scholarly journals A Novel Angular Dioxygenase Gene Cluster Encoding 3-Phenoxybenzoate 1′,2′-Dioxygenase in Sphingobium wenxiniae JZ-1

2014 ◽  
Vol 80 (13) ◽  
pp. 3811-3818 ◽  
Author(s):  
Chenghong Wang ◽  
Qing Chen ◽  
Rui Wang ◽  
Chao Shi ◽  
Xin Yan ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Heme Iron ◽  
Transcriptional Level ◽  
Content Type ◽  
Type Iv ◽  
Reductase Gene ◽  
Wide Range ◽  
Dioxygenase Gene ◽  
Sphingomonas Wittichii ◽  
Angular Dioxygenase

ABSTRACTSphingobium wenxiniaeJZ-1 utilizes a wide range of pyrethroids and their metabolic product, 3-phenoxybenzoate, as sources of carbon and energy. A mutant JZ-1 strain, MJZ-1, defective in the degradation of 3-phenoxybenzoate was obtained by successive streaking on LB agar. Comparison of the draft genomes of strains JZ-1 and MJZ-1 revealed that a 29,366-bp DNA fragment containing a putative angular dioxygenase gene cluster (pbaA1A2B) is missing in strain MJZ-1. PbaA1, PbaA2, and PbaB share 65%, 52%, and 10% identity with the corresponding α and β subunits and the ferredoxin component of dioxin dioxygenase fromSphingomonas wittichiiRW1, respectively. Complementation ofpbaA1A2Bin strain MJZ-1 resulted in the active 3-phenoxybenzoate 1′,2′-dioxygenase, but the enzyme activity inEscherichia coliwas achieved only through the coexpression ofpbaA1A2Band a glutathione reductase (GR)-type reductase gene,pbaC, indicating that the 3-phenoxybenzoate 1′,2′-dioxygenase belongs to a type IV Rieske non-heme iron aromatic ring-hydroxylating oxygenase system consisting of a hetero-oligomeric oxygenase, a [2Fe-2S]-type ferredoxin, and a GR-type reductase. ThepbaCgene is not located in the immediate vicinity ofpbaA1A2B. 3-Phenoxybenzoate 1′,2′-dioxygenase catalyzes the hydroxylation in the 1′ and 2′ positions of the benzene moiety of 3-phenoxybenzoate, yielding 3-hydroxybenzoate and catechol. Transcription ofpbaA1A2BandpbaCwas induced by 3-phenoxybenzoate, but the transcriptional level ofpbaCwas far less than that ofpbaA1A2B, implying the possibility that PbaC may not be the only reductase that can physiologically transfer electrons to PbaA1A2B in strain JZ-1. Some GR-type reductases from other sphingomonad strains could also transfer electrons to PbaA1A2B, suggesting that PbaA1A2B has a low specificity for reductase.

scholarly journals Gene Cluster Responsible for Secretion of and Immunity to Multiple Bacteriocins, the NKR-5-3 Enterocins

2014 ◽  
Vol 80 (21) ◽  
pp. 6647-6655 ◽  
Author(s):  
Naoki Ishibashi ◽  
Kohei Himeno ◽  
Yoshimitsu Masuda ◽  
Rodney Honrada Perez ◽  
Shun Iwatani ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Abc Transporter ◽  
Response Regulator ◽  
Regulatory System ◽  
Content Type ◽  
Expression Studies ◽  
A Genome ◽  
Wide Range ◽  
Close Proximity ◽  
Immunity Genes

ABSTRACTEnterococcus faeciumNKR-5-3, isolated from Thai fermented fish, is characterized by the unique ability to produce five bacteriocins, namely, enterocins NKR-5-3A, -B, -C, -D, and -Z (Ent53A, Ent53B, Ent53C, Ent53D, and Ent53Z). Genetic analysis with a genome library revealed that the bacteriocin structural genes (enkA[ent53A],enkC[ent53C],enkD[ent53D], andenkZ[ent53Z]) that encode these peptides (except for Ent53B) are located in close proximity to each other. This NKR-5-3ACDZ (Ent53ACDZ) enterocin gene cluster (approximately 13 kb long) includes certain bacteriocin biosynthetic genes such as an ABC transporter gene (enkT), two immunity genes (enkIazandenkIc), a response regulator (enkR), and a histidine protein kinase (enkK). Heterologous-expression studies ofenkTand ΔenkTmutant strains showed thatenkTis responsible for the secretion of Ent53A, Ent53C, Ent53D, and Ent53Z, suggesting that EnkT is a wide-range ABC transporter that contributes to the effective production of these bacteriocins. In addition, EnkIaz and EnkIc were found to confer self-immunity to the respective bacteriocins. Furthermore, bacteriocin induction assays performed with the ΔenkRKmutant strain showed that EnkR and EnkK are regulatory proteins responsible for bacteriocin production and that, together with Ent53D, they constitute a three-component regulatory system. Thus, the Ent53ACDZ gene cluster is essential for the biosynthesis and regulation of NKR-5-3 enterocins, and this is, to our knowledge, the first report that demonstrates the secretion of multiple bacteriocins by an ABC transporter.

scholarly journals A Novel AdpA Homologue Negatively Regulates Morphological Differentiation inStreptomyces xiamenensis318

2019 ◽  
Vol 85 (7) ◽  
Author(s):  
Xu-Liang Bu ◽  
Jing-Yi Weng ◽  
Bei-Bei He ◽  
Min-Juan Xu ◽  
Jun Xu
Keyword(s):  
Cell Growth ◽  
Secondary Metabolism ◽  
Gene Cluster ◽  
Morphological Differentiation ◽  
Gene Clusters ◽  
Transcriptional Level ◽  
Negative Effects ◽  
Promoter Regions ◽  
Content Type ◽  
Enhanced Production

ABSTRACTThe pleiotropic transcriptional regulator AdpA positively controls morphological differentiation and regulates secondary metabolism in mostStreptomycesspecies.Streptomyces xiamenensis318 has a linear chromosome 5.96 Mb in size. How AdpA affects secondary metabolism and morphological differentiation in such a naturally minimized genomic background is unknown. Here, we demonstrated that AdpASx, an AdpA orthologue inS. xiamenensis, negatively regulates cell growth and sporulation and bidirectionally regulates the biosynthesis of xiamenmycin and polycyclic tetramate macrolactams (PTMs) inS. xiamenensis318. Overexpression of theadpASxgene inS. xiamenensis318 had negative effects on morphological differentiation and resulted in reduced transcription of putativessgA,ftsZ,ftsH,amfC,whiB,wblA1,wblA2,wblE, and a gene encoding sporulation-associated protein (sxim_29740), whereas the transcription of putativebldDandbldAgenes was upregulated. Overexpression ofadpASxled to significantly enhanced production of xiamenmycin but had detrimental effects on the production of PTMs. As expected, the transcriptional level of theximgene cluster was upregulated, whereas the PTM gene cluster was downregulated. Moreover, AdpASxnegatively regulated the transcription of its own gene. Electrophoretic mobility shift assays revealed that AdpASxcan bind the promoter regions of structural genes of both theximand PTM gene clusters as well as to the promoter regions of genes potentially involved in the cell growth and differentiation ofS. xiamenensis318. We report that an AdpA homologue has negative effects on morphological differentiation inS. xiamenensis318, a finding confirmed when AdpASxwas introduced into the heterologous hostStreptomyces lividansTK24.IMPORTANCEAdpA is a key regulator of secondary metabolism and morphological differentiation inStreptomycesspecies. However, AdpA had not been reported to negatively regulate morphological differentiation. Here, we characterized the regulatory role of AdpASxinStreptomyces xiamenensis318, which has a naturally streamlined genome. In this strain, AdpASxnegatively regulated cell growth and morphological differentiation by directly controlling genes associated with these functions. AdpASxalso bidirectionally controlled the biosynthesis of xiamenmycin and PTMs by directly regulating their gene clusters rather than through other regulators. Our findings provide additional evidence for the versatility of AdpA in regulating morphological differentiation and secondary metabolism inStreptomyces.

scholarly journals Genomic Characterization of Urethritis-Associated Neisseria meningitidis Shows that a Wide Range of N. meningitidis Strains Can Cause Urethritis

2017 ◽  
Vol 55 (12) ◽  
pp. 3374-3383 ◽  
Author(s):  
Kevin C. Ma ◽  
Magnus Unemo ◽  
Samo Jeverica ◽  
Robert D. Kirkcaldy ◽  
Hideyuki Takahashi ◽  
...  
Keyword(s):  
Neisseria Meningitidis ◽  
Etiologic Agent ◽  
Factor H ◽  
Urogenital Tract ◽  
Genetic Characteristics ◽  
Content Type ◽  
Nitrite Reductase Gene ◽  
Reductase Gene ◽  
Wide Range ◽  
Genomic Characterization

ABSTRACTNeisseria meningitidis, typically a resident of the oro- or nasopharynx and the causative agent of meningococcal meningitis and meningococcemia, is capable of invading and colonizing the urogenital tract. This can result in urethritis, akin to the syndrome caused by its sister species,N. gonorrhoeae, the etiologic agent of gonorrhea. Recently, meningococcal strains associated with outbreaks of urethritis were reported to share genetic characteristics with the gonococcus, raising the question of the extent to which these strains contain features that promote adaptation to the genitourinary niche, making them gonococcus-like and distinguishing them from otherN. meningitidisstrains. Here, we analyzed the genomes of 39 diverseN. meningitidisisolates associated with urethritis, collected independently over a decade and across three continents. In particular, we characterized the diversity of the nitrite reductase gene (aniA), the factor H-binding protein gene (fHbp), and the capsule biosynthetic locus, all of which are loci previously suggested to be associated with urogenital colonization. We observed notable diversity, including frameshift variants, inaniAandfHbpand the presence of intact, disrupted, and absent capsule biosynthetic genes, indicating that urogenital colonization and urethritis caused byN. meningitidisare possible across a range of meningococcal genotypes. Previously identified allelic patterns in urethritis-associatedN. meningitidisstrains may reflect genetic diversity in the underlying meningococcal population rather than novel adaptation to the urogenital tract.

scholarly journals Degradation of Diphenyl Ether in Sphingobium phenoxybenzoativorans SC_3 Is Initiated by a Novel Ring Cleavage Dioxygenase

2017 ◽  
Vol 83 (10) ◽  
Author(s):  
Shu Cai ◽  
Li-Wei Chen ◽  
Yu-Chun Ai ◽  
Ji-Guo Qiu ◽  
Cheng-Hong Wang ◽  
...  
Keyword(s):  
Benzene Ring ◽  
Aromatic Compounds ◽  
Diphenyl Ether ◽  
Angular Position ◽  
Heme Iron ◽  
Ring Cleavage ◽  
Phenyl Ester ◽  
Muconic Acid ◽  
Content Type ◽  
Angular Dioxygenase

ABSTRACT Sphingobium phenoxybenzoativorans SC_3 degrades and utilizes diphenyl ether (DE) or 2-carboxy-DE as its sole carbon and energy source. In this study, we report the degradation of DE and 2-carboxy-DE initiated by a novel ring cleavage angular dioxygenase (diphenyl ether dioxygenase [Dpe]) in the strain. Dpe functions at the angular carbon and its adjacent carbon (C-1a, C-2) of a benzene ring in DE (or the 2-carboxybenzene ring in 2-carboxy-DE) and cleaves the C-1a—C-2 bond (decarboxylation occurs simultaneously for 2-carboxy-DE), yielding 2,4-hexadienal phenyl ester, which is subsequently hydrolyzed to muconic acid semialdehyde and phenol. Dpe is a type IV Rieske non-heme iron oxygenase (RHO) and consists of three components: a hetero-oligomer oxygenase, a [2Fe-2S]-type ferredoxin, and a glutathione reductase (GR)-type reductase. Genetic analyses revealed that dpeA1A2 plays an essential role in the degradation and utilization of DE and 2-carboxy-DE in S. phenoxybenzoativorans SC_3. Enzymatic study showed that transformation of 1 molecule of DE needs two molecules of oxygen and two molecules of NADH, supporting the assumption that the cleavage of DE catalyzed by Dpe is a continuous two-step dioxygenation process: DE is dioxygenated at C-1a and C-2 to form a hemiacetal-like intermediate, which is further deoxygenated, resulting in the cleavage of the C-1a—C-2 bond to form one molecule of 2,4-hexadienal phenyl ester and two molecules of H2O. This study extends our knowledge of the mode and mechanism of ring cleavage of aromatic compounds. IMPORTANCE Benzene ring cleavage, catalyzed by dioxygenase, is the key and speed-limiting step in the aerobic degradation of aromatic compounds. As previously reported, in the ring cleavage of DEs, the benzene ring needs to be first dihydroxylated at a lateral position and subsequently dehydrogenated and opened through extradiol cleavage. This process requires three enzymes (two dioxygenases and one dehydrogenase). In this study, we identified a novel angular dioxygenase (Dpe) in S. phenoxybenzoativorans SC_3. Under Dpe-mediated catalysis, the benzene ring of DE is dioxygenated at the angular position (C-1a, C-2), resulting in the cleavage of the C-1a—C-2 bond to generate a novel product, 2,4-hexadienal phenyl ester. This process needs only one angular dioxygenase, Dpe. Thus, the ring cleavage catalyzed by Dpe represents a novel mechanism of benzene ring cleavage.

scholarly journals Novel Three-Component Rieske Non-Heme Iron Oxygenase System Catalyzing theN-Dealkylation of Chloroacetanilide Herbicides in Sphingomonads DC-6 and DC-2

2014 ◽  
Vol 80 (16) ◽  
pp. 5078-5085 ◽  
Author(s):  
Qing Chen ◽  
Cheng-Hong Wang ◽  
Shi-Kai Deng ◽  
Ya-Dong Wu ◽  
Yi Li ◽  
...  
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Heme Iron ◽  
Content Type ◽  
Non Heme Iron ◽  
Transport Component ◽  
Reductase Gene ◽  
Chloroacetanilide Herbicides ◽  
The Individual ◽  
Sequence Identities

ABSTRACTSphingomonads DC-6 and DC-2 degrade the chloroacetanilide herbicides alachlor, acetochlor, and butachlor viaN-dealkylation. In this study, we report a three-component Rieske non-heme iron oxygenase (RHO) system catalyzing theN-dealkylation of these herbicides. The oxygenase component genecndAis located in a transposable element that is highly conserved in the two strains. CndA shares 24 to 42% amino acid sequence identities with the oxygenase components of some RHOs that catalyzeN- orO-demethylation. Two putative [2Fe-2S] ferredoxin genes and one glutathione reductase (GR)-type reductase gene were retrieved from the genome of each strain. These genes were not located in the immediate vicinity ofcndA. The four ferredoxins share 64 to 72% amino acid sequence identities to the ferredoxin component of dicambaO-demethylase (DMO), and the two reductases share 62 to 65% amino acid sequence identities to the reductase component of DMO.cndA, the four ferredoxin genes, and the two reductases genes were expressed inEscherichia coli, and the recombinant proteins were purified using Ni-affinity chromatography. The individual components or the components in pairs displayed no activity; the enzyme mixture showedN-dealkylase activities toward alachlor, acetochlor, and butachlor only when CndA-His6was combined with one of the four ferredoxins and one of the two reductases, suggesting that the enzyme consists of three components, a homo-oligomer oxygenase, a [2Fe-2S] ferredoxin, and a GR-type reductase, and CndA has a low specificity for the electron transport component (ETC). TheN-dealkylase utilizes NADH, but not NADPH, as the electron donor.

scholarly journals PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

2015 ◽  
Vol 81 (23) ◽  
pp. 8084-8092 ◽  
Author(s):  
Minggen Cheng ◽  
Kai Chen ◽  
Suhui Guo ◽  
Xing Huang ◽  
Jian He ◽  
...  
Keyword(s):  
Binding Site ◽  
Gene Cluster ◽  
Transcriptional Start Site ◽  
Transcriptional Activator ◽  
Transcriptional Regulators ◽  
Mobility Shift ◽  
Content Type ◽  
Dnase I Footprinting ◽  
Dioxygenase Gene ◽  
Mobility Shift Assay

ABSTRACTThe 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2Bcluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed inSphingobium wenxiniaestrain JZ-1Tby its substrate 3-PBA. In this study, we identified a transcriptional activator of thepbaA1A2Bcluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 inSphingomonassp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of thepbaA1A2Bcluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component genepbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in thepbaA1A2Bpromoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

scholarly journals cis-Encoded Small RNAs, a Conserved Mechanism for Repression of Polysaccharide Utilization in Bacteroides

2016 ◽  
Vol 198 (18) ◽  
pp. 2410-2418 ◽  
Author(s):  
Yanlu Cao ◽  
Konrad U. Förstner ◽  
Jörg Vogel ◽  
C. Jeffrey Smith
Keyword(s):  
Small Rnas ◽  
Nutritive Value ◽  
Hierarchical Control ◽  
Gene Clusters ◽  
Regulatory Control ◽  
Energy Sources ◽  
Transcriptional Level ◽  
Human Gut ◽  
Content Type ◽  
Wide Range

ABSTRACTBacteroidesis a major component of the human gut microbiota which has a broad impact on the development and physiology of its host and a potential role in a wide range of disease syndromes. The predominance of this genus is due in large part to expansion of paralogous gene clusters, termedpolysaccharideutilizationloci (PULs), dedicated to the uptake and catabolism of host-derived and dietary polysaccharides. The nutritive value and availability of polysaccharides in the gut vary greatly; thus, their utilization is hierarchical and strictly controlled. A typical PUL includes regulatory genes that induce PUL expression in response to the presence of specific glycan substrates. However, the existence of additional regulatory mechanisms has been predicted to explain phenomena such as hierarchical control and catabolite repression. In this report, a previously unknown layer of regulatory control was discovered inBacteroides fragilis. Exploratory transcriptome sequencing (RNA-seq) analysis revealed the presence ofcis-encoded antisense small RNAs (sRNAs) associated with 15 (30%) of theB. fragilisPULs. A model system using the Don (degradation of N-glycans) PUL showed that thedonSsRNA negatively regulated Don expression at the transcriptional level, resulting in a decrease in N-glycan utilization. Additional studies performed with otherBacteroidesspecies indicated that this regulatory mechanism is highly conserved and, interestingly, that the regulated PULs appear to be closely linked to the utilization of host-derived glycans rather than dietary plant polysaccharides. The findings described here demonstrate a global control mechanism underlying known PUL regulatory circuits and provide insight into regulation ofBacteroidesphysiology.IMPORTANCEThe human gut is colonized by a dense microbiota which is essential to the health and normal development of the host. A key to gut homeostasis is the preservation of a stable, diverse microbiota.Bacteroidesis a dominant genus in the gut, and the ability ofBacteroidesspecies to efficiently compete for a wide range of glycan energy sources is a crucial advantage for colonization. Glycan utilization is mediated by a large number ofpolysaccharideutilizationloci (PULs) which are regulated by substrate induction. In this report, a novel family of antisense sRNAs is described whose members repress gene expression in a distinct subset of PULs. This repression downregulates PUL expression in the presence of energy sources that are more readily utilized such as glucose, thereby allowing efficient glycan utilization.

scholarly journals Iron and Zinc Regulate Expression of a Putative ABC Metal Transporter inCorynebacterium diphtheriae

2018 ◽  
Vol 200 (10) ◽  
pp. e00051-18 ◽  
Author(s):  
Eric D. Peng ◽  
Diana M. Oram ◽  
Marcos D. Battistel ◽  
Lindsey R. Lyman ◽  
Darón I. Freedberg ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Bacterial Colonization ◽  
Corynebacterium Diphtheriae ◽  
Heme Iron ◽  
Transport Systems ◽  
Upstream Region ◽  
Aerobic Bacterium ◽  
Dependent Manner ◽  
Content Type ◽  
Regulatory Factors

ABSTRACTCorynebacterium diphtheriae, a Gram-positive, aerobic bacterium, is the causative agent of diphtheria and cutaneous infections. While mechanisms required for heme iron acquisition are well known inC. diphtheriae, systems involved in the acquisition of other metals such as zinc and manganese remain poorly characterized. In this study, we identified a genetic region that encodes an ABC-type transporter (iutBCD) and that is flanked by two genes (iutAandiutE) encoding putative substrate binding proteins of the cluster 9 family, a related group of transporters associated primarily with the import of Mn and Zn. We showed that IutA and IutE are both membrane proteins with comparable Mn and Zn binding abilities. We demonstrated that theiutABCDgenes are cotranscribed and repressed in response to iron by the iron-responsive repressor DtxR. Transcription ofiutEwas positively regulated in response to iron availability in a DtxR-dependent manner and was repressed in response to Zn by the Zn-dependent repressor Zur. Electrophoretic mobility shift assays showed that DtxR does not bind to theiutEupstream region, which indicates that DtxR regulation ofiutEis indirect and that other regulatory factors controlled by DtxR are likely responsible for the iron-responsive regulation. Analysis of theiutEpromoter region identified a 50-bp sequence at the 3′ end of theiutDgene that is required for the DtxR-dependent and iron-responsive activation of theiutEgene. These findings indicate that transcription ofiutEis controlled by a complex mechanism that involves multiple regulatory factors whose activity is impacted by both Zn and Fe.IMPORTANCEVaccination against diphtheria prevents toxin-related symptoms but does not inhibit bacterial colonization of the human host by the bacterium. Thus,Corynebacterium diphtheriaeremains an important human pathogen that poses a significant health risk to unvaccinated individuals. The ability to acquire iron, zinc, and manganese is critical to the pathogenesis of many disease-causing organisms. Here, we describe a gene cluster inC. diphtheriaethat encodes a metal importer that is homologous to broadly distributed metal transport systems, some with important roles in virulence in other bacterial pathogens. Two metal binding components of the gene cluster encode surface exposed proteins, and studies of such proteins may guide the development of second-generation vaccines forC. diphtheriae.

scholarly journals Constitutive Expression of a Nag-Like Dioxygenase Gene through an Internal Promoter in the 2-Chloronitrobenzene Catabolism Gene Cluster of Pseudomonas stutzeri ZWLR2-1

2016 ◽  
Vol 82 (12) ◽  
pp. 3461-3470 ◽  
Author(s):  
Yi-Zhou Gao ◽  
Hong Liu ◽  
Hong-Jun Chao ◽  
Ning-Yi Zhou
Keyword(s):  
Gene Cluster ◽  
Molecular Mechanisms ◽  
Expression System ◽  
Constitutive Expression ◽  
Pseudomonas Stutzeri ◽  
Initial Reaction ◽  
Synthetic Compounds ◽  
Content Type ◽  
Dioxygenase Gene ◽  
Catabolism Pathway

ABSTRACTThe gene cluster encoding the 2-chloronitrobenzene (2CNB) catabolism pathway inPseudomonas stutzeriZWLR2-1 is a patchwork assembly of a Nag-like dioxygenase (dioxygenase belonging to the naphthalene dioxygenase NagAaAbAcAd family fromRalstoniasp. strain U2) gene cluster and a chlorocatechol catabolism cluster. However, the transcriptional regulator gene usually present in the Nag-like dioxygenase gene cluster is missing, leaving it unclear how this cluster is expressed. The pattern of expression of the 2CNB catabolism cluster was investigated here. The results demonstrate that the expression was constitutive and not induced by its substrate 2CNB or salicylate, the usual inducer of expression in the Nag-like dioxygenase family. Reverse transcription-PCR indicated the presence of at least one transcript containing all the structural genes for 2CNB degradation. Among the three promoters verified in the gene cluster, P1 served as the promoter for the entire catabolism operon, but the internal promoters P2 and P3 also enhanced the transcription of the genes downstream. The P3 promoter, which was not previously defined as a promoter sequence, was the strongest of these three promoters. It drove the expression ofcnbAcAdencoding the dioxygenase that catalyzes the initial reaction in the 2CNB catabolism pathway. Bioinformatics and mutation analyses suggested that this P3 promoter evolved through the duplication of an 18-bp fragment and introduction of an extra 132-bp fragment.IMPORTANCEThe release of many synthetic compounds into the environment places selective pressure on bacteria to develop their ability to utilize these chemicals to grow. One of the problems that a bacterium must surmount is to evolve a regulatory device for expression of the corresponding catabolism genes. Considering that 2CNB is a xenobiotic that has existed only since the onset of synthetic chemistry, it may be a good example for studying the molecular mechanisms underlying rapid evolution in regulatory networks for the catabolism of synthetic compounds. The 2CNB utilizerPseudomonas stutzeriZWLR2-1 in this study has adapted itself to the new pollutant by evolving the always-inducible Nag-like dioxygenase into a constitutively expressed enzyme, and its expression has escaped the influence of salicylate. This may facilitate an understanding of how bacteria can rapidly adapt to the new synthetic compounds by evolving its expression system for key enzymes involved in the degradation of a xenobiotic.

scholarly journals A Substrate-Activated Efflux Pump, DesABC, Confers Zeamine Resistance to Dickeya zeae

mBio ◽  
2019 ◽  
Vol 10 (3) ◽  
Author(s):  
Zhibin Liang ◽  
Luhao Huang ◽  
Fei He ◽  
Xiaofan Zhou ◽  
Zurong Shi ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Efflux Pump ◽  
Bacterial Pathogens ◽  
Bacterial Genome ◽  
Resistance Mechanism ◽  
High Potency ◽  
Content Type ◽  
Wide Range ◽  
Distant Location

ABSTRACT Zeamines are a family of polyamino phytotoxins produced by Dickeya zeae EC1. These phytotoxins are also potent antibiotics against a range of microorganisms. To understand how D. zeae EC1 can protect itself from the antimicrobial activity of zeamines, we tested whether the ABC transporter genes within the zms (zeamine synthesis) gene cluster were related to zeamine resistance. Our results ruled out the possible involvement of these ABC transporters in zeamine resistance and instead unveiled an RND (resistance-nodulation-cell division) efflux pump, DesABC, which plays an important role in zeamine resistance in D. zeae EC1. The desAB genes are located next to the zms gene cluster, but desC is at a distant location in the bacterial genome. Null mutation of the desABC genes in a zeamine-minus derivative of strain EC1 led to about an 8- to 32-fold decrease in zeamine tolerance level. This efflux pump was zeamine specific and appeared to be conserved only in Dickeya species, which may explain the high potency of zeamines against a wide range of bacterial pathogens. Significantly, expression of the desAB genes was abolished by deletion of zmsA, which encodes zeamine biosynthesis but could be induced by exogenous addition of zeamines. The results suggest that sophisticated and coordinated regulatory mechanisms have evolved to govern zeamine production and tolerance. Taken together, these findings documented a novel signaling role of zeamines and the first resistance mechanism against zeamines, which is a family of potent and promising antibiotics against both Gram-positive and Gram-negative bacterial pathogens. IMPORTANCE Zeamines are a family of newly identified phytotoxins and potent antibiotics produced by D. zeae EC1. Unlike most bacterial organisms, which are highly sensitive, D. zeae EC1 is tolerant to zeamines, but the mechanisms involved are unknown. Our study showed, for the first time, that a new RND efflux pump, DesABC, is indispensable for D. zeae EC1 against zeamines. We found that the DesABC efflux pump was zeamine specific and appeared to be conserved only in the Dickeya species, which may explain the high potency of zeamines against a wide range of bacterial pathogens. We also showed that expression of DesABC efflux system genes was induced by zeamines. These findings not only provide an answer to why D. zeae EC1 is much more tolerant to zeamines than other bacterial pathogens but also document a signaling role of zeamines in modulation of gene expression.

Sign in / Sign up

Export Citation Format

Share Document