scholarly journals Novel Three-Component Rieske Non-Heme Iron Oxygenase System Catalyzing theN-Dealkylation of Chloroacetanilide Herbicides in Sphingomonads DC-6 and DC-2

2014 ◽  
Vol 80 (16) ◽  
pp. 5078-5085 ◽  
Author(s):  
Qing Chen ◽  
Cheng-Hong Wang ◽  
Shi-Kai Deng ◽  
Ya-Dong Wu ◽  
Yi Li ◽  
...  
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Heme Iron ◽  
Content Type ◽  
Non Heme Iron ◽  
Transport Component ◽  
Reductase Gene ◽  
Chloroacetanilide Herbicides ◽  
The Individual ◽  
Sequence Identities

ABSTRACTSphingomonads DC-6 and DC-2 degrade the chloroacetanilide herbicides alachlor, acetochlor, and butachlor viaN-dealkylation. In this study, we report a three-component Rieske non-heme iron oxygenase (RHO) system catalyzing theN-dealkylation of these herbicides. The oxygenase component genecndAis located in a transposable element that is highly conserved in the two strains. CndA shares 24 to 42% amino acid sequence identities with the oxygenase components of some RHOs that catalyzeN- orO-demethylation. Two putative [2Fe-2S] ferredoxin genes and one glutathione reductase (GR)-type reductase gene were retrieved from the genome of each strain. These genes were not located in the immediate vicinity ofcndA. The four ferredoxins share 64 to 72% amino acid sequence identities to the ferredoxin component of dicambaO-demethylase (DMO), and the two reductases share 62 to 65% amino acid sequence identities to the reductase component of DMO.cndA, the four ferredoxin genes, and the two reductases genes were expressed inEscherichia coli, and the recombinant proteins were purified using Ni-affinity chromatography. The individual components or the components in pairs displayed no activity; the enzyme mixture showedN-dealkylase activities toward alachlor, acetochlor, and butachlor only when CndA-His6was combined with one of the four ferredoxins and one of the two reductases, suggesting that the enzyme consists of three components, a homo-oligomer oxygenase, a [2Fe-2S] ferredoxin, and a GR-type reductase, and CndA has a low specificity for the electron transport component (ETC). TheN-dealkylase utilizes NADH, but not NADPH, as the electron donor.

scholarly journals Three-ComponentO-Demethylase System Essential for Catabolism of a Lignin-Derived Biphenyl Compound in Sphingobium sp. Strain SYK-6

2014 ◽  
Vol 80 (23) ◽  
pp. 7142-7153 ◽  
Author(s):  
Taichi Yoshikata ◽  
Kazuya Suzuki ◽  
Naofumi Kamimura ◽  
Masahiro Namiki ◽  
Shojiro Hishiyama ◽  
...  
Keyword(s):  
Electron Transfer ◽  
Amino Acid ◽  
Amino Acid Sequence ◽  
Reductase Activity ◽  
Normal Growth ◽  
Prosthetic Group ◽  
Gene Encoding ◽  
Content Type ◽  
Sequence Identities ◽  
Electron Transfer Component

ABSTRACTSphingobiumsp. strain SYK-6 is able to assimilate lignin-derived biaryls, including a biphenyl compound, 5,5′-dehydrodivanillate (DDVA). Previously,ligXa(SLG_07770), which is similar to the gene encoding oxygenase components of Rieske-type nonheme iron aromatic-ring-hydroxylating oxygenases, was identified to be essential for the conversion of DDVA; however, the genes encoding electron transfer components remained unknown. Disruption of putative electron transfer component genes scattered through the SYK-6 genome indicated that SLG_08500 and SLG_21200, which showed approximately 60% amino acid sequence identities with ferredoxin and ferredoxin reductase of dicambaO-demethylase, were essential for the normal growth of SYK-6 on DDVA. LigXa and the gene products of SLG_08500 (LigXc) and SLG_21200 (LigXd) were purified and were estimated to be a trimer, a monomer, and a monomer, respectively. LigXd contains FAD as the prosthetic group and showed much higher reductase activity toward 2,6-dichlorophenolindophenol with NADH than with NADPH. A mixture of purified LigXa, LigXc, and LigXd converted DDVA into 2,2′,3-trihydroxy-3′-methoxy-5,5′-dicarboxybiphenyl in the presence of NADH, indicating that DDVAO-demethylase is a three-component monooxygenase. This enzyme requires Fe(II) for its activity and is highly specific for DDVA, with aKmvalue of 63.5 μM andkcatof 6.1 s−1. Genome searches in six other sphingomonads revealed genes similar toligXcandligXd(>58% amino acid sequence identities) with a limited number of electron transfer component genes, yet a number of diverse oxygenase component genes were found. This fact implies that these few electron transfer components are able to interact with numerous oxygenase components and the conserved LigXc and LigXd orthologs are important in sphingomonads.

Bio-inspired amino acid oxidation by a non-heme iron catalyst modeling the action of 1-aminocyclopropane-1-carboxylic acid oxidase

2010 ◽  
Vol 46 (39) ◽  
pp. 7391 ◽  
Author(s):  
Gábor Baráth ◽  
József Kaizer ◽  
József Sándor Pap ◽  
Gábor Speier ◽  
Nadia El Bakkali-Taheri ◽  
...  
Keyword(s):  
Amino Acid ◽  
Carboxylic Acid ◽  
Iron Catalyst ◽  
Heme Iron ◽  
Acid Oxidation ◽  
Acid Oxidase ◽  
Amino Acid Oxidation ◽  
Non Heme Iron

scholarly journals Rhodococcus sp. Strain CR-53 LipR, the First Member of a New Bacterial Lipase Family (Family X) Displaying an Unusual Y-Type Oxyanion Hole, Similar to the Candida antarctica Lipase Clan

2012 ◽  
Vol 78 (6) ◽  
pp. 1724-1732 ◽  
Author(s):  
Arnau Bassegoda ◽  
F. I. Javier Pastor ◽  
Pilar Diaz
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Candida Antarctica ◽  
Burkholderia Cenocepacia ◽  
Sequence Motifs ◽  
Oxyanion Hole ◽  
Content Type ◽  
New Family ◽  
Consensus Amino Acid Sequence ◽  
Four Blocks

ABSTRACTBacterial lipases constitute the most important group of biocatalysts for synthetic organic chemistry. Accordingly, there is substantial interest in developing new valuable lipases. Considering the lack of information concerning the lipases of the genusRhodococcusand taking into account the interest raised by the enzymes produced by actinomycetes, a search for putative lipase-encoding genes fromRhodococcussp. strain CR-53 was performed. We isolated, cloned, purified, and characterized LipR, the first lipase described from the genusRhodococcus. LipR is a mesophilic enzyme showing preference for medium-chain-length acyl groups without showing interfacial activation. It displays good long-term stability and high tolerance for the presence of ions and chemical agents in the reaction mixture. Amino acid sequence analysis of LipR revealed that it displays four unique amino acid sequence motifs that clearly separate it from any other previously described family of bacterial lipases. Using bioinformatics tools, LipR could be related only to several uncharacterized putative lipases from different bacterial origins, all of which display the four blocks of consensus amino acid sequence motifs that contribute to define a new family of bacterial lipases, namely, family X. Therefore, LipR is the first characterized member of the new bacterial lipase family X. Further confirmation of this new family of lipases was performed after cloningBurkholderia cenocepaciaputative lipase, bearing the same conserved motifs and clustering in family X. Interestingly, all lipases grouping in the new bacterial lipase family X display a Y-type oxyanion hole, a motif conserved in theCandida antarcticalipase clan but never found among bacterial lipases. This observation contributes to confirm that LipR and its homologs belong to a new family of bacterial lipases.

scholarly journals Loss of an individual idiotype on chemical modification. A strategy for assigning idiotypic determinants.

1981 ◽  
Vol 153 (5) ◽  
pp. 1275-1285 ◽  
Author(s):  
J Dickerman ◽  
B Clevinger ◽  
B Friedenson
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Chemical Modification ◽  
Heavy Chain ◽  
Light Chains ◽  
Heavy Chains ◽  
Myeloma Proteins ◽  
Low Levels ◽  
The Individual ◽  
Complementary Strategy

Two dextran-binding myeloma proteins, J558 and Hdex 24, which possess the same individual idiotype (IdI) were diazotized to low levels (1-3.3 groups per subunit) with 1-[14C]-p-aminobenzoate. Both proteins lost the IdI idiotype under these conditions with most of the label incorporated on the heavy chains of each protein. When the diazotization ws carried out in the presence of the hapten 1-O-methyl-alpha-D-glucopyranoside the loss of idiotypic reactivity could be prevented for J558 but not for Hdex 24. Under these conditions most of the label was incorporated on the light chains of J558, but on the heavy chains of Hdex 24. For J558, these results show that a major determinant of the individual idiotype is within the hypervariable positions of the heavy chain. For Hdex 24 the determinant being modified is on the heavy chain but not involved in hapten binding. These results are consistent with previous work showing that J558 and Hdex 24 differ in amino acid sequence in the D and the J segments of the heavy chain and offer an alternative and complementary strategy for assigning idiotypic determinants.

scholarly journals Genetic and Biochemical Characterization of OXA-535, a Distantly Related OXA-48-Like β-Lactamase

2018 ◽  
Vol 62 (10) ◽  
Author(s):  
L. Dabos ◽  
A. B. Jousset ◽  
R. A. Bonnin ◽  
N. Fortineau ◽  
A. Zavala ◽  
...  
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Amino Acid Sequence ◽  
Amino Acid Sequence Identity ◽  
Biochemical Characterization ◽  
Content Type ◽  
Sequence Identity

ABSTRACT OXA-535 is a chromosome-encoded carbapenemase of Shewanella bicestrii JAB-1 that shares only 91.3% amino acid sequence identity with OXA-48. Catalytic efficiencies are similar to those of OXA-48 for most β-lactams, except for ertapenem, where a 2,000-fold-higher efficiency was observed with OXA-535. OXA-535 and OXA-436, a plasmid-encoded variant of OXA-535 differing by three amino acids, form a novel cluster of distantly related OXA-48-like carbapenemases. Comparison of blaOXA-535 and blaOXA-436 genetic environments suggests that an ISCR1 may be responsible for blaOXA-436 gene mobilization from the chromosome of Shewanella spp. to plasmids.

scholarly journals First Report of Wheat streak mosaic virus in Slovakia

Plant Disease ◽  
2008 ◽  
Vol 92 (9) ◽  
pp. 1365-1365 ◽  
Author(s):  
O. Kúdela ◽  
M. Kúdelová ◽  
S. Nováková ◽  
M. Glasa
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Mosaic Virus ◽  
Direct Sequencing ◽  
Sandwich Elisa ◽  
Triticum Aestivum L ◽  
Wheat Streak Mosaic Virus ◽  
Natural Occurrence ◽  
First Report ◽  
Sequence Identities

The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5′ GAGAGCAATACTGCGTGTACG 3′ and WS-8909R 5′ GCATAATGGCTCGAAGTGATG 3′) designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.

Sign in / Sign up

Export Citation Format

Share Document