scholarly journals Limiting Populations and Spread of Clavibacter michiganensis subsp. michiganensis on Seedling Tomatoes in the Greenhouse

Plant Disease ◽  
2002 ◽  
Vol 86 (5) ◽  
pp. 535-542 ◽  
Author(s):  
N. A. Werner ◽  
D. W. Fulbright ◽  
R. Podolsky ◽  
J. Bell ◽  
M. K. Hausbeck
Keyword(s):  
Bacterial Canker ◽  
Susceptible Cultivar ◽  
Copper Hydroxide ◽  
Clavibacter Michiganensis ◽  
Canker Disease ◽  
Resistant Cultivars ◽  
Tomato Seedlings ◽  
Greenhouse Tomato ◽  
Clavibacter Michiganensis Subsp ◽  
Pathogen Populations

Symptomless greenhouse tomato transplants may harbor high populations of Clavibacter michiganensis subsp. michiganensis, the causal agent of bacterial canker, leading to yield loss in the field. The objective of this study was to determine whether resistant cultivars, acibenzolar-S-methyl, avirulent strains of C. michiganensis subsp. michiganensis, or standard bactericides reduce pathogen populations and spread among greenhouse tomato seedlings. All treatments limited pathogen populations compared with the untreated inoculated susceptible cultivar in 1996 and 1998, but not in 1997. In 1996, copper hydroxide alone or mixed with mancozeb or streptomycin limited pathogen populations relative to acibenzolar-S-methyl, acibenzolar-S-methyl mixed with copper hydroxide, and avirulent strains. Copper hydroxide mixed with streptomycin limited pathogen populations compared with copper hydroxide mixed with mancozeb. Adding copper hydroxide to acibenzolar-S-methyl limited pathogen populations compared with acibenzolar-S-methyl alone. In 1998, treatments did not differ significantly from each other in limiting pathogen populations. The treatments limited spread of the bacterium only in 1997. Copper hydroxide mixed with mancozeb limited spread compared with copper hydroxide mixed with streptomycin. Pathogen spread was also reduced among resistant cultivars compared with the susceptible cultivar treated with streptomycin. In the field, the untreated inoculated susceptible cultivar produced yields that were 61% (1996) and 93% (1997) of those produced by the uninoculated susceptible cultivar. Fruit spotting occurred regardless of treatment. To prevent severe bacterial canker disease in the field, growers should initiate and sustain bactericide applications to tomato transplants while in the greenhouse to suppress pathogen populations. Cultivar resistance and acibenzolar-S-methyl may be helpful in disease management of bacterial canker on tomato.

scholarly journals Clavibacter michiganensis subsp. capsici subsp. nov., causing bacterial canker disease in pepper

2016 ◽  
Vol 66 (10) ◽  
pp. 4065-4070 ◽  
Author(s):  
Eom-Ji Oh ◽  
Chungyun Bae ◽  
Han-Beoyl Lee ◽  
In Sun Hwang ◽  
Hyok-In Lee ◽  
...  
Keyword(s):  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Canker Disease ◽  
Clavibacter Michiganensis Subsp

scholarly journals Effect of Bactericides on Population Sizes and Spread of Clavibacter michiganensis subsp. michiganensis on Tomatoes in the Greenhouse and on Disease Development and Crop Yield in the Field

2000 ◽  
Vol 90 (1) ◽  
pp. 38-44 ◽  
Author(s):  
M. K. Hausbeck ◽  
J. Bell ◽  
C. Medina-Mora ◽  
R. Podolsky ◽  
D. W. Fulbright
Keyword(s):  
Control Plant ◽  
Disease Development ◽  
Copper Hydroxide ◽  
Clavibacter Michiganensis ◽  
Pathogen Population ◽  
Tomato Seedlings ◽  
Clavibacter Michiganensis Subsp ◽  
Population Sizes ◽  
Uninoculated Control ◽  
Uninoculated Control Plant

Chemical applications, with the exception of mancozeb, reduced population sizes and spread of Clavibacter michiganensis subsp. michiganensis among tomato seedlings in the greenhouse and impacted subsequent plant development and yield in the field. While applications of copper hydroxide, copper hydroxide/mancozeb, copper hydroxide/mancozeb (premixed 12 h before spraying), streptomycin, and streptomycin/copper hydroxide to seedlings in the greenhouse did not differ significantly from the inoculated control, the trend was for these treatments to increase the survival of inoculated transplants in the field in comparison to the inoculated control. In the field, inoculated controls produced yields that were 63% (1995) and 51% (1996) of those produced by uninoculated controls. In both years, with the exception of mancozeb in 1995, all treatments resulted in yields similar to those obtained with the uninoculated control. Plant survival and yield in the field were severely affected when transplants had a pathogen population of ≥ × 108 CFU/g of tissue. All treatments, with the exception of mancozeb, limited C. michiganensis subsp. michiganensis populations to <5.0 × 105. None of the treatments significantly reduced the incidence of fruit spotting compared with that of the inoculated control.

scholarly journals Severe Outbreak of Bacterial Canker Caused by Clavibacter michiganensis subsp. michiganensis on Tomato in Central Italy

Plant Disease ◽  
2011 ◽  
Vol 95 (2) ◽  
pp. 221-221 ◽  
Author(s):  
J. R. Lamichhane ◽  
G. M. Balestra ◽  
L. Varvaro
Keyword(s):  
16S Rdna ◽  
Central Italy ◽  
Negative Control ◽  
Economic Losses ◽  
Bacterial Suspension ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Tomato Seedlings ◽  
Clavibacter Michiganensis Subsp ◽  
Tomato Field

From May to July 2010, severe outbreaks of bacterial canker of tomato (Solanum lycopersicum L.) were observed in 16 fields in the Province of Viterbo, central Italy. Cultivars affected were Uno Rosso, Peto 1296, UG 812, UG 822, and Podium. Disease incidence ranged from 70 to 100% and was highest for Uno Rosso followed by UG 812, UG 822, Peto 1296, and Podium. Leaf symptoms initially appeared as interveinal, pale green, water-soaked areas that quickly turned yellow-brown to necrotic, resembling sunburn. Infected parts of the plants began to wilt and then die. Light yellow-to-brown streaks or cankers appeared on stems and the cankers darkened. As the disease progressed, affected stems split lengthwise and a pale yellow-to-reddish brown discoloration of the vascular tissue was observed. The pith of infected stems turned brown, granular to mealy, and filled with cavities. Dividing the stem into two pieces lengthwise revealed yellowing of vascular tissues in the fruits that otherwise was asymptomatic. Eventually, vascular wilting and premature death of entire plants were observed. Once a month, infected samples were randomly collected three times from each field from five plants. A gram-positive, nonmotile, nonspore forming, aerobic, curved, rod-shaped bacterium was consistently isolated onto nutrient broth yeast extract agar medium from symptomatic plant tissues. Strains tested positive for gelatin liquefaction, H2S production from peptone, utilization of citrate and negative for starch hydrolysis. Forty-five isolates were used to inoculate four-o'clock (Mirabilis jalapa L.) plants by injecting a bacterial suspension of the appropriate isolate in sterilized distilled water (108 CFU/ml) into leaves (1). Known strains of Clavibacter michiganensis subsp. michiganensis (DPP22) and Pseudomonas fluorescens (DPP09N) were used as positive and negative control treatments, respectively. Four leaves per plant and three plants were inoculated for each bacterial strain and control treatment. All 45 tomato field isolates and the known strain of C. michiganensis subsp. michiganensis produced a hypersensitive reaction within 48 h. Pathogenicity tests were performed on 3-week-old, potted tomato seedlings (cv. Ciliegino) by placing a drop of the appropriate bacterial suspension (108 CFU/ml) on wounds created by excising the leaf petiole. The inoculated plants were maintained at 26 ± 1°C in a greenhouse. The two control isolates were similarly inoculated onto tomato seedlings. After 15 days, all inoculated plants developed symptoms, whereas negative control plants remained asymptomatic. Bacteria reisolated from inoculated leaf lesions had the same characteristics as the original bacteria. A 1,400-bp region of the 16S rDNA was amplified from 15 of the 45 strains with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession Nos. HQ144228 to HQ144242; strains CmmVT1 to CmmVT15). A BlastN search of the sequences in GenBank revealed the tomato strains had 99 to 100% identity with the 16S rDNA sequences of C. michiganensis subsp. michiganensis strains (GenBank Accession Nos. EU 685335, AM711867, and AM410696). In Italy, this pathogen was first reported in 1914 in Vasto and later in a few other regions. However, to our knowledge, this is the first observation of widespread outbreaks in >300 ha of tomato fields with severe economic losses. Reference: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990.

scholarly journals Effects of copper-based compounds, antibiotics and a plant activator on population sizes and spread of Clavibacter michiganensis subsp. michiganensis in greenhouse tomato seedlings

2009 ◽  
Vol 24 (1) ◽  
pp. 19-27 ◽  
Author(s):  
Svetlana Milijasevic ◽  
Biljana Todorovic ◽  
Ivana Potocnik ◽  
Emil Rekanovic ◽  
Milos Stepanovic
Keyword(s):  
Population Size ◽  
The Other ◽  
Copper Oxychloride ◽  
Copper Hydroxide ◽  
Clavibacter Michiganensis ◽  
Pathogen Population ◽  
Tomato Seedlings ◽  
Clavibacter Michiganensis Subsp ◽  
Population Sizes ◽  
Plant Activator

Three copper-based compounds (copper hydroxide, copper oxychloride, copper sulphate), two antibiotics (streptomycin and kasugamycin) and a plant activator (ASM) significantly reduced population sizes and spread of C. michiganensis subsp. michiganensis among tomato seedlings in the greenhouse. Streptomycin had the best effect in reducing pathogen population size in all sampling regions. Moreover, this antibiotic completely stopped the spread of C. michiganensis subsp. michiganensis in the region most distant from the inoculum focus. Copper hydroxide mixed with streptomycin significantly limited the pathogen population, compared with copper hydroxide alone, the other copper-based compounds, ASM and kasugamycin. However, combining streptomycin with copper hydroxide did not contribute to its greater efficacy against the pathogen population. Copper-based compounds, in general, were less effective in limiting pathogen population sizes than the other treatments in all three sampling regions, primarily copper oxychloride and the combination of copper hydroxide and mannose. Among copper compounds, copper hydroxide was the most prominent in reducing the bacterial population, especially in the region closest to the inoculums focus, while its combination with mannose did not improve the effects. Kasugamycin significantly limited pathogen population size, compared to copper bactericides, but it was less effective than the other antibiotic compound, i.e. streptomycin. The plant activator ASM significantly reduced population density, and it was more effective when used three days prior to inoculation than six days before inoculation.

scholarly journals Bacterial Canker Caused by Clavibacter michiganensis subsp. michiganensis on Tomato in the Baja California Peninsula of Mexico

Plant Disease ◽  
2006 ◽  
Vol 90 (12) ◽  
pp. 1550-1550 ◽  
Author(s):  
R. J. Holguín-Peña ◽  
R. C. Vázquez-Juárez ◽  
E. O. Rueda-Puente
Keyword(s):  
Baja California ◽  
Vascular Tissue ◽  
Baja California Peninsula ◽  
Pcr Analysis ◽  
Bacterial Disease ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Greenhouse Production ◽  
Tomato Seedlings ◽  
Clavibacter Michiganensis Subsp

During the 2005 tomato-growing (Lycopersicon esculentum Mill.) season, an apparent bacterial disease with cankers on the stems and bird's eye lesions on the fruit appeared in commercial fields and greenhouses in the San Quintin and San Simon areas (a 60-mile long coastal plain) near the central region of the Baja California Peninsula of Mexico. The disease was found in midseason, especially when plants were flowering, and the mature and ripe stage. Incidence ranged from 4 to 46%, which represented an important loss in field and greenhouse production. Symptomatic plants showed reddish brown cavities in the stem, discoloration, and water soaking of vascular tissue. Diseased tissues were washed with phosphate buffer and placed on semiselective Clavibacter medium (SCM) (1), and a gram-positive, nonmotile, nonspore-forming, aerobic, curved rod bacterium was consistently isolated and morphologically characterized. Twenty-eight isolates were identified as Clavibacter michiganensis subsp. michiganensis by polymerase chain reaction (PCR) technology with primers CMM5/CMM6 to amplify a fragment of approximately 6.2 kb (2). The isolates were also identified by REP-PCR (repetitive extragenic palindromic PCR) genomic fingerprinting techniques (3) with REP and BOX primer sets (4). Pathogenicity tests consisting of three replicates of 4-week-old tomato seedlings (cv. Tequila) were performed by spraying (twice, 2 days apart) inocula at 108 CFU/ml. Control seedlings were sprayed with sterile water. Inoculated plants previously covered in polyethylene bags were incubated in a growth chamber at 25°C for 48 h. Within 3 weeks, symptoms of reddish-brown cavities, water-soaked lesions, and asymmetrical wilting appeared on inoculated plants and were similar to those symptoms observed in the field. No symptoms were observed on control plants. Confirmation of the causal agent was done by culturing the bacteria on SCM and PCR analysis. Occurrence of the disease in San Quintin Valley is relevant because the disease is one of the five most serious tomato diseases in the peninsula. Moreover, the potential spread of the pathogen by tomato seedlings represents a permanent risk to other pathogen-free areas in the peninsula. Although bacterial canker has been observed in Baja California (Punta Colonet, Vicente Guerrero, San Quintin, and San Simon), to our knowledge, this is the first confirmation of C. michiganensis subsp. michiganensis in Baja, Mexico. References: (1). C. Alarcon et al. Phytopathology 88:306, 1998. (2) J. Dreier et al. Phytopathology 85:462, 1995. (3) F. J. Louws et al. Phytopathology 88:862, 1998. (4) J. Versalovic et al. Methods Mol. Cell. Biol. 5:25, 1994.

Ingress of Clavibacter michiganensis subsp. michiganensis into Tomato Leaves Through Hydathodes

1998 ◽  
Vol 88 (6) ◽  
pp. 525-529 ◽  
Author(s):  
W. M. Carlton ◽  
E. J. Braun ◽  
M. L. Gleason
Keyword(s):  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Intercellular Spaces ◽  
Clavibacter Michiganensis Subsp ◽  
Canker Pathogen ◽  
Large Populations ◽  
Pathogen Populations

Hydathodes of tomato leaves served as extremely efficient infection courts for the bacterial canker pathogen, Clavibacter michiganensis subsp. michiganensis. Chlorotic lesions developed at the tips of leaflet lobes about 2 weeks after inoculation of guttation droplets. Lesions expanded along the leaflet margins and became necrotic. Movement of C. michiganensis subsp. michiganensis from the inoculated leaflet into the rachis was slow and erratic. Histological observations revealed that pathogen populations first developed within large intercellular spaces lying beneath the stomata, which serve as water pores in tomato hydathodes. Bacteria were first observed within vessels of the large marginal fimbriate veins 7 days after inoculation. By 14 days after inoculation, large populations could be seen within the vessels; and by 21 days after inoculation, tissue collapse was widespread and masses of bacteria could be seen in the intercellular spaces and within necrotic cells.

Attempts at Biological Control of Clavibacter michiganensis subsp. michiganensis On Rockwool-Grown Greenhouse Tomatoes

2008 ◽  
Vol 69 (1) ◽  
pp. 125-134 ◽  
Author(s):  
Czesław Ślusarski
Keyword(s):  
Biological Control ◽  
Biocontrol Agent ◽  
Root Zone ◽  
First Year ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Tomato Plants ◽  
Clavibacter Michiganensis Subsp ◽  
Greenhouse Tomatoes ◽  
Bacterial Canker Of Tomato

Attempts at Biological Control ofClavibacter michiganensissubsp.michiganensisOn Rockwool-Grown Greenhouse TomatoesTwo greenhouse experiments were conducted in which tomato plants artificially inoculated withClavibacter michiganensissubsp.michiganensis(Cmm) were grown in an open rockwool system as spring and autumn crops. Two isolates of the rhizosphere bacteria,Pseudomonas fluorescensstrain PSR21,Pseudomonas reactansstrain GGS14, a commercial biocontrol agent Aqua Bac Plus (Bacillusspp.) and a proprietary disinfectant containing QAC+Chx, applied at weekly intervals, were evaluated for their efficiency in the suppression of the bacterial canker of tomato. All treatments tested revealed to be ineffective in controlling the disease. The introduction ofCmmbacteria into the fresh rockwool in the first year of its usage resulted in a 100% death of tomato plants, whereas following an artificial inoculation of two- and three-year-old rockwool slabs withCmmbacteria dead plants amounted to 70 and 58%, respectively. This indicates that in the re-used rockwool a natural microbial suppressiveness to bacterial canker of tomato might be developed in the root zone.

scholarly journals First Record of Clavibacter michiganensis subsp. michiganensis Causing Canker of Tomato Plants in Syria

Plant Disease ◽  
2008 ◽  
Vol 92 (4) ◽  
pp. 649-649 ◽  
Author(s):  
R. Ftayeh ◽  
A. von Tiedemann ◽  
B. Koopmann ◽  
K. Rudolph ◽  
M. Abu-Ghorrah
Keyword(s):  
First Record ◽  
Bacterial Suspension ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Fresh Market ◽  
Gram Positive ◽  
Tomato Plants ◽  
Clavibacter Michiganensis Subsp ◽  
Whole Plants ◽  
Bacterial Canker Of Tomato

Between March and mid April of 2007, several extensive surveys for Clavibacter michiganensis subsp. michiganensis were carried out among greenhouses in the coastal strip provinces of the Mediterranean Sea in north-west Syria (Latakia and Tartous), where a large proportion of Syrian fresh-market tomatoes are produced. This bacterium causes bacterial canker of tomato and is considered an A2 quarantine pathogen by the European Plant Protection Organization (EPPO). It is currently present in all major tomato-production areas in the EPPO region (4), but has not been previously reported in Syria. The survey revealed typical canker symptoms in 7% of 150 inspected greenhouses that contained cvs. Dima, Huda, and Astona. These symptoms included stunting, dark brown-to-black lesions on the leaf margins, wilting and defoliation of whole plants, and vascular discoloration. The disease incidence in such greenhouses was estimated at 15% at the time of the survey. Diseased plants were surface sterilized and homogenized in sterile water. Serial dilutions were plated on nutrient glucose agar. Suspected colonies were further purified by repeated restreaking on new agar plates. All 10 of the suspected strains obtained from different locations were identified as C. michiganensis subsp. michiganensis on the basis of the following observations: bacterial cells of all strains had a coryneform shape, were nonmotile, gram positive according to Gram's reaction test with 3% KOH (2), oxidase-negative, and caused hypersensitive reactions on leaves of Mirabilis jalaba (1) within 24 h. PCR assays were conducted with the C. michiganensis subsp. michiganensis-specific primer set PSA-4/R (3) and template DNA prepared from in-vitro-grown bacteria with the MasterPure Gram Positive DNA Purification Kit (Epicentre Biotechnologies, Madison, WI). The expected 270-bp amplicon was observed for both reference strains as well as the Syrian strains. Pathogenicity of the strains was confirmed by artificial inoculation of 6-week-old tomato plants (Lycopersicon esculentum Mill. cv. Lyconorma). Inoculation was performed by stabbing the stem with a sterile needle through a drop (~35 μl) of bacterial suspension (~108 CFU/ml in 0.01 M MgSO4) placed in the axil of the second or third true leaf. Three tomato seedlings were inoculated with each strain. Control plants were inoculated with sterile 0.01 M MgSO4. Symptoms including lateral wilt of leaflets, stem lesions, and wilting of whole plants were observed within 10 to 15 days after inoculation, except for the negative control. To fulfill Koch's postulates, reisolation and reidentification of the pathogen was conducted as previously described. To our knowledge, this is the first record of the occurrence of bacterial canker of tomato in Syria. References: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990. (2) T. J. Gregersen. Appl. Microbiol. Biotechnol. 5:123, 1978. (3) K. H. Pastrik and F. A. Rainey. J. Phytopathol. 147:687, 1999. (4) I. M. Smith and L. M. F. Charles, eds. Map 253 in: Distribution Maps of Quarantine Pests for Europe. EPPO/CABI, 1998.

Screening of Tomato Somaclones for Resistance to Bacterial Canker (Clavibacter michiganensis subsp. michiganensis)

1991 ◽  
Vol 107 (3) ◽  
pp. 190-196 ◽  
Author(s):  
R. W. Bulk ◽  
J. Jansen ◽  
W. H. Lindhout ◽  
H. J. M. Loffler
Keyword(s):  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Clavibacter Michiganensis Subsp
Sign in / Sign up

Export Citation Format

Share Document