scholarly journals Constitutive Expression of a Nag-Like Dioxygenase Gene through an Internal Promoter in the 2-Chloronitrobenzene Catabolism Gene Cluster of Pseudomonas stutzeri ZWLR2-1

2016 ◽  
Vol 82 (12) ◽  
pp. 3461-3470 ◽  
Author(s):  
Yi-Zhou Gao ◽  
Hong Liu ◽  
Hong-Jun Chao ◽  
Ning-Yi Zhou
Keyword(s):  
Gene Cluster ◽  
Molecular Mechanisms ◽  
Expression System ◽  
Constitutive Expression ◽  
Pseudomonas Stutzeri ◽  
Initial Reaction ◽  
Synthetic Compounds ◽  
Content Type ◽  
Dioxygenase Gene ◽  
Catabolism Pathway

ABSTRACTThe gene cluster encoding the 2-chloronitrobenzene (2CNB) catabolism pathway inPseudomonas stutzeriZWLR2-1 is a patchwork assembly of a Nag-like dioxygenase (dioxygenase belonging to the naphthalene dioxygenase NagAaAbAcAd family fromRalstoniasp. strain U2) gene cluster and a chlorocatechol catabolism cluster. However, the transcriptional regulator gene usually present in the Nag-like dioxygenase gene cluster is missing, leaving it unclear how this cluster is expressed. The pattern of expression of the 2CNB catabolism cluster was investigated here. The results demonstrate that the expression was constitutive and not induced by its substrate 2CNB or salicylate, the usual inducer of expression in the Nag-like dioxygenase family. Reverse transcription-PCR indicated the presence of at least one transcript containing all the structural genes for 2CNB degradation. Among the three promoters verified in the gene cluster, P1 served as the promoter for the entire catabolism operon, but the internal promoters P2 and P3 also enhanced the transcription of the genes downstream. The P3 promoter, which was not previously defined as a promoter sequence, was the strongest of these three promoters. It drove the expression ofcnbAcAdencoding the dioxygenase that catalyzes the initial reaction in the 2CNB catabolism pathway. Bioinformatics and mutation analyses suggested that this P3 promoter evolved through the duplication of an 18-bp fragment and introduction of an extra 132-bp fragment.IMPORTANCEThe release of many synthetic compounds into the environment places selective pressure on bacteria to develop their ability to utilize these chemicals to grow. One of the problems that a bacterium must surmount is to evolve a regulatory device for expression of the corresponding catabolism genes. Considering that 2CNB is a xenobiotic that has existed only since the onset of synthetic chemistry, it may be a good example for studying the molecular mechanisms underlying rapid evolution in regulatory networks for the catabolism of synthetic compounds. The 2CNB utilizerPseudomonas stutzeriZWLR2-1 in this study has adapted itself to the new pollutant by evolving the always-inducible Nag-like dioxygenase into a constitutively expressed enzyme, and its expression has escaped the influence of salicylate. This may facilitate an understanding of how bacteria can rapidly adapt to the new synthetic compounds by evolving its expression system for key enzymes involved in the degradation of a xenobiotic.

scholarly journals Development of a Homologous Expression System for and Systematic Site-Directed Mutagenesis Analysis of Thurincin H, a Bacteriocin Produced by Bacillus thuringiensis SF361

2014 ◽  
Vol 80 (12) ◽  
pp. 3576-3584 ◽  
Author(s):  
Gaoyan Wang ◽  
David C. Manns ◽  
John J. Churey ◽  
Randy W. Worobo
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Bacillus Thuringiensis ◽  
Gene Cluster ◽  
Expression Vector ◽  
Expression System ◽  
Structural Genes ◽  
Cry Protein ◽  
Content Type ◽  
Thurincin H

ABSTRACTThurincin H is an antimicrobial peptide produced byBacillus thuringiensisSF361. With a helical back bone, the 31 amino acids of thurincin H form a hairpin structure maintained by four pairs of very unique sulfur-to-α-carbon thioether bonds. The production of thurincin H depends on a putative gene cluster containing 10 open reading frames. The gene cluster includes three tandem structural genes (thnA1,thnA2, andthnA3) encoding three identical 40-amino-acid thurincin H prepeptides and seven other genes putatively responsible for prepeptide processing, regulation, modification, exportation, and self-immunity. A homologous thurincin H expression system was developed by transforming a thurincin H-deficient host with a novel expression vector, pGW133. The host, designatedB. thuringiensisSF361 ΔthnA1ΔthnA2ΔthnA3, was constructed by deletion of the three tandem structural genes from the chromosome of the natural thurincin H producer. The thurincin H expression vector pGW133 was constructed by cloning the thurincin H native promoter,thnA1, and a Cry protein terminator into theEscherichia coli-B. thuringiensisshuttle vector pHT315. Thirty-three different pGW133 variants, each containing a different point mutation in thethnA1gene, were generated and separately transformed intoB. thuringiensisSF361 ΔthnA1ΔthnA2ΔthnA3. Those site-directed mutants contained either a single radical or conservative amino acid substitution on the thioether linkage-forming positions or a radical substitution on all other nonalanine amino acids. The bacteriocin activities ofB. thuringiensisSF361 ΔthnA1ΔthnA2ΔthnA3carrying different pGW133 variants against three different indicator strains were subsequently compared.

scholarly journals Candida albicans Ume6, a Filament-Specific Transcriptional Regulator, Directs Hyphal Growth via a Pathway Involving Hgc1 Cyclin-Related Protein

2010 ◽  
Vol 9 (9) ◽  
pp. 1320-1328 ◽  
Author(s):  
Patricia L. Carlisle ◽  
David Kadosh
Keyword(s):  
Candida Albicans ◽  
Molecular Mechanisms ◽  
Constitutive Expression ◽  
Transcriptional Regulator ◽  
Hyphal Growth ◽  
Related Protein ◽  
Content Type ◽  
Epistasis Analysis ◽  
Dependent Inactivation ◽  
Hyphal Formation

ABSTRACT The ability of Candida albicans, the most common human fungal pathogen, to transition from yeast to hyphae is essential for pathogenicity. While a variety of transcription factors important for filamentation have been identified and characterized, links between transcriptional regulators of C. albicans morphogenesis and molecular mechanisms that drive hyphal growth are not well defined. We have previously observed that constitutive expression of UME6, which encodes a filament-specific transcriptional regulator, is sufficient to direct hyphal growth in the absence of filament-inducing conditions. Here we show that HGC1, encoding a cyclin-related protein necessary for hyphal growth under filament-inducing conditions, is specifically important for agar invasion, hyphal extension, and formation of true septa in response to constitutive UME6 expression under non-filament-inducing conditions. HGC1-dependent inactivation of Rga2, a Cdc42 GTPase activating protein (GAP), also appears to be important for these processes. In response to filament-inducing conditions, HGC1 is induced prior to UME6 although UME6 controls the level and duration of HGC1 expression, which are likely to be important for hyphal extension. Interestingly, an epistasis analysis suggests that UME6 and HGC1 play distinct roles during early filament formation. These findings establish a link between a key regulator of filamentation and a downstream mechanism important for hyphal formation. In addition, this study demonstrates that a strain expressing constitutive high levels of UME6 provides a powerful strategy to specifically dissect downstream mechanisms important for hyphal development in the absence of complex filament-inducing conditions.

scholarly journals NAD-Independent l-Lactate Dehydrogenase Required for l-Lactate Utilization in Pseudomonas stutzeri A1501

2015 ◽  
Vol 197 (13) ◽  
pp. 2239-2247 ◽  
Author(s):  
Chao Gao ◽  
Yujiao Wang ◽  
Yingxin Zhang ◽  
Min Lv ◽  
Peipei Dou ◽  
...  
Keyword(s):  
Lactate Dehydrogenase ◽  
Gene Cluster ◽  
Pseudomonas Stutzeri ◽  
Lactate Metabolism ◽  
Lactate Oxidation ◽  
Iron Sulfur Cluster ◽  
Content Type ◽  
Sulfur Cluster ◽  
Iron Sulfur ◽  
Lactate Utilization

ABSTRACTNAD-independentl-lactate dehydrogenases (l-iLDHs) play important roles inl-lactate utilization of different organisms. All of the previously reportedl-iLDHs were flavoproteins that catalyze the oxidation ofl-lactate by the flavin mononucleotide (FMN)-dependent mechanism. Based on comparative genomic analysis, a gene cluster with three genes (lldA,lldB, andlldC) encoding a novel type ofl-iLDH was identified inPseudomonas stutzeriA1501. When the gene cluster was expressed inEscherichia coli, distinctivel-iLDH activity was detected. The expressedl-iLDH was purified by ammonium sulfate precipitation, ion-exchange chromatography, and affinity chromatography. SDS-PAGE and successive matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) analysis of the purifiedl-iLDH indicated that it is a complex of LldA, LldB, and LldC (encoded bylldA,lldB, andlldC, respectively). Purifiedl-iLDH (LldABC) is a dimer of three subunits (LldA, LldB, and LldC), and the ratio between LldA, LldB, and LldC is 1:1:1. Different from the FMN-containingl-iLDH, absorption spectra and elemental analysis suggested that LldABC might use the iron-sulfur cluster for thel-lactate oxidation. LldABC has narrow substrate specificity, and onlyl-lactate anddl-2-hydrobutyrate were rapidly oxidized. Mg2+could activatel-iLDH activity effectively (6.6-fold). Steady-state kinetics indicated a ping-pong mechanism of LldABC for thel-lactate oxidation. Based on the gene knockout results, LldABC was confirmed to be required for thel-lactate metabolism ofP. stutzeriA1501. LldABC is the first purified and characterizedl-iLDH with different subunits that uses the iron-sulfur cluster as the cofactor.IMPORTANCEProviding new insights into the diversity of microbial lactate utilization could assist in the production of valuable chemicals and understanding microbial pathogenesis. An NAD-independentl-lactate dehydrogenase (l-iLDH) encoded by the gene clusterlldABCis indispensable for thel-lactate metabolism inPseudomonas stutzeriA1501. This novel type of enzyme was purified and characterized in this study. Different from the well-characterized FMN-containingl-iLDH in other microbes, LldABC inP. stutzeriA1501 is a dimer of three subunits (LldA, LldB, and LldC) and uses the iron-sulfur cluster as a cofactor.

scholarly journals A SilencedvanAGene Cluster on a Transferable Plasmid Caused an Outbreak of Vancomycin-Variable Enterococci

2016 ◽  
Vol 60 (7) ◽  
pp. 4119-4127 ◽  
Author(s):  
Audun Sivertsen ◽  
Torunn Pedersen ◽  
Kjersti Wik Larssen ◽  
Kåre Bergh ◽  
Torunn Gresdal Rønning ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Molecular Mechanisms ◽  
Genetic Difference ◽  
Brain Heart Infusion ◽  
Broad Host Range ◽  
S1 Nuclease ◽  
Content Type ◽  
Transcription Profiles

ABSTRACTWe report an outbreak of vancomycin-variablevanA+enterococci (VVE) able to escape phenotypic detection by current guidelines and demonstrate the molecular mechanisms forin vivoswitching into vancomycin resistance and horizontal spread of thevanAcluster. Forty-eightvanA+Enterococcus faeciumisolates and oneEnterococcus faecalisisolate were analyzed for clonality with pulsed-field gel electrophoresis (PFGE), and theirvanAgene cluster compositions were assessed by PCR and whole-genome sequencing of six isolates. The susceptible VVE strains were cultivated in brain heart infusion broth containing vancomycin at 8 μg/ml forin vitrodevelopment of resistant VVE. The transcription profiles of susceptible VVE and their resistant revertants were assessed using quantitative reverse transcription-PCR. Plasmid content was analyzed with S1 nuclease PFGE and hybridizations. Conjugative transfer ofvanAwas assessed by filter mating. The only genetic difference between thevanAclusters of susceptible and resistant VVE was an ISL3-family element upstream ofvanHAX, which silencedvanHAXgene transcription in susceptible VVE. Furthermore, the VVE had an insertion of IS1542betweenorf2andvanRthat attenuated the expression ofvanHAX. Growth of susceptible VVE occurred after 24 to 72 h of exposure to vancomycin due to excision of the ISL3-family element. ThevanAgene cluster was located on a transferable broad-host-range plasmid also detected in outbreak isolates with different pulsotypes, including oneE. faecalisisolate. Horizontally transferable silencedvanAable to escape detection and revert into resistance during vancomycin therapy represents a new challenge in the clinic. Genotypic testing of invasive vancomycin-susceptible enterococci byvanA-PCR is advised.

scholarly journals PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

2015 ◽  
Vol 81 (23) ◽  
pp. 8084-8092 ◽  
Author(s):  
Minggen Cheng ◽  
Kai Chen ◽  
Suhui Guo ◽  
Xing Huang ◽  
Jian He ◽  
...  
Keyword(s):  
Binding Site ◽  
Gene Cluster ◽  
Transcriptional Start Site ◽  
Transcriptional Activator ◽  
Transcriptional Regulators ◽  
Mobility Shift ◽  
Content Type ◽  
Dnase I Footprinting ◽  
Dioxygenase Gene ◽  
Mobility Shift Assay

ABSTRACTThe 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2Bcluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed inSphingobium wenxiniaestrain JZ-1Tby its substrate 3-PBA. In this study, we identified a transcriptional activator of thepbaA1A2Bcluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 inSphingomonassp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of thepbaA1A2Bcluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component genepbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in thepbaA1A2Bpromoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

scholarly journals A Novel Membrane Protein, VanJ, Conferring Resistance to Teicoplanin

2012 ◽  
Vol 56 (4) ◽  
pp. 1784-1796 ◽  
Author(s):  
Gabriela Novotna ◽  
Chris Hill ◽  
Karen Vincent ◽  
Chang Liu ◽  
Hee-Jeon Hong
Keyword(s):  
Membrane Protein ◽  
Gene Cluster ◽  
Molecular Mechanisms ◽  
Bacterial Resistance ◽  
Streptomyces Coelicolor ◽  
Biosynthetic Gene Cluster ◽  
Glycopeptide Antibiotics ◽  
Content Type ◽  
Peptidoglycan Biosynthesis ◽  
New Family

ABSTRACTBacterial resistance to the glycopeptide antibiotic teicoplanin shows some important differences from the closely related compound vancomycin. They are currently poorly understood but may reflect significant differences in the mode of action of each antibiotic.Streptomyces coelicolorpossesses avanRSJKHAXgene cluster that when expressed confers resistance to both vancomycin and teicoplanin. The resistance to vancomycin is mediated by the enzymes encoded byvanKHAX, but not byvanJ. vanHAXeffect a reprogramming of peptidoglycan biosynthesis, which is considered to be generic, conferring resistance to all glycopeptide antibiotics. Here, we show thatvanKHAXare not in fact required for teicoplanin resistance inS. coelicolor, which instead is mediated solely byvanJ. vanJis shown to encode a membrane protein oriented with its C-terminal active site exposed to the extracytoplasmic space. VanJ also confers resistance to the teicoplanin-like antibiotics ristocetin and A47934 and to a broad range of semisynthetic teicoplanin derivatives, but not generally to antibiotics or semisynthetic derivatives with vancomycin-like structures.vanJhomologues are found ubiquitously in streptomycetes and includestaPfrom theStreptomyces toyocaensisA47934 biosynthetic gene cluster. While overexpression ofstaPalso conferred resistance to teicoplanin, similar expression of othervanJhomologues (SCO2255, SCO7017, and SAV5946) did not. ThevanJandstaPorthologues, therefore, appear to represent a subset of a larger protein family whose members have acquired specialist roles in antibiotic resistance. Future characterization of the divergent enzymatic activity within this new family will contribute to defining the molecular mechanisms important for teicoplanin activity and resistance.

scholarly journals Novel Metabolic Pathway for N-Methylpyrrolidone Degradation in Alicycliphilus sp. Strain BQ1

2017 ◽  
Vol 84 (1) ◽  
Author(s):  
Claudia Julieta Solís-González ◽  
Lilianha Domínguez-Malfavón ◽  
Martín Vargas-Suárez ◽  
Itzel Gaytán ◽  
Miguel Ángel Cevallos ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Metabolic Pathway ◽  
Molecular Mechanisms ◽  
Skin Irritation ◽  
Enzymatic Activities ◽  
Acid Oxidase ◽  
Amino Acid Oxidase ◽  
Content Type ◽  
Semialdehyde Dehydrogenase ◽  
Succinate Semialdehyde

ABSTRACTThe molecular mechanisms underlying the biodegradation ofN-methylpyrrolidone (NMP), a widely used industrial solvent that produces skin irritation in humans and is teratogenic in rats, are unknown.Alicycliphilussp. strain BQ1 degrades NMP. By studying a transposon-tagged mutant unable to degrade NMP, we identified a six-gene cluster (nmpABCDEF) that is transcribed as a polycistronic mRNA and encodes enzymes involved in NMP biodegradation.nmpAand the transposon-affected genenmpBencode anN-methylhydantoin amidohydrolase that transforms NMP to γ-N-methylaminobutyric acid; this is metabolized by an amino acid oxidase (NMPC), either by demethylation to produce γ-aminobutyric acid (GABA) or by deamination to produce succinate semialdehyde (SSA). If GABA is produced, the activity of a GABA aminotransferase (GABA-AT), not encoded in thenmpgene cluster, is needed to generate SSA. SSA is transformed by a succinate semialdehyde dehydrogenase (SSDH) (NMPF) to succinate, which enters the Krebs cycle. The abilities to consume NMP and to utilize it for growth were complemented in the transposon-tagged mutant by use of thenmpABCDgenes. Similarly,Escherichia coliMG1655, which has two SSDHs but is unable to grow in NMP, acquired these abilities after functional complementation with these genes. In wild-type (wt) BQ1 cells growing in NMP, GABA was not detected, but SSA was present at double the amount found in cells growing in Luria-Bertani medium (LB), suggesting that GABA is not an intermediate in this pathway. Moreover,E. coliGABA-AT deletion mutants complemented withnmpABCDgenes retained the ability to grow in NMP, supporting the possibility that γ-N-methylaminobutyric acid is deaminated to SSA instead of being demethylated to GABA.IMPORTANCEN-Methylpyrrolidone is a cyclic amide reported to be biodegradable. However, the metabolic pathway and enzymatic activities for degrading NMP are unknown. By developing molecular biology techniques forAlicycliphilussp. strain BQ1, an environmental bacterium able to grow in NMP, we identified a six-gene cluster encoding enzymatic activities involved in NMP degradation. These findings set the basis for the study of new enzymatic activities and for the development of biotechnological processes with potential applications in bioremediation.

scholarly journals A Novel Angular Dioxygenase Gene Cluster Encoding 3-Phenoxybenzoate 1′,2′-Dioxygenase in Sphingobium wenxiniae JZ-1

2014 ◽  
Vol 80 (13) ◽  
pp. 3811-3818 ◽  
Author(s):  
Chenghong Wang ◽  
Qing Chen ◽  
Rui Wang ◽  
Chao Shi ◽  
Xin Yan ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Heme Iron ◽  
Transcriptional Level ◽  
Content Type ◽  
Type Iv ◽  
Reductase Gene ◽  
Wide Range ◽  
Dioxygenase Gene ◽  
Sphingomonas Wittichii ◽  
Angular Dioxygenase

ABSTRACTSphingobium wenxiniaeJZ-1 utilizes a wide range of pyrethroids and their metabolic product, 3-phenoxybenzoate, as sources of carbon and energy. A mutant JZ-1 strain, MJZ-1, defective in the degradation of 3-phenoxybenzoate was obtained by successive streaking on LB agar. Comparison of the draft genomes of strains JZ-1 and MJZ-1 revealed that a 29,366-bp DNA fragment containing a putative angular dioxygenase gene cluster (pbaA1A2B) is missing in strain MJZ-1. PbaA1, PbaA2, and PbaB share 65%, 52%, and 10% identity with the corresponding α and β subunits and the ferredoxin component of dioxin dioxygenase fromSphingomonas wittichiiRW1, respectively. Complementation ofpbaA1A2Bin strain MJZ-1 resulted in the active 3-phenoxybenzoate 1′,2′-dioxygenase, but the enzyme activity inEscherichia coliwas achieved only through the coexpression ofpbaA1A2Band a glutathione reductase (GR)-type reductase gene,pbaC, indicating that the 3-phenoxybenzoate 1′,2′-dioxygenase belongs to a type IV Rieske non-heme iron aromatic ring-hydroxylating oxygenase system consisting of a hetero-oligomeric oxygenase, a [2Fe-2S]-type ferredoxin, and a GR-type reductase. ThepbaCgene is not located in the immediate vicinity ofpbaA1A2B. 3-Phenoxybenzoate 1′,2′-dioxygenase catalyzes the hydroxylation in the 1′ and 2′ positions of the benzene moiety of 3-phenoxybenzoate, yielding 3-hydroxybenzoate and catechol. Transcription ofpbaA1A2BandpbaCwas induced by 3-phenoxybenzoate, but the transcriptional level ofpbaCwas far less than that ofpbaA1A2B, implying the possibility that PbaC may not be the only reductase that can physiologically transfer electrons to PbaA1A2B in strain JZ-1. Some GR-type reductases from other sphingomonad strains could also transfer electrons to PbaA1A2B, suggesting that PbaA1A2B has a low specificity for reductase.

scholarly journals Metabolism of Four α-Glycosidic Linkage-Containing Oligosaccharides by Bifidobacterium breve UCC2003

2013 ◽  
Vol 79 (20) ◽  
pp. 6280-6292 ◽  
Author(s):  
Kerry Joan O'Connell ◽  
Mary O'Connell Motherway ◽  
John O'Callaghan ◽  
Gerald F. Fitzgerald ◽  
R. Paul Ross ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Molecular Mechanisms ◽  
Functional Genomic ◽  
Adjacent Gene ◽  
Glycosidic Linkage ◽  
Carbohydrate Utilization ◽  
Content Type ◽  
Bifidobacterium Breve

ABSTRACTMembers of the genusBifidobacteriumare common inhabitants of the gastrointestinal tracts of humans and other mammals, where they ferment many diet-derived carbohydrates that cannot be digested by their hosts. To extend our understanding of bifidobacterial carbohydrate utilization, we investigated the molecular mechanisms by which 11 strains ofBifidobacterium brevemetabolize four distinct α-glucose- and/or α-galactose-containing oligosaccharides, namely, raffinose, stachyose, melibiose, and melezitose. Here we demonstrate that allB. brevestrains examined possess the ability to utilize raffinose, stachyose, and melibiose. However, the ability to metabolize melezitose was not common to allB. brevestrains tested. Transcriptomic and functional genomic approaches identified a gene cluster dedicated to the metabolism of α-galactose-containing carbohydrates, while an adjacent gene cluster, dedicated to the metabolism of α-glucose-containing melezitose, was identified in strains that are able to use this carbohydrate.

scholarly journals 3-Hydroxypyridine Dehydrogenase HpdA Is Encoded by a Novel Four-Component Gene Cluster and Catalyzes the First Step of 3-Hydroxypyridine Catabolism in Ensifer adhaerens HP1

2020 ◽  
Vol 86 (19) ◽  
Author(s):  
Haixia Wang ◽  
Xiaoyu Wang ◽  
Hao Ren ◽  
Xuejun Wang ◽  
Zhenmei Lu
Keyword(s):  
Gene Cluster ◽  
Microbial Degradation ◽  
Molecular Mechanisms ◽  
Gene Clusters ◽  
Pyridine Derivative ◽  
Pyruvate Phosphate Dikinase ◽  
Content Type ◽  
Ensifer Adhaerens ◽  
Microbial Strains ◽  
Important Building Block

ABSTRACT 3-Hydroxypyridine (3HP) is an important natural pyridine derivative. Ensifer adhaerens HP1 can utilize 3HP as its sole sources of carbon, nitrogen, and energy to grow, but the genes responsible for the degradation of 3HP remain unknown. In this study, we predicted that a gene cluster, designated 3hpd, might be responsible for the degradation of 3HP. The analysis showed that the initial hydroxylation of 3HP in E. adhaerens HP1 was catalyzed by a four-component dehydrogenase (HpdA1A2A3A4) and led to the formation of 2,5-dihydroxypyridine (2,5-DHP). In addition, the SRPBCC component in HpdA existed as a separate subunit, which is different from other SRPBCC-containing molybdohydroxylases acting on N-heterocyclic aromatic compounds. Moreover, the results demonstrated that the phosphoenolpyruvate (PEP)-utilizing protein and pyruvate-phosphate dikinase were involved in the HpdA activity, and the presence of the gene cluster 3hpd was discovered in the genomes of diverse microbial strains. Our findings provide a better understanding of the microbial degradation of pyridine derivatives in nature and indicated that further research on the origin of the discovered four-component dehydrogenase with a separate SRPBCC domain and the function of PEP-utilizing protein and pyruvate-phosphate dikinase might be of great significance. IMPORTANCE 3-Hydroxypyridine is an important building block for the synthesis of drugs, herbicides, and antibiotics. Although the microbial degradation of 3-hydroxypyridine has been studied for many years, the molecular mechanisms remain unclear. Here, we show that 3hpd is responsible for the catabolism of 3-hydroxypyridine. The 3hpd gene cluster was found to be widespread in Actinobacteria, Rubrobacteria, Thermoleophilia, and Alpha-, Beta-, and Gammaproteobacteria, and the genetic organization of the 3hpd gene clusters in these bacteria shows high diversity. Our findings provide new insight into the catabolism of 3-hydroxypyridine in bacteria.

Sign in / Sign up

Export Citation Format

Share Document