Novel decaplex PCR assay for simultaneous detection of scallop species with species-specific primers targeting highly variable 5′ end of the 16S rRNA gene

This study was carried out in order to compare two PCR-based methods in the detection of Streptococcus mutans. The first PCR method was based on primers for the 16S rRNA gene and the second method was based on specific primers that targeted the glucosyltransferase gene (gtfB). Each PCR was performed with eight different streptococci from the viridans group, five other streptococci and 17 different non-streptococcal bacterial strains. Direct use of the S. mutans 16S rRNA gene-specific primers revealed that Streptococcus gordonii and Streptococcus infantis were also detected. After amplifying the 16S rRNA gene with universal primers and subsequently performing nested PCR, the S. mutans-specific nested primers based on the 16S rRNA gene detected all tested streptococci. There was no cross-reaction of the gtfB primers after direct PCR. Our results indicate that direct PCR and nested PCR based on 16S rRNA genes can reveal false-positive results for oral streptococci and lead to an overestimation of the prevalence of S. mutans with regards to its role as the most prevalent causative agent of dental caries.

Download Full-text

Genus-specific primers targeting the 16S rRNA gene for PCR detection of members of the genus Verrucosispora

Antonie van Leeuwenhoek ◽

10.1007/s10482-011-9571-4 ◽

2011 ◽

Vol 100 (1) ◽

pp. 117-128 ◽

Cited By ~ 6

Author(s):

Qingyi Xie ◽

Kui Hong ◽

Michael Goodfellow

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Pcr Detection ◽

Rrna Gene ◽

Specific Primers ◽

The 16S Rrna Gene

Download Full-text

Nested PCR Assay for Detection of Granulocytic Ehrlichiae

Journal of Clinical Microbiology ◽

10.1128/jcm.36.4.1090-1095.1998 ◽

1998 ◽

Vol 36 (4) ◽

pp. 1090-1095 ◽

Cited By ~ 237

Author(s):

Robert F. Massung ◽

Kim Slater ◽

Jessica H. Owens ◽

William L. Nicholson ◽

Thomas N. Mather ◽

...

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Nested Pcr ◽

Limit Of Detection ◽

Rrna Gene ◽

Pcr Assay ◽

Serum Samples ◽

Blood Specimens ◽

The 16S Rrna Gene ◽

Edta Blood

A sensitive and specific nested PCR assay was developed for the detection of granulocytic ehrlichiae. The assay amplifies the 16S rRNA gene and was used to examine acute-phase EDTA-blood and serum samples obtained from seven humans with clinical presentations compatible with human granulocytic ehrlichiosis. Five of the seven suspected cases were positive by the PCR assay using DNA extracted from whole blood as the template, compared with a serologic assay that identified only one positive sample. The PCR assay using DNA extracted from the corresponding serum samples as the template identified three positive samples. The sensitivity of the assay on human samples was examined, and the limit of detection was shown to be fewer than 2 copies of the 16S rRNA gene. The application of the assay to nonhuman samples demonstrated products amplified from template DNA extracted fromIxodes scapularis ticks collected in Rhode Island and from EDTA-blood specimens obtained from white-tailed deer in Maryland. All PCR products were sequenced and identified as specific to granulocytic ehrlichiae. A putative variant granulocytic ehrlichia 16S rRNA gene sequence was detected among products amplified from both the ticks and the deer blood specimens.

Download Full-text

Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification

Journal of Clinical Microbiology ◽

10.1128/jcm.00112-06 ◽

2006 ◽

Vol 44 (8) ◽

pp. 2750-2759 ◽

Cited By ~ 54

Author(s):

F. Zucol ◽

R. A. Ammann ◽

C. Berger ◽

C. Aebi ◽

M. Altwegg ◽

...

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Real Time ◽

Species Identification ◽

Rrna Gene ◽

Pcr Assay ◽

The 16S Rrna Gene

Download Full-text

First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽

10.1094/pdis-03-13-0317-pdn ◽

2013 ◽

Vol 97 (10) ◽

pp. 1375-1375 ◽

Cited By ~ 1

Author(s):

B. Dutta ◽

R. D. Gitaitis ◽

F. H. Sanders ◽

C. Booth ◽

S. Smith ◽

...

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Leaf Spot ◽

Pathogenic Bacteria ◽

Bacterial Suspension ◽

Rrna Gene ◽

Bacterial Isolates ◽

Pcr Assay ◽

First Report ◽

The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Download Full-text

Distribution of Bifidobacterial Species in Human Intestinal Microflora Examined with 16S rRNA-Gene-Targeted Species-Specific Primers

Applied and Environmental Microbiology ◽

10.1128/aem.65.10.4506-4512.1999 ◽

1999 ◽

Vol 65 (10) ◽

pp. 4506-4512 ◽

Cited By ~ 319

Author(s):

Takahiro Matsuki ◽

Koichi Watanabe ◽

Ryuichiro Tanaka ◽

Masafumi Fukuda ◽

Hiroshi Oyaizu

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Intestinal Tract ◽

Bifidobacterium Longum ◽

Rrna Gene ◽

Human Feces ◽

Specific Primers ◽

Specific Pcr ◽

Species Specific ◽

Human Intestinal Tract

ABSTRACT In order to clarify the distribution of bifidobacterial species in the human intestinal tract, a 16S rRNA-gene-targeted species-specific PCR technique was developed and used with DNAs extracted from fecal samples obtained from 48 healthy adults and 27 breast-fed infants. To cover all of the bifidobacterial species that have been isolated from and identified in the human intestinal tract, species-specific primers for Bifidobacterium longum, B. infantis,B. dentium, and B. gallicum were developed and used with primers for B. adolescentis, B. angulatum, B. bifidum, B. breve, and the B. catenulatum group (B. catenulatum andB. pseudocatenulatum) that were developed in a previous study (T. Matsuki, K. Watanabe, R. Tanaka, and H. Oyaizu, FEMS Microbiol. Lett. 167:113–121, 1998). The specificity of the nine primers was confirmed by PCR, and the species-specific PCR method was found to be a useful means for identifying Bifidobacteriumstrains isolated from human feces. The results of an examination of bifidobacterial species distribution showed that the B. catenulatum group was the most commonly found taxon (detected in 44 of 48 samples [92%]), followed by B. longum andB. adolescentis, in the adult intestinal bifidobacterial flora and that B. breve, B. infantis, andB. longum were frequently found in the intestinal tracts of infants. The present study demonstrated that qualitative detection of the bifidobacterial species present in human feces can be accomplished rapidly and accurately.

Download Full-text

Development of a rapid identification method forAeromonasspecies by multiplex-PCR

Canadian Journal of Microbiology ◽

10.1139/w05-089 ◽

2005 ◽

Vol 51 (11) ◽

pp. 957-966 ◽

Cited By ~ 22

Author(s):

Keya Sen

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Multiplex Pcr ◽

Rapid Identification ◽

Complete Agreement ◽

Aeromonas Species ◽

Rrna Gene ◽

Primer Sets ◽

Species Specific ◽

The 16S Rrna Gene

Existing biochemical methods cannot distinguish among some species of Aeromonads, while genetic methods are labor intensive. In this study, primers were developed to three genes of Aeromonas: lipase, elastase, and DNA gyraseB. In addition, six previously described primer sets, five corresponding to species-specific signature regions of the 16S rRNA gene from A. veronii, A. popoffii, A. caviae, A. jandaei, and A. schubertii, respectively, and one corresponding to A. hydrophila specific lipase (hydrolipase), were chosen. The primer sets were combined in a series of multiplex-PCR (mPCR) assays against 38 previously characterized strains. Following PCR, each species was distinguished by the production of a unique combination of amplicons. When the assays were tested using 63 drinking water isolates, there was complete agreement in the species identification (ID) for 59 isolates, with ID established by biochemical assays. Sequencing the gyrB and the 16S rRNA gene from the remaining four strains established that the ID obtained by mPCR was correct for three strains. For only one strain, no consensus ID could be obtained. A rapid and reliable method for identification of different Aeromonas species is proposed that does not require restriction enzyme digestions, thus simplifying and speeding up the process.Key words: Aeromonas, multiplex-PCR, identification.

Download Full-text

Detection of Legionellae in Hospital Water Samples by Quantitative Real-Time LightCycler PCR

Applied and Environmental Microbiology ◽

10.1128/aem.67.9.3985-3993.2001 ◽

2001 ◽

Vol 67 (9) ◽

pp. 3985-3993 ◽

Cited By ~ 142

Author(s):

Nele Wellinghausen ◽

Cathrin Frost ◽

Reinhard Marre

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Water Samples ◽

Potable Water ◽

Water Systems ◽

Rrna Gene ◽

Pcr Assay ◽

Specific Pcr ◽

Pcr Assays ◽

The 16S Rrna Gene

ABSTRACT Contamination of hospital water systems with legionellae is a well-known cause of nosocomial legionellosis. We describe a new real-time LightCycler PCR assay for quantitative determination of legionellae in potable water samples. Primers that amplify both a 386-bp fragment of the 16S rRNA gene from Legionellaspp. and a specifically cloned fragment of the phage lambda, added to each sample as an internal inhibitor control, were used. The amplified products were detected by use of a dual-color hybridization probe assay design and quantified with external standards composed ofLegionella pneumophila genomic DNA. The PCR assay had a sensitivity of 1 fg of Legionella DNA (i.e., less than one Legionella organism) per assay and detected 44Legionella species and serogroups. Seventy-seven water samples from three hospitals were investigated by PCR and culture. The rates of detection of legionellae were 98.7% (76 of 77) by the PCR assay and 70.1% (54 of 77) by culture; PCR inhibitors were detected in one sample. The amounts of legionellae calculated from the PCR results were associated with the CFU detected by culture (r= 0.57; P < 0.001), but PCR results were mostly higher than the culture results. Since L. pneumophila is the main cause of legionellosis, we further developed a quantitativeL. pneumophila-specific PCR assay targeting the macrophage infectivity potentiator (mip) gene, which codes for an immunophilin of the FK506 binding protein family. All but one of the 16S rRNA gene PCR-positive water samples were also positive in the mip gene PCR, and the results of the two PCR assays were correlated. In conclusion, the newly developedLegionella genus-specific and L. pneumophila species-specific PCR assays proved to be valuable tools for investigation of Legionella contamination in potable water systems.

Download Full-text