From May to July 2010, severe outbreaks of bacterial canker of tomato (Solanum lycopersicum L.) were observed in 16 fields in the Province of Viterbo, central Italy. Cultivars affected were Uno Rosso, Peto 1296, UG 812, UG 822, and Podium. Disease incidence ranged from 70 to 100% and was highest for Uno Rosso followed by UG 812, UG 822, Peto 1296, and Podium. Leaf symptoms initially appeared as interveinal, pale green, water-soaked areas that quickly turned yellow-brown to necrotic, resembling sunburn. Infected parts of the plants began to wilt and then die. Light yellow-to-brown streaks or cankers appeared on stems and the cankers darkened. As the disease progressed, affected stems split lengthwise and a pale yellow-to-reddish brown discoloration of the vascular tissue was observed. The pith of infected stems turned brown, granular to mealy, and filled with cavities. Dividing the stem into two pieces lengthwise revealed yellowing of vascular tissues in the fruits that otherwise was asymptomatic. Eventually, vascular wilting and premature death of entire plants were observed. Once a month, infected samples were randomly collected three times from each field from five plants. A gram-positive, nonmotile, nonspore forming, aerobic, curved, rod-shaped bacterium was consistently isolated onto nutrient broth yeast extract agar medium from symptomatic plant tissues. Strains tested positive for gelatin liquefaction, H2S production from peptone, utilization of citrate and negative for starch hydrolysis. Forty-five isolates were used to inoculate four-o'clock (Mirabilis jalapa L.) plants by injecting a bacterial suspension of the appropriate isolate in sterilized distilled water (108 CFU/ml) into leaves (1). Known strains of Clavibacter michiganensis subsp. michiganensis (DPP22) and Pseudomonas fluorescens (DPP09N) were used as positive and negative control treatments, respectively. Four leaves per plant and three plants were inoculated for each bacterial strain and control treatment. All 45 tomato field isolates and the known strain of C. michiganensis subsp. michiganensis produced a hypersensitive reaction within 48 h. Pathogenicity tests were performed on 3-week-old, potted tomato seedlings (cv. Ciliegino) by placing a drop of the appropriate bacterial suspension (108 CFU/ml) on wounds created by excising the leaf petiole. The inoculated plants were maintained at 26 ± 1°C in a greenhouse. The two control isolates were similarly inoculated onto tomato seedlings. After 15 days, all inoculated plants developed symptoms, whereas negative control plants remained asymptomatic. Bacteria reisolated from inoculated leaf lesions had the same characteristics as the original bacteria. A 1,400-bp region of the 16S rDNA was amplified from 15 of the 45 strains with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession Nos. HQ144228 to HQ144242; strains CmmVT1 to CmmVT15). A BlastN search of the sequences in GenBank revealed the tomato strains had 99 to 100% identity with the 16S rDNA sequences of C. michiganensis subsp. michiganensis strains (GenBank Accession Nos. EU 685335, AM711867, and AM410696). In Italy, this pathogen was first reported in 1914 in Vasto and later in a few other regions. However, to our knowledge, this is the first observation of widespread outbreaks in >300 ha of tomato fields with severe economic losses. Reference: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990.
Effect of Bactericides on Population Sizes and Spread of Clavibacter michiganensis subsp. michiganensis on Tomatoes in the Greenhouse and on Disease Development and Crop Yield in the Field