scholarly journals Nested PCR Assay for Detection of Granulocytic Ehrlichiae

1998 ◽  
Vol 36 (4) ◽  
pp. 1090-1095 ◽  
Author(s):  
Robert F. Massung ◽  
Kim Slater ◽  
Jessica H. Owens ◽  
William L. Nicholson ◽  
Thomas N. Mather ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Limit Of Detection ◽  
Rrna Gene ◽  
Pcr Assay ◽  
Serum Samples ◽  
Blood Specimens ◽  
The 16S Rrna Gene ◽  
Edta Blood

A sensitive and specific nested PCR assay was developed for the detection of granulocytic ehrlichiae. The assay amplifies the 16S rRNA gene and was used to examine acute-phase EDTA-blood and serum samples obtained from seven humans with clinical presentations compatible with human granulocytic ehrlichiosis. Five of the seven suspected cases were positive by the PCR assay using DNA extracted from whole blood as the template, compared with a serologic assay that identified only one positive sample. The PCR assay using DNA extracted from the corresponding serum samples as the template identified three positive samples. The sensitivity of the assay on human samples was examined, and the limit of detection was shown to be fewer than 2 copies of the 16S rRNA gene. The application of the assay to nonhuman samples demonstrated products amplified from template DNA extracted fromIxodes scapularis ticks collected in Rhode Island and from EDTA-blood specimens obtained from white-tailed deer in Maryland. All PCR products were sequenced and identified as specific to granulocytic ehrlichiae. A putative variant granulocytic ehrlichia 16S rRNA gene sequence was detected among products amplified from both the ticks and the deer blood specimens.

Overestimation of Streptococcus mutans prevalence by nested PCR detection of the 16S rRNA gene

2006 ◽  
Vol 55 (1) ◽  
pp. 109-113 ◽  
Author(s):  
Ali Al-Ahmad ◽  
Thorsten Mathias Auschill ◽  
Gabriele Braun ◽  
Elmar Hellwig ◽  
Nicole Birgit Arweiler
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Streptococcus Mutans ◽  
Nested Pcr ◽  
16S Rrna Genes ◽  
Rrna Genes ◽  
Rrna Gene ◽  
Direct Pcr ◽  
Specific Primers ◽  
The 16S Rrna Gene

This study was carried out in order to compare two PCR-based methods in the detection of Streptococcus mutans. The first PCR method was based on primers for the 16S rRNA gene and the second method was based on specific primers that targeted the glucosyltransferase gene (gtfB). Each PCR was performed with eight different streptococci from the viridans group, five other streptococci and 17 different non-streptococcal bacterial strains. Direct use of the S. mutans 16S rRNA gene-specific primers revealed that Streptococcus gordonii and Streptococcus infantis were also detected. After amplifying the 16S rRNA gene with universal primers and subsequently performing nested PCR, the S. mutans-specific nested primers based on the 16S rRNA gene detected all tested streptococci. There was no cross-reaction of the gtfB primers after direct PCR. Our results indicate that direct PCR and nested PCR based on 16S rRNA genes can reveal false-positive results for oral streptococci and lead to an overestimation of the prevalence of S. mutans with regards to its role as the most prevalent causative agent of dental caries.

scholarly journals Development and Validation of PCR Primers To Assess the Diversity of Clostridium spp. in Cheese by Temporal Temperature Gradient Gel Electrophoresis

2005 ◽  
Vol 71 (1) ◽  
pp. 29-38 ◽  
Author(s):  
Anne-Ga�lle Le Bourhis ◽  
Katiana Saunier ◽  
Jo�l Dor� ◽  
Jean-Philippe Carlier ◽  
Jean-Fran�ois Chamba ◽  
...  
Keyword(s):  
Temperature Gradient ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Gel Electrophoresis ◽  
Rrna Gene ◽  
Gradient Gel Electrophoresis ◽  
Temperature Gradient Gel Electrophoresis ◽  
Clostridial Species ◽  
The 16S Rrna Gene

ABSTRACT A nested-PCR temporal temperature gradient gel electrophoresis (TTGE) approach was developed for the detection of bacteria belonging to phylogenetic cluster I of the genus Clostridium (the largest clostridial group, which represents 25% of the currently cultured clostridial species) in cheese suspected of late blowing. Primers were designed based on the 16S rRNA gene sequence, and the specificity was confirmed in PCRs performed with DNAs from cluster I and non-cluster I species as the templates. TTGE profiles of the PCR products, comprising the V5-V6 region of the 16S rRNA gene, allowed us to distinguish the majority of cluster I species. PCR-TTGE was applied to analyze commercial cheeses with defects. All cheeses gave a signal after nested PCR, and on the basis of band comigration with TTGE profiles of reference strains, all the bands could be assigned to a clostridial species. The direct identification of Clostridium spp. was confirmed by sequencing of excised bands. C. tyrobutyricum and C. beijerinckii contaminated 15 and 14 of the 20 cheese samples tested, respectively, and C. butyricum and C. sporogenes were detected in one cheese sample. Most-probable-number counts and volatile fatty acid were determined for comparison purposes. Results obtained were in agreement, but only two species, C. tyrobutyricum and C. sporogenes, could be isolated by the plating method. In all cheeses with a high amount of butyric acid (>100 mg/100 g), the presence of C. tyrobutyricum DNA was confirmed by PCR-TTGE, suggesting the involvement of this species in butyric acid fermentation. These results demonstrated the efficacy of the PCR-TTGE method to identify Clostridium in cheeses. The sensitivity of the method was estimated to be 100 CFU/g.

scholarly journals First Report of Blueberry Reddening Disease in Serbia Associated with 16SrXII-A (Stolbur) Phytoplasma

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1653-1653 ◽  
Author(s):  
M. Starović ◽  
S. Kojic ◽  
S. T. Kuzmanovic ◽  
S. D. Stojanovic ◽  
S. Pavlovic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Vaccinium Corymbosum ◽  
23S Rrna ◽  
Rrna Gene ◽  
Restriction Enzyme Digestion ◽  
First Report ◽  
Stolbur Phytoplasma ◽  
The 16S Rrna Gene

Blueberries (Vaccinium corymbosum) are among the healthiest fruits due to their high antioxidant content. The total growing area of blueberries in Serbia ranges from 80 to 90 ha. A phytoplasma-like disease was observed for the first time during July 2009 in three blueberry cultivars (Bluecrop, Duke, and Spartan) grown in central Serbia, locality Kopljare (44°20′10.9″ N, 20°38′39.3″ E). Symptoms of yellowing and reddening were observed on the upper leaves and proliferating shoots, similar to those already described on blueberries (4). There was uneven ripening of the fruits on affected plants. Incidence of affected plants within a single field was estimated to be greater than 20% in 2009 and 50% in 2010. Blueberry leaves, together with petioles, were collected during two seasons, 2009 and 2010, and six samples from diseased plants and one from symptomless plants from each cultivar, resulting in 42 samples in total. For phytoplasma detection, total DNA was extracted from the veins of symptomatic and asymptomatic leaves of V. corymbosum using the protocol of Angelini et al. (1). Universal oligonucleotide primers P1/P7 were used to amplify a 1.8-kb DNA fragment containing the 16S rRNA gene, the 16S-23S spacer region, and the 5′ end of the 23S rRNA gene. Subsequently, a 1.2-kb fragment of the 16S rRNA gene was amplified by nested PCR with the R16F2n/R16R2 primers. Reactions were performed in a volume of 50 μl using Dream Taq Green master mix (Thermo Scientific, Lithuania). PCR reaction conditions were as reported (3), except for R16F2n/R2 primers set (annealing for 30 s at 58°C). PCR products were obtained only from the DNA of symptomatic plants. Fragments of 1.2 kb were further characterized by the PCR-RFLP analysis, using AluI, HpaII, HhaI, and Tru1I restriction enzymes (Thermo Scientific, Lithuania), as recommended by the manufacturer. The products of restriction enzyme digestion were separated by electrophoresis on 2.5% agarose gel. All R16F2n/R2 amplicons showed identical RFLP patterns corresponding to the profile of the Stolbur phytoplasma (subgroup 16SrXII-A). The results were confirmed by sequencing the nested PCR product from the representative strain Br1. The sequence was deposited in NCBI GenBank database under accession number KC960486. Phylogenetic analysis showed maximal similarities with SH1 isolate from Vitis vinifera, Jordan (KC835139.1), Bushehr (Iran) eggplant big bud phytoplasma (JX483703.1), BA strain isolated from insect in Italy (JQ868436.1), and also with several plants from Serbia: Arnica montana L. (JX891383.1), corn (JQ730750.1), Hypericum perforatum (JQ033928.1), tobacco (JQ730740.1), etc. In conclusion, our results demonstrate that leaf discoloration of V. corymbosum was associated with a phytoplasma belonging to the 16SrXII-A subgroup. The wild European blueberry (Vaccinium myrtillus L.) is already detected as a host plant of 16SrIII-F phytoplasma in Germany, North America, and Lithuania (4). The main vector of the Stolbur phytoplasma, Hyalesthes obsoletus Signoret, was already detected in Serbia (2). The first report of Stolbur phytoplasma occurrence on blueberry in Serbia is significant for the management of the pathogen spreading in blueberry fields. Since the cultivation of blueberry has a great economic potential in the region, it is important to identify emerging disease concerns in order to ensure sustainable production. References: (1) E. Angelini et al. Vitis 40:79, 2001. (2) J. Jović et al. Phytopathology 99:1053, 2009. (3) S. Pavlovic et al. J. Med. Plants Res. 6:906, 2012. (4) D. Valiunas et al. J. Plant Pathol. 86:135, 2004.

scholarly journals Analytical Sensitivity, Reproducibility of Results, and Clinical Performance of Five PCR Assays for Detecting Chlamydia pneumoniae DNA in Peripheral Blood Mononuclear Cells

2000 ◽  
Vol 38 (7) ◽  
pp. 2622-2627 ◽  
Author(s):  
J. B. Mahony ◽  
S. Chong ◽  
B. K. Coombes ◽  
M. Smieja ◽  
A. Petrich
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Chlamydia Pneumoniae ◽  
Mononuclear Cells ◽  
Rrna Gene ◽  
Analytical Sensitivity ◽  
Infected Cells ◽  
Pcr Assays ◽  
The 16S Rrna Gene

Chlamydia pneumoniae has been associated with atherosclerosis and coronary artery disease (CAD), and its DNA has been detected in atheromatous lesions of the aorta, carotid, and coronary arteries by a variety of PCR assays. The objective of this study was to compare the performances of five published PCR assays in the detection of C. pneumoniae in peripheral blood mononuclear cells (PBMCs) from patients with coronary artery disease. The assays included two conventional PCRs, one targeting a cloned PstI fragment and one targeting the 16S rRNA gene; two nested PCRs, one targeting the 16S rRNA gene and one targeting ompA; and a touchdown enzyme time release (TETR) PCR, targeting the 16S rRNA gene. All PCRs had similar analytical sensitivities and detected a minimum of 0.005 inclusion-forming units (IFU) of C. pneumoniae; the ompA nested PCR and the TETR PCR were slightly more sensitive and detected 0.001 IFU. Assay reproducibility was examined by testing 10 replicates of C. pneumoniae DNA by each assay. All five assays showed excellent reproducibility at high levels of DNA, with scores of 10 out of 10 for 0.01 IFU, but exhibited decreased reproducibility for smaller numbers of C. pneumoniae IFU for all tests. Pairwise comparison of test results indicated that there was a significant difference between tests (Cochran Q = 32.0, P < 0.001), with thePstI fragment (P < 0.001) and 16S rRNA (P = 0.002) assays having lower reproducibility than the nested ompA and TETR assays. To further analyze assay sensitivity, C. pneumoniae-infected U-937 mononuclear cells were added to whole blood, and extracted mononuclear-cell DNA was tested by each assay. All five assays showed similar sensitivities, detecting 15 infected cells; three assays detected 3 infected cells, while all assays were negative at the next dilution (1.5 infected cells). A striking difference in performance of the five assays was seen, however, when PBMCs from CAD patients were tested for C. pneumoniae DNA. The ompA nested PCR detected C. pneumoniae DNA in 11 of 148 (7.4%) specimens, the 16S rRNA nested PCR detected 2 positives among the 148 specimens (1.4%) (P < 0.001), and the other 3 assays detected no positive specimens (P < 0.001, compared with theompA assay). These results indicate that analytical sensitivity alone does not predict the ability of an assay to detectC. pneumoniae in whole-blood-derived PBMCs. Before standardized assays can be used in wide-scale epidemiological studies, further characterization of these assays will be required to improve our understanding of their performance in the detection of C. pneumoniae in clinical material.

scholarly journals Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification

2006 ◽  
Vol 44 (8) ◽  
pp. 2750-2759 ◽  
Author(s):  
F. Zucol ◽  
R. A. Ammann ◽  
C. Berger ◽  
C. Aebi ◽  
M. Altwegg ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Real Time ◽  
Species Identification ◽  
Rrna Gene ◽  
Pcr Assay ◽  
The 16S Rrna Gene

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Nested PCR and RFLP Analysis Based on the 16S rRNA Gene

2012 ◽  
pp. 159-171 ◽  
Author(s):  
Bojan Duduk ◽  
Samanta Paltrinieri ◽  
Ing-Ming Lee ◽  
Assunta Bertaccini
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Rflp Analysis ◽  
Rrna Gene ◽  
The 16S Rrna Gene

scholarly journals Comparison of P1 and 16S rRNA genes for detection of Mycoplasma pneumoniae by nested PCR in adults in Zhejiang, China

2015 ◽  
Vol 9 (03) ◽  
pp. 244-253 ◽  
Author(s):  
Zibo Zhou ◽  
Xiangzhi Li ◽  
Xiaojian Chen ◽  
Lili Yao ◽  
Changwang Pan ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Mycoplasma Pneumoniae ◽  
Nested Pcr ◽  
16S Rrna Genes ◽  
Rrna Genes ◽  
Clinical Samples ◽  
Rrna Gene ◽  
Positive Rate ◽  
The 16S Rrna Gene

Introduction: Mycoplasma pneumoniae (M. pneumoniae) is the most common atypical pathogen that causes respiratory infections in humans. Laboratory tests are important in the diagnosis of M. pneumoniae because of the atypical features in clinical signs and symptoms. Nowadays, both the P1 adhesin gene and 16S ribosomal (r) RNA (rRNA) gene of M. pneumoniae have been widely detected by polymerase chain reaction (PCR). The purpose of the present study was to evaluate the most suitable target in the detection of M. pneumonia via nested PCR. Methodology: Both the P1 adhesin gene and 16S rRNA gene for nested PCR reaction conditions were optimized through an orthogonal test and single-factor experiment. Then, the sensitivity of the two sets of targets was evaluated. Finally, based on the optimal conditions, 55 clinical samples of throat swabs collected from adult patients in 2013 were examined by established nested PCR. Result: The results revealed that PCR detection of the 16S rRNA gene was more sensitive than the P1 adhesin gene because the detection limits for both the P1 gene and 16S rRNA gene were at least 100 fg and 10 fg of M. pneumoniae DNA, respectively. Furthermore, the positive rate for detection of the 16S rRNA gene (30/55; 54.5%) was higher than that of the P1 adhesin gene (25/55; 45.5%). Conclusion: Our results indicate that the 16S rRNA gene is more suitable for diagnosis of M. pneumoniae infection than the P1 adhesin gene due to its higher sensitivity and positive rate in clinical samples.

scholarly journals Detection of Legionellae in Hospital Water Samples by Quantitative Real-Time LightCycler PCR

2001 ◽  
Vol 67 (9) ◽  
pp. 3985-3993 ◽  
Author(s):  
Nele Wellinghausen ◽  
Cathrin Frost ◽  
Reinhard Marre
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Water Samples ◽  
Potable Water ◽  
Water Systems ◽  
Rrna Gene ◽  
Pcr Assay ◽  
Specific Pcr ◽  
Pcr Assays ◽  
The 16S Rrna Gene

ABSTRACT Contamination of hospital water systems with legionellae is a well-known cause of nosocomial legionellosis. We describe a new real-time LightCycler PCR assay for quantitative determination of legionellae in potable water samples. Primers that amplify both a 386-bp fragment of the 16S rRNA gene from Legionellaspp. and a specifically cloned fragment of the phage lambda, added to each sample as an internal inhibitor control, were used. The amplified products were detected by use of a dual-color hybridization probe assay design and quantified with external standards composed ofLegionella pneumophila genomic DNA. The PCR assay had a sensitivity of 1 fg of Legionella DNA (i.e., less than one Legionella organism) per assay and detected 44Legionella species and serogroups. Seventy-seven water samples from three hospitals were investigated by PCR and culture. The rates of detection of legionellae were 98.7% (76 of 77) by the PCR assay and 70.1% (54 of 77) by culture; PCR inhibitors were detected in one sample. The amounts of legionellae calculated from the PCR results were associated with the CFU detected by culture (r= 0.57; P < 0.001), but PCR results were mostly higher than the culture results. Since L. pneumophila is the main cause of legionellosis, we further developed a quantitativeL. pneumophila-specific PCR assay targeting the macrophage infectivity potentiator (mip) gene, which codes for an immunophilin of the FK506 binding protein family. All but one of the 16S rRNA gene PCR-positive water samples were also positive in the mip gene PCR, and the results of the two PCR assays were correlated. In conclusion, the newly developedLegionella genus-specific and L. pneumophila species-specific PCR assays proved to be valuable tools for investigation of Legionella contamination in potable water systems.

Sign in / Sign up

Export Citation Format

Share Document