced in Hsp70 virus-induced gene silenced and in quercetin-treated Nicotiana benthamiana plants. Similarly, in vitro–transcribed as well as virion RNA input levels were reduced in quercetin-treated protoplasts, suggesting an essential role for Hsp70 in PepMV replication. As for Potato virus X, the PepMV CP and triple gene-block protein 1 (TGBp1) self-associate and interact with each other in vitro but, unlike in the prototype, both PepMV proteins represent suppressors of transgene-induced RNA silencing with different modes of action; CP is a more efficient suppressor of RNA silencing, sequesters the silencing signal by preventing its spread to neighboring cells and its systemic movement. Here, we provide evidence for additional roles of the PepMV CP and host-encoded Hsp70 in viral infection, the first as a truly multifunctional protein able to specifically bind to a host chaperone and to counterattack an RNA-based defense mechanism, and the latter as an essential factor for PepMV infection.

scholarly journals Subcellular Localization of the Barley Stripe Mosaic Virus Triple Gene Block Proteins

2009 ◽  
Vol 83 (21) ◽  
pp. 11413-11413 ◽  
Author(s):  
Hyoun-Sub Lim ◽  
Jennifer N. Bragg ◽  
Uma Ganesan ◽  
Steven Ruzin ◽  
Denise Schichnes ◽  
...  
Keyword(s):  
Subcellular Localization ◽  
Mosaic Virus ◽  
Triple Gene Block ◽  
Barley Stripe Mosaic Virus ◽  
Gene Block

scholarly journals Triple Gene Block Protein Interactions Involved in Movement of Barley Stripe Mosaic Virus

2008 ◽  
Vol 82 (10) ◽  
pp. 4991-5006 ◽  
Author(s):  
Hyoun-Sub Lim ◽  
Jennifer N. Bragg ◽  
Uma Ganesan ◽  
Diane M. Lawrence ◽  
Jialin Yu ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Triple Gene Block ◽  
Cell Movement ◽  
Wild Type Virus ◽  
Barley Stripe Mosaic Virus ◽  
Wild Type ◽  
In Planta ◽  
Gene Block ◽  
Physical Interactions

ABSTRACT Barley stripe mosaic virus (BSMV) encodes three movement proteins in an overlapping triple gene block (TGB), but little is known about the physical interactions of these proteins. We have characterized a ribonucleoprotein (RNP) complex consisting of the TGB1 protein and plus-sense BSMV RNAs from infected barley plants and have identified TGB1 complexes in planta and in vitro. Homologous TGB1 binding was disrupted by site-specific mutations in each of the first two N-terminal helicase motifs but not by mutations in two C-terminal helicase motifs. The TGB2 and TGB3 proteins were not detected in the RNP, but affinity chromatography and yeast two-hybrid experiments demonstrated that TGB1 binds to TGB3 and that TGB2 and TGB3 form heterologous interactions. These interactions required the TGB2 glycine 40 and the TGB3 isoleucine 108 residues, and BSMV mutants containing these amino acid substitution were unable to move from cell to cell. Infectivity experiments indicated that TGB1 separated on a different genomic RNA from TGB2 and TGB3 could function in limited cell-to-cell movement but that the rates of movement depended on the levels of expression of the proteins and the contexts in which they are expressed. Moreover, elevated expression of the wild-type TGB3 protein interfered with cell-to-cell movement but movement was not affected by the similar expression of a TGB3 mutant that fails to interact with TGB2. These experiments suggest that BSMV movement requires physical interactions of TGB2 and TGB3 and that substantial deviation from the TGB protein ratios expressed by the wild-type virus compromises movement.

scholarly journals Topological properties of the triple gene block protein 2 of Bamboo mosaic virus

Virology ◽  
2008 ◽  
Vol 379 (1) ◽  
pp. 1-9 ◽  
Author(s):  
Hsiu-Ting Hsu ◽  
Yuan-Lin Chou ◽  
Yang-Hao Tseng ◽  
Yu-Hsing Lin ◽  
Tzung-Min Lin ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Triple Gene Block ◽  
Topological Properties ◽  
Gene Block ◽  
Triple Gene Block Protein

scholarly journals Interactions of the TGB1 Protein during Cell-to-Cell Movement of Barley Stripe Mosaic Virus

2001 ◽  
Vol 75 (18) ◽  
pp. 8712-8723 ◽  
Author(s):  
Diane M. Lawrence ◽  
A. O. Jackson
Keyword(s):  
Subcellular Localization ◽  
Mosaic Virus ◽  
Fluorescent Protein ◽  
Triple Gene Block ◽  
Cell Movement ◽  
Barley Stripe Mosaic Virus ◽  
Helicase Domain ◽  
Chenopodium Amaranticolor ◽  
Gene Block ◽  
Green Fluorescent

ABSTRACT We have recently used a green fluorescent protein (GFP) fusion to the γb protein of Barley stripe mosaic virus (BSMV) to monitor cell-to-cell and systemic virus movement. The γb protein is involved in expression of the triple gene block (TGB) proteins encoded by RNAβ but is not essential for cell-to-cell movement. The GFP fusion appears not to compromise replication or movement substantially, and mutagenesis experiments demonstrated that the three most abundant TGB-encoded proteins, βb (TGB1), βc (TGB3), and βd (TGB2), are each required for cell-to-cell movement (D. M. Lawrence and A. O. Jackson, Mol. Plant Pathol. 2:65–75, 2001). We have now extended these analyses by engineering a fusion of GFP to TGB1 to examine the expression and interactions of this protein during infection. BSMV derivatives containing the TGB1 fusion were able to move from cell to cell and establish local lesions in Chenopodium amaranticolor and systemic infections of Nicotiana benthamiana and barley. In these hosts, the GFP-TGB1 fusion protein exhibited a temporal pattern of expression along the advancing edge of the infection front. Microscopic examination of the subcellular localization of the GFP-TGB1 protein indicated an association with the endoplasmic reticulum and with plasmodesmata. The subcellular localization of the TGB1 protein was altered in infections in which site-specific mutations were introduced into the six conserved regions of the helicase domain and in mutants unable to express the TGB2 and/or TGB3 proteins. These results are compatible with a model suggesting that movement requires associations of the TGB1 protein with cytoplasmic membranes that are facilitated by the TGB2 and TGB3 proteins.

scholarly journals First Report of Potato mop-top virus on Potato from the United States

Plant Disease ◽  
2003 ◽  
Vol 87 (7) ◽  
pp. 872-872 ◽  
Author(s):  
D. H. Lambert ◽  
L. Levy ◽  
V. A. Mavrodieva ◽  
S. B. Johnson ◽  
M. J. Babcock ◽  
...  
Keyword(s):  
Triple Gene Block ◽  
The United States ◽  
Russet Burbank ◽  
Enzyme Linked Immunosorbent Assay ◽  
Coding Region ◽  
Rt Pcr ◽  
Protein Coding ◽  
Gene Block ◽  
Elisa Testing ◽  
Potato Mop Top Virus

Potato mop-top virus (PMTV) is a tripartite pomovirus vectored by the powdery scab plasmodiophoromycete Spongospora subterranea pv. subterranea (1). PMTV occurs on potato (Solanum tuberosum) in Europe, the Andes, Asia, and Canada. Internal necrotic arc and fleck tuber symptoms (“spraing”) may reduce commercial acceptance of some cultivars (3). PMTV symptoms were discovered in ‘Shepody’ tubers at the Aroostook Research Farm, Presque Isle, ME in May 2002 and subsequently in ‘Russet Burbank’ tubers in commercial storage from the 2001 Maine crop. Symptomatic tubers exhibited single or multiple concentric necrotic arcs that were partial or complete, but exhibited no distinct external symptoms. The presence of PMTV in eight ‘Shepody’ tubers was indicated by positive enzyme-linked immunosorbent assay (ELISA; Adgen, Ltd., Auchincruive, Ayr, Scotland) and confirmed by reverse transcription polymerase chain reaction (RT-PCR). ‘Russet Burbank’ potatoes were visually diagnosed, and the corresponding halves of 128 symptomatic tubers were forwarded to the University of Maine and APHIS (Beltsville, MD). Of these, ELISA readings in Maine were strongly positive (>3 × background) for 88, ambiguous (1.5-3 × background) for 13, and negative for 27. Subsamples from these three categories were positive by PCR in 17 of 17, 9 of 9, and 12 of 14 cases, respectively. A similar rating, positive or ambiguous, in ELISA testing was identical for all but one case at Beltsville. Confirmation of PMTV required PCR testing, resulting in a characteristic PCR product of 401 bp that was generated from the coat protein coding region on RNA 2 (2) using the primer pair PMTV 1 5′-GCAGCCGTCGAGAATAGATA-3′ (RNA nucleotides 316–335) and PMTV 4 5′-GCGAGTTGATGTGCC ACATT-3′ (complementary to RNA 2 nucleotides 716–697). An immunocapture RT-PCR using this primer set and the coating antibody from the Adgen ELISA kit was also successful in detecting PMTV. In separate reactions, a second product of 646 bp was generated from the triple gene block on RNA 3 (4) using the primer pair PMTV 5 5′-GGTGAACACGAGGACAAGGT-3′ (RNA 3 nucleotides 1417–1436) and PMTV 7 5′-AACAGTCCGGTCTTGTGAAC-3′ (complementary to RNA 3 nucleotides 2063–2044). The sequence of these products was 98 to 100% identical to PMTV published sequences. The discovery of this virus will result in adjustments to U.S. and Canadian seed potato certification standards and symptom characterization for common North American cultivars. References: (1) R. A. C. Jones and B. D. Harrison. Ann. Appl. Biol 63:1, 1969. (2) S. Kashiwazak et al. Virology 206:701, 1995. (3) M. Sandgren et al. Am. J. Potato Res. 79:205, 2002. (4) K. P. Scott et al. J. Gen. Virol.75:3561, 1994.

Sign in / Sign up

Export Citation Format

Share Document