scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals First Report of Pseudomonas oryzihabitans Causing Stem and Leaf Rot on Muskmelon in China

Plant Disease ◽  
2021 ◽  
Author(s):  
JuFen Li ◽  
Ganghan Zhou ◽  
Tan Wang ◽  
Tao Lin ◽  
yiwen wang ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Distilled Water ◽  
Phylogenetic Tree Analysis ◽  
First Report ◽  
Rot Disease ◽  
The 16S Rrna Gene ◽  
Leaf Rot

Muskmelon (Cucumis melo L.) is an important economic crop in China, which is planted on more than 376, 000 hectares with over 13 million tons of annual fruit production. In February 2020, a serious bacterial stem and leaf rot disease on muskmelon plants was observed in greenhouses in Liguo Town, Ledong County, Hainan Province, China (18.54° N, 108.87° E), with disease incidences being approximately 10 to 12%. Initially, soft rot symptoms appeared on petioles and stems, showing yellow bacterial ooze signs, which was different from the milky white ooze produced by Erwinia tracheiphila infection. The infected tissues of petioles, stems, and leaves eventually developed into browning and withering symptoms. To isolate and identify the causal agent, the lesion tissues were sterilized by immersion in 75% ethanol for 30 s, washed three times with sterile water, and then cut and soaked in 1 ml of distilled water for 10 min. The suspension was serially diluted and spread on Luria-Bertani agar (LB) medium. After incubation at 28°C for 24 to 36 h, the resulted bacterial colonies were tiny and were streaked on LB plate for further culture. After purification, the colonies were yellow, circular, smooth-margined, and two independent representative isolates CM-11 and CM-12 were used for further validation experiments. The electron microscope analysis showed that the pathogen was rod-shaped, with a length of 1.34 ± 0.22 μm and a width of 0.54 ± 0.06 μm (N=50), and had a single terminal flagellum. The gram staining of the two isolates was negative. Moreover, the tested strains were positive for catalase but negative for oxidase and were able to utilize D-glucose, L-arabinose, and D-mannitol. Morphological, physiological, and biochemical characteristics of both isolates were consistent with those of Pseudomonas spp. To verify the species identity of the bacterial pathogens, genomic DNA of isolates CM-11 and CM-12 was extracted and several conserved genes were amplified and sequenced, including the 16S rRNA gene with primers 27F/1492R (GenBank MW187499 and MW187500), rpoB gene with primers V4/LAPS27 (MW201910 and MW446819), and gyrB gene with primers gyrBBAUP2/APrU (MW187501 and MW187502) (Mulet et al. 2010). In the BLAST analysis, the 16S rRNA sequences showed a 99% similarity to that of Pseudomonas oryzihabitans strains TH19 (LC026009), AA21 (MG571765). The rpoB and gyrB sequences showed high similarity (> 98%) to P. oryzihabitans strains FDAARGOS_657. The phylogenetic tree analysis of rpoB and gyrB genes further verified that the two isolates CM-11 and CM-12 were most closely related to P. oryzihabitans species. Consequently, the two pathogenic isolates CM-11 and CM-12 were identified as P. oryzihabitans. Both strains of CM-11 and CM-12 were tested to accomplish Koch's postulates. Young branches of muskmelons (cultivar Yugu, 10 days after pollination) were chosen as the material for inoculation. Ten healthy detached branches were placed in 15 ml tubes by submerging the cutting wound in 5 ml of the bacterial suspension (108 CFU/ml). Ten additional branches were implemented with sterilized distilled water as a negative control. The inoculated branches were placed in a plastic box containing moistened paper at 28°C. Rotting symptoms appeared within 5 days after infection, while the control samples remained healthy. Bacteria were re-isolated from diseased tissues, and the 16S rRNA gene sequences of the isolates showed the same as those from the original pathogen. Panicle blight and grain discoloration disease caused by P. oryzihabitans on rice has been described in China (Hou et al. 2020). It’s also recently found that P. oryzihabitans caused center blackening disease on muskmelon fruit in Korea (Choi et al. 2019). This study indicated that it was a causative agent of stem and leaf rot disease during the field growth period. To the best of our knowledge, this is the first report of P. oryzihabitans causing muskmelon stem rot in China.

scholarly journals First Report of Blueberry Reddening Disease in Serbia Associated with 16SrXII-A (Stolbur) Phytoplasma

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1653-1653 ◽  
Author(s):  
M. Starović ◽  
S. Kojic ◽  
S. T. Kuzmanovic ◽  
S. D. Stojanovic ◽  
S. Pavlovic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Vaccinium Corymbosum ◽  
23S Rrna ◽  
Rrna Gene ◽  
Restriction Enzyme Digestion ◽  
First Report ◽  
Stolbur Phytoplasma ◽  
The 16S Rrna Gene

Blueberries (Vaccinium corymbosum) are among the healthiest fruits due to their high antioxidant content. The total growing area of blueberries in Serbia ranges from 80 to 90 ha. A phytoplasma-like disease was observed for the first time during July 2009 in three blueberry cultivars (Bluecrop, Duke, and Spartan) grown in central Serbia, locality Kopljare (44°20′10.9″ N, 20°38′39.3″ E). Symptoms of yellowing and reddening were observed on the upper leaves and proliferating shoots, similar to those already described on blueberries (4). There was uneven ripening of the fruits on affected plants. Incidence of affected plants within a single field was estimated to be greater than 20% in 2009 and 50% in 2010. Blueberry leaves, together with petioles, were collected during two seasons, 2009 and 2010, and six samples from diseased plants and one from symptomless plants from each cultivar, resulting in 42 samples in total. For phytoplasma detection, total DNA was extracted from the veins of symptomatic and asymptomatic leaves of V. corymbosum using the protocol of Angelini et al. (1). Universal oligonucleotide primers P1/P7 were used to amplify a 1.8-kb DNA fragment containing the 16S rRNA gene, the 16S-23S spacer region, and the 5′ end of the 23S rRNA gene. Subsequently, a 1.2-kb fragment of the 16S rRNA gene was amplified by nested PCR with the R16F2n/R16R2 primers. Reactions were performed in a volume of 50 μl using Dream Taq Green master mix (Thermo Scientific, Lithuania). PCR reaction conditions were as reported (3), except for R16F2n/R2 primers set (annealing for 30 s at 58°C). PCR products were obtained only from the DNA of symptomatic plants. Fragments of 1.2 kb were further characterized by the PCR-RFLP analysis, using AluI, HpaII, HhaI, and Tru1I restriction enzymes (Thermo Scientific, Lithuania), as recommended by the manufacturer. The products of restriction enzyme digestion were separated by electrophoresis on 2.5% agarose gel. All R16F2n/R2 amplicons showed identical RFLP patterns corresponding to the profile of the Stolbur phytoplasma (subgroup 16SrXII-A). The results were confirmed by sequencing the nested PCR product from the representative strain Br1. The sequence was deposited in NCBI GenBank database under accession number KC960486. Phylogenetic analysis showed maximal similarities with SH1 isolate from Vitis vinifera, Jordan (KC835139.1), Bushehr (Iran) eggplant big bud phytoplasma (JX483703.1), BA strain isolated from insect in Italy (JQ868436.1), and also with several plants from Serbia: Arnica montana L. (JX891383.1), corn (JQ730750.1), Hypericum perforatum (JQ033928.1), tobacco (JQ730740.1), etc. In conclusion, our results demonstrate that leaf discoloration of V. corymbosum was associated with a phytoplasma belonging to the 16SrXII-A subgroup. The wild European blueberry (Vaccinium myrtillus L.) is already detected as a host plant of 16SrIII-F phytoplasma in Germany, North America, and Lithuania (4). The main vector of the Stolbur phytoplasma, Hyalesthes obsoletus Signoret, was already detected in Serbia (2). The first report of Stolbur phytoplasma occurrence on blueberry in Serbia is significant for the management of the pathogen spreading in blueberry fields. Since the cultivation of blueberry has a great economic potential in the region, it is important to identify emerging disease concerns in order to ensure sustainable production. References: (1) E. Angelini et al. Vitis 40:79, 2001. (2) J. Jović et al. Phytopathology 99:1053, 2009. (3) S. Pavlovic et al. J. Med. Plants Res. 6:906, 2012. (4) D. Valiunas et al. J. Plant Pathol. 86:135, 2004.

scholarly journals Controlling Culex Quinquefasciatus Say, 1823 (Diptera: Culicidae) Using Several Lysinibacillus Sphaericus Isolates Endogenic to Indonesia

2021 ◽  
Vol 21 (1) ◽  
pp. 298
Author(s):  
Ika Indayati ◽  
Hari Purwanto
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Larval Mortality ◽  
Global Scale ◽  
Rrna Gene ◽  
Pathogenicity Test ◽  
Bacterial Isolates ◽  
Lysinibacillus Sphaericus ◽  
16S Rna ◽  
The 16S Rrna Gene

Mosquito-borne diseases include tropical diseases such as malaria, filariasis, dengue fever, chikungunya, yellow fever and cerebral fever are still major health problems in Indonesia and on a global scale. Various methods have been used to overcome this, including controlling vector mosquitoes using the entomopathogenic microbial Lysinibacillus sphaericus. This study aims to identify bacterial isolates collected based on the 16S rRNA gene and to carry out the pathogenicity test of the bacterial isolates collected on Cx. quinquefasciatus larvae. Bacterial isolates used in this study were collected from root soil, bird droppings and guano. The identification of the type of bacteria was carried out based on the 16S rRNA gene fragment. Based on the results of the 16S RNA sequence analysis of isolates 229C, 6B4, 6.2 and 4D21, it was found that the four isolates were included in the L. sphaericus species with similarity scores ranging from 97% to 100%. The pathogenicity of bacteria was measured based on the mortality of Cx. quinquefasciatus larvae to know whether it has pathogenicity equal to or higher than strain 1593. The pathogenicity test results of 6 isolates 15.4, 229C, 1593, 6B4, 6.2 and 4D21 showed that isolate 15.4 has the highest larval mortality rate, so it is potentially used as a biological agent to control disease vector mosquitoes.

scholarly journals First Report of Bacterial Stalk Rot of Maize Caused by Dickeya zeae in Mexico

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1267-1267 ◽  
Author(s):  
B. A. Martinez-Cisneros ◽  
G. Juarez-Lopez ◽  
N. Valencia-Torres ◽  
E. Duran-Peralta ◽  
M. Mezzalama
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Pathogenic Bacteria ◽  
The State ◽  
Rrna Gene ◽  
Bacterial Disease ◽  
Sterile Water ◽  
First Report ◽  
Stalk Rot ◽  
Positive Controls

A bacterial disease of maize, bacterial stalk and top rot, was found in the state of Morelos in February 2011, and in the state of Puebla in July 2013, Mexico. In both cases, the incidence of diseased plants was lower than 0.5%. The typical symptoms were a soft rot and darkening of the tissues affecting the stalk and the top of the plant, causing breaking of the stalk. The lesions progressed from the top to below nodes, leaf sheaths and blades, and rotten tissues emitted an unpleasant odor. Eleven diseased plants were collected, and bacterial colonies were isolated from fragments detached from the edges of symptomatic tissues after sterilization with a 0.5% solution of NaClO for 30 s, rinsing three times in sterile water. The sterilized fragments were macerated in drops of distilled sterile water for 10 min and the extract was streaked on King's medium B (agar 15 g, distilled water 1,000 ml, proteose peptone 20 g, K2HPO4 1.5 g, MgSO4·7H2O 1.5 g, glycerol 10 ml). Eight representative strains from Morelos and five from Puebla were selected for identification. All strains were gram-negative, grew at 37°C, showed pectynolitic activity on potato tubers, were positive for indole production, utilized arabinose, galactose, glucose, glycerol, lactose, mannose, melibiose, rafinose, ribose, and sucrose but did not produce acid from arabitol, adonitol, and keto-methyl-glucoside (3,4). Pathogenicity tests were conducted with each strain by inoculating with a syringe four 25-day-old maize seedlings with 107 CFU ml–1 bacterial cells in the leaf collar. Plants were incubated in the greenhouse at 30°C during the day and 24°C during the night with a 12-h photoperiod, and relative humidity of 93%. The reference strains Erwinia chrysanthemi pv zeae ATTC29942 and Dickeya zeae CFBP 2052 were used as positive controls in laboratory and greenhouses tests. Sterile water was used as negative control. Two days after inoculation, soft stalk rot symptoms developed that were identical to those observed in the field. No symptoms were observed on the negative controls. Diagnostic amplification of DNA by conventional PCR was carried out and yielded the expected amplicon size of 420 bp of the Dickeya-specific pel gene with the ADE primers set (2). PCR was used to amplify the 16S rRNA gene with the universal primers 27f and 1495r (5) for molecular identification of the 13 strains (GenBank Accession Nos. KJ438941, KJ438942, KJ438943, KJ438944, KJ438945, KJ438946, KJ438947, KJ438948, KJ438949, KJ438950, KJ438951, KJ438952, and KJ438953). The strains D. zeae CFBP 2052 and E. chrysanthemi pv. zeae ATCC 29942 were sequenced as positive controls. A BLAST search with the 13 16S rRNA gene sequences of 1.4 kb were 99% identical to the sequence of D. zeae CFBP 2052 (NR_041923). D. zeae can be a major disease of maize in tropical and subtropical countries. It is particularly severe under conditions of high temperature and high humidity, but it occurs sporadically. Control of the vector, Chilo partellus, can aid disease management (1). To our knowledge, this is the first report of D. zeae causing maize stalk rot in Mexico. References: (1) CABI. Crop Prot. Compend. CAB International, Wallingford, UK, 2014. (2) A. Nassar et al. Appl. Environ. Microbiol. 62:2228, 1996. (3) R. Samson et al. Int. J. Syst. Evol. Microbiol. 55:1415, 2005. (4) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. APS Press, St. Paul, MN, 2001. (5) W. G. Weisburg. J. Bacteriol. 173:697, 1991.

scholarly journals Identification and Assessment of Genetic Similarity of Soil Bacterial Isolates of Pseudomonas spp. Using Molecular Techniques

2014 ◽  
Vol 63 (3) ◽  
pp. 291-298
Author(s):  
ANNA LISEK ◽  
LIDIA SAS PASZ ◽  
PAWEŁ TRZCIŃSKI
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Genetic Similarity ◽  
Sour Cherry ◽  
23S Rrna ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Bacterial Strains ◽  
The 16S Rrna Gene ◽  
Selection Of

Bacteria of the genus Pseudomonas are often components of bioproducts designed to enhance the condition of the soil and plants. The use of Pseudomonas bacteria in bioproducts must be preceded by the acquisition, characterization and selection of beneficial strains living in the soil. A prerequisite for the selection of bacterial strains for use in bioproducts is to be able to identify the isolates rapidly and accurately. To identify and differentiate 15 bacterial isolates obtained from the soil surrounding the roots of sour cherry trees and to assess their genetic similarity, the rep-PCR technique and restriction analysis of the 16S rRNA gene and the 16S-ITS-23S rRNA operon were used. In addition, a sequence analysis of the 16S rRNA gene was performed. The analyses made it possible to divide the isolates into four clusters and to confirm their affiliation with the Pseudomonas species. RFLP analysis of the 16S-ITS-23S rRNA operon enabled greater differentiation of the isolates than RFLP of the 16S rRNA gene. The greatest differentiation of isolates within the clusters was obtained after using the rep-PCR technique. However, none of the techniques was able to discriminate all the isolates, which indicates very high genetic similarity of the Pseudomonas isolates found in the same sample of soil from around the roots of sour cherry trees. The tests performed will find application for distinguishing and identifying Pseudomonas strains collected from the soil in order to select the most valuable bacterial strains that produce beneficial effects on plants.

scholarly journals Nested PCR Assay for Detection of Granulocytic Ehrlichiae

1998 ◽  
Vol 36 (4) ◽  
pp. 1090-1095 ◽  
Author(s):  
Robert F. Massung ◽  
Kim Slater ◽  
Jessica H. Owens ◽  
William L. Nicholson ◽  
Thomas N. Mather ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Limit Of Detection ◽  
Rrna Gene ◽  
Pcr Assay ◽  
Serum Samples ◽  
Blood Specimens ◽  
The 16S Rrna Gene ◽  
Edta Blood

A sensitive and specific nested PCR assay was developed for the detection of granulocytic ehrlichiae. The assay amplifies the 16S rRNA gene and was used to examine acute-phase EDTA-blood and serum samples obtained from seven humans with clinical presentations compatible with human granulocytic ehrlichiosis. Five of the seven suspected cases were positive by the PCR assay using DNA extracted from whole blood as the template, compared with a serologic assay that identified only one positive sample. The PCR assay using DNA extracted from the corresponding serum samples as the template identified three positive samples. The sensitivity of the assay on human samples was examined, and the limit of detection was shown to be fewer than 2 copies of the 16S rRNA gene. The application of the assay to nonhuman samples demonstrated products amplified from template DNA extracted fromIxodes scapularis ticks collected in Rhode Island and from EDTA-blood specimens obtained from white-tailed deer in Maryland. All PCR products were sequenced and identified as specific to granulocytic ehrlichiae. A putative variant granulocytic ehrlichia 16S rRNA gene sequence was detected among products amplified from both the ticks and the deer blood specimens.

scholarly journals Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification

2006 ◽  
Vol 44 (8) ◽  
pp. 2750-2759 ◽  
Author(s):  
F. Zucol ◽  
R. A. Ammann ◽  
C. Berger ◽  
C. Aebi ◽  
M. Altwegg ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Real Time ◽  
Species Identification ◽  
Rrna Gene ◽  
Pcr Assay ◽  
The 16S Rrna Gene

scholarly journals Genetic characterization of the microbiota of artisan fresh cheese from the Papaloapan region

2021 ◽  
Vol 6 (2) ◽  
pp. 61-85
Author(s):  
Miguel A. García-Muñoz ◽  
◽  
Nancy Cruz-Velazco ◽  
América Chávez-Martínez ◽  
Cirilo Nolasco-Hipólito ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gel Electrophoresis ◽  
Pathogenic Bacteria ◽  
Denaturing Gradient Gel Electrophoresis ◽  
Starter Cultures ◽  
Rrna Gene ◽  
Gradient Gel Electrophoresis ◽  
Fresh Cheese ◽  
The 16S Rrna Gene

The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) method was used for bacteria identification. For all the samples, the presence of aerobic mesophiles, Streptococcus mesophiles and thermophiles, Lactobacillus mesophiles, Leuconostoc, total coliforms, Staphylococcus aureus, molds, and yeasts were identified. The complexity and variety of microorganisms in the summer and winter seasons samples were not significantly different. In conclusion, all samples of fresh artisan cheeses were under high microbial loads. Lactic Acid Bacteria (LAB) were in a typical load, as established by the quality and safety standards in the food industry. Conversely, pathogenic bacteria exceeded this limit. The microorganisms present in the fresh artisanal cheeses of the Papaloapan region were identified with precision, regarding the count and their diversity. A recommendation for the cheese manufacturers is to prepare starter cultures by selecting the appropriate microorganisms to produce the desirable characteristics such as aroma and flavor and reduce the risk of microbial infections by using pasteurized milk.

scholarly journals First Report of Bacterial Blight of Pomegranate Caused by Xanthomonas axonopodis pv. punicae in Turkey

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1427-1427 ◽  
Author(s):  
S. M. Icoz ◽  
I. Polat ◽  
G. Sulu ◽  
M. Yilmaz ◽  
A. Unlu ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacterial Blight ◽  
Acid Methyl Ester ◽  
Rrna Gene ◽  
Original Strain ◽  
Gene Sequences ◽  
Xanthomonas Axonopodis ◽  
First Report ◽  
The 16S Rrna Gene

Pomegranate (Punica granatum L.) is an increasingly important fruit crop that is widely cultivated in Turkey. Typical bacterial blight symptoms were observed since spring of 2011 in pomegranate orchards located in Antalya Province. Symptoms were characterized by dark brown, angular to irregularly shaped spots on leaves and fruit; cankers on stems, branches, and trunks; and split trunks. The pathogen was isolated from leaf spots on naturally infected plants showing typical symptoms onto yeast dextrose chalk agar. Bright yellow bacterial colonies were consistently isolated. Bacterial strains were characterized as gram negative, oxidase negative, catalase positive, tobacco hypersensitivity positive, and able to produce acid from L-arabinose, D-galactose, D-glucose, and D-mannitol but not from D-xylose. Pathogenicity of the representative bacterial strain Serik-4 was performed on 2-year-old pomegranate plants cv. Hicaz. Leaves were sprayed until runoff with bacterial cell suspensions containing 107 CFU/ml. Inoculated plants were covered with transparent plastic bags to maintain moisture for 48 h. Negative control plants were inoculated with sterile distilled water. Plants were then incubated in a greenhouse at 30°C for 14 days. Symptoms on leaves included dark brown, angular to irregularly shaped water soaked lesions along the veins of the inoculated plants 10 days after inoculation. No lesions developed on the control plants. The symptoms on inoculated plants were similar to those on naturally infected plants. Yellow bacterial colonies were re-isolated from the inoculated plants and identified as the same as the original strain by conventional tests and FAME analysis, thus fulfilling Koch's postulates. Fatty acid methyl ester profiling of the representative strain Serik-4 using GC-MIDI (Microbial Identification Inc, Newark, DE) identified the genus of the bacterium as Xanthomonas. The identity of Serik-4 was further confirmed by amplifying the 16S rRNA gene with the universal primers 27F and 1492R (3) and sequence analysis (GenBank Accession No. KM007073). The 16S rRNA gene sequences of Serik-4 was 99% identical to the corresponding gene sequences of the Xanthomonas axonopodis pv. punicae strain present in the NCBI database (JQ067629.1). High incidence of bacterial blight caused by X. axonopodis pv. punicae on pomegranate has been previously reported in India (2), Pakistan (1), and South Africa (4). To our knowledge, this is the first report of bacterial blight on pomegranate caused by X. axonopodis pv. punicae in Turkey. References: (1) M. A. Akhtar and M. H. R. Bhatti. Pakistan J. Agric. Res. 13:95, 1992. (2) R. Chand and R. Kishun. Indian Phytopathol. 44:370, 1991. (3) D. J. Lane. Page 115 in: Nucleic Acid Techniques in Bacterial Systematics, 1991. (4) Y. Petersen et al. Australas. Plant Pathol. 39:544, 2010.

Sign in / Sign up

Export Citation Format

Share Document