Characterization of the Serpin-Encoding Gene of Bifidobacterium breve 210B

ABSTRACT Members of the serpin (serine protease inhibitor) superfamily have been identified in higher multicellular eukaryotes, as well as in bacteria, although examination of available genome sequences has indicated that homologs of the bacterial serpin-encoding gene (ser) are not widely distributed. In members of the genus Bifidobacterium this gene appears to be present in at least 5, and perhaps up to 9, of the 30 species tested. Moreover, phylogenetic analysis using available bacterial and eukaryotic serpin sequences revealed that bifidobacteria produce serpins that form a separate clade. We characterized the ser 210B locus of Bifidobacterium breve 210B, which encompasses a number of genes whose deduced protein products display significant similarity to proteins encoded by corresponding loci found in several other bifidobacteria. Northern hybridization, primer extension, microarray, reverse transcription-PCR (RT-PCR), and quantitative real-time PCR (qRT-PCR) analyses revealed that a 3.5-kb polycistronic mRNA encompassing the ser 210B operon with a single transcriptional start site is strongly induced following treatment of B. breve 210B cultures with some proteases. Interestingly, transcription of other bifidobacterial ser homologs appears to be triggered by different proteases.

Download Full-text

Reassortment of Genome Segments Creates Stable Lineages Among Strains of Orchid Fleck Virus Infecting Citrus in Mexico

Phytopathology ◽

10.1094/phyto-07-19-0253-fi ◽

2020 ◽

Vol 110 (1) ◽

pp. 106-120 ◽

Cited By ~ 1

Author(s):

Avijit Roy ◽

Andrew L. Stone ◽

Gabriel Otero-Colina ◽

Gang Wei ◽

Ronald H. Brlansky ◽

...

Keyword(s):

High Throughput Sequencing ◽

Sensu Stricto ◽

Genome Segment ◽

Rt Pcr ◽

Sequence Comparisons ◽

Orchid Fleck Virus ◽

Reverse Transcription Pcr ◽

Sequencing Technologies ◽

Negative Sense

The genus Dichorhavirus contains viruses with bipartite, negative-sense, single-stranded RNA genomes that are transmitted by flat mites to hosts that include orchids, coffee, the genus Clerodendrum, and citrus. A dichorhavirus infecting citrus in Mexico is classified as a citrus strain of orchid fleck virus (OFV-Cit). We previously used RNA sequencing technologies on OFV-Cit samples from Mexico to develop an OFV-Cit–specific reverse transcription PCR (RT-PCR) assay. During assay validation, OFV-Cit–specific RT-PCR failed to produce an amplicon from some samples with clear symptoms of OFV-Cit. Characterization of this virus revealed that dichorhavirus-like particles were found in the nucleus. High-throughput sequencing of small RNAs from these citrus plants revealed a novel citrus strain of OFV, OFV-Cit2. Sequence comparisons with known orchid and citrus strains of OFV showed variation in the protein products encoded by genome segment 1 (RNA1). Strains of OFV clustered together based on host of origin, whether orchid or citrus, and were clearly separated from other dichorhaviruses described from infected citrus in Brazil. The variation in RNA1 between the original (now OFV-Cit1) and the new (OFV-Cit2) strain was not observed with genome segment 2 (RNA2), but instead, a common RNA2 molecule was shared among strains of OFV-Cit1 and -Cit2, a situation strikingly similar to OFV infecting orchids. We also collected mites at the affected groves, identified them as Brevipalpus californicus sensu stricto, and confirmed that they were infected by OFV-Cit1 or with both OFV-Cit1 and -Cit2. OFV-Cit1 and -Cit2 have coexisted at the same site in Toliman, Queretaro, Mexico since 2012. OFV strain-specific diagnostic tests were developed.

Download Full-text

Role of ABC Transporters in Aureobasidin A Resistance

Antimicrobial Agents and Chemotherapy ◽

10.1128/aac.42.4.755 ◽

1998 ◽

Vol 42 (4) ◽

pp. 755-761 ◽

Cited By ~ 23

Author(s):

Atsuko Ogawa ◽

Takashi Hashida-Okado ◽

Masahiro Endo ◽

Hirofumi Yoshioka ◽

Takashi Tsuruo ◽

...

Keyword(s):

Abc Transporters ◽

Mammalian Cells ◽

Northern Hybridization ◽

Significant Similarity ◽

Genetic Studies ◽

Multiple Copies ◽

Recessive Mutant ◽

Encoding Gene ◽

Aureobasidin A

ABSTRACT Aureobasidin A (AbA) has strong antifungal effects arising from an unusual mechanism. We show that AbA interacts with ATP-binding cassette (ABC) transporters in yeast and mammalian cells. We isolated a gene ofSaccharomyces cerevisiae that conferred resistance to AbA when the gene was present in multiple copies. The gene was identical toYOR1/YRS1, which confers resistance to oligomycin, reveromycin, and organic anions, none of which have structures similar to that of AbA. We also isolated an aur3 Rrecessive mutant of S. cerevisiae with increased resistance to AbA. Northern hybridization showed that theaur3 R mutant expressed not onlyYOR1 but also the ABC transporter-encoding genePDR5 at high levels. Genetic studies showed that theaur3 R mutant had a mutation in thePDR1 gene, which encodes a transcriptional regulator ofPDR5 and YOR1. Analysis of a yor1disruptant of the aur3/pdr1 mutant showed that both the functional YOR1 gene and the mutation in PDR1were necessary for AbA resistance. These results suggest thatYOR1 is more important than PDR5 for AbA resistance. We found in Candida albicans a novel gene whose sequence was similar to the sequence of YOR1 in S. cerevisiae. The amino acid sequence of the C. albicans YOR1 homolog showed no significant similarity to the sequences ofCDR1 and CDR2, which are ABC transporters ofC. albicans. Furthermore, AbA inhibited the efflux of the anticancer agent vincristine through P glycoproteins in cancer cells with multidrug resistance.

Download Full-text

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon)

Indonesian Journal of Chemistry ◽

10.22146/ijc.21388 ◽

2011 ◽

Vol 11 (3) ◽

pp. 246-252

Author(s):

Tri Joko Raharjo ◽

Rosyida Azis Rizki ◽

Stalis Norma Ethica ◽

Elly Rustanti ◽

L. Hartanto Nugroho

Keyword(s):

Enzymatic Reaction ◽

Pcr Amplification ◽

Stilbene Synthase ◽

Nucleotide Sequence Analysis ◽

Dna Fragments ◽

Gene Fragment ◽

Rt Pcr ◽

Gnetum Gnemon ◽

Encoding Gene

Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encoding gene from melinjo plant (Gnetum gnemon L.) has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3') and GGR2 (5' CTGGATCGCACATCC TGGTG 3') primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Download Full-text

Transcriptional Analysis of the vanC Cluster from Enterococcus gallinarum Strains with Constitutive and Inducible Vancomycin Resistance

Antimicrobial Agents and Chemotherapy ◽

10.1128/aac.49.3.1060-1066.2005 ◽

2005 ◽

Vol 49 (3) ◽

pp. 1060-1066 ◽

Cited By ~ 6

Author(s):

Diana Panesso ◽

Lorena Abadía-Patiño ◽

Natasha Vanegas ◽

Peter E. Reynolds ◽

Patrice Courvalin ◽

...

Keyword(s):

Transcriptional Start Site ◽

Consensus Sequence ◽

Transcriptional Analysis ◽

Northern Hybridization ◽

Sensor Kinase ◽

Glycopeptide Resistance ◽

High Identity ◽

Reverse Transcription Pcr ◽

Constitutive Resistance ◽

Enterococcus Gallinarum

ABSTRACT The vanC glycopeptide resistance gene cluster encodes enzymes required for synthesis of peptidoglycan precursors ending in d-Ala-d-Ser. Enterococcus gallinarum BM4174 and SC1 are constitutively and inducibly resistant to vancomycin, respectively. Analysis of peptidoglycan precursors in both strains indicated that UDP-MurNAc-tetrapeptide and UDP-MurNAc-pentapeptide[d-Ser] were synthesized in E. gallinarum SC1 only in the presence of vancomycin (4 μg/ml), whereas the “resistance” precursors accumulated in the cytoplasm of BM4174 cells under both inducing and noninducing conditions. Northern hybridization and reverse transcription-PCR experiments revealed that all the genes from the cluster, vanC-1, vanXY C, vanT, vanR C, and vanS C, were transcribed from a single promoter. In the inducible SC1 isolate, transcriptional regulation appeared to be responsible for inducible expression of resistance. Promoter mapping in E. gallinarum BM4174 revealed that the transcriptional start site was located 30 nucleotides upstream from vanC-1 and that the −10 promoter consensus sequence had high identity with that of the vanA cluster. Comparison of the deduced sequence of the vanS C genes from isolates with constitutive and inducible resistance revealed several amino acid substitutions located in the X box (R200L) and in the region between the F and G2 boxes (D312N, D312A, and G320S) of the putative sensor kinase proteins from isolates with constitutive resistance.

Download Full-text

Gene Structure and Transcriptional Organization of the dnaK Operon of Bifidobacterium breve UCC 2003 and Application of the Operon in Bifidobacterial Tracing

Applied and Environmental Microbiology ◽

10.1128/aem.71.1.487-500.2005 ◽

2005 ◽

Vol 71 (1) ◽

pp. 487-500 ◽

Cited By ~ 57

Author(s):

Marco Ventura ◽

Ralf Zink ◽

Gerald F. Fitzgerald ◽

Douwe van Sinderen

Keyword(s):

16S Rrna ◽

Osmotic Shock ◽

Gene Region ◽

Evolutionary Development ◽

Pcr Analysis ◽

Northern Hybridization ◽

Gene Marker ◽

Rrna Gene ◽

Bifidobacterium Breve ◽

Polycistronic Mrna

ABSTRACT The incorporation and delivery of bifidobacterial strains as probiotic components in many food preparations expose these microorganisms to a multitude of environmental insults, including heat and osmotic stresses. We characterized the dnaK gene region of Bifidobacterium breve UCC 2003. Sequence analysis of the dnaK locus revealed four genes with the organization dnaK-grpE-dnaJ-ORF1, whose deduced protein products display significant similarity to corresponding chaperones found in other bacteria. Northern hybridization and real-time LightCycler PCR analysis revealed that the transcription of the dnaK operon was strongly induced by osmotic shock but was not induced significantly by heat stress. A 4.4-kb polycistronic mRNA, which represented the transcript of the complete dnaK gene region, was detected. Many other small transcripts, which were assumed to have resulted from intensive processing or degradation of this polycistronic mRNA, were identified. The transcription start site of the dnaK operon was determined by primer extension. Phylogenetic analysis of the available bifidobacterial grpE and dnaK genes suggested that the evolutionary development of these genes has been similar. The phylogeny derived from the various bifidobacterial grpE and dnaK sequences is consistent with that derived from 16S rRNA. The use of these genes in bifidobacterial species as an alternative or complement to the 16S rRNA gene marker provides sequence signatures that allow a high level of discrimination between closely related species of this genus.

Download Full-text

Identification and Functional Characterization of a new Sunflower Germacrene A Synthase (HaGAS3)

Natural Product Communications ◽

10.1177/1934578x1000500507 ◽

2010 ◽

Vol 5 (5) ◽

pp. 1934578X1000500 ◽

Cited By ~ 1

Author(s):

Jens Göpfert ◽

Anna-Katharina Bülow ◽

Otmar Spring

Keyword(s):

Sesquiterpene Lactones ◽

Glandular Trichomes ◽

Functional Characterization ◽

Plant Tissues ◽

Rt Pcr ◽

Plant Organs ◽

Reverse Transcription Pcr ◽

Engineered Yeast

Sesquiterpenes and sesquiterpene lactones are major natural compounds found in linear and capitate glandular trichomes of sunflower, Helianthus annuus L. In addition to two recently identified germacrene A synthases HaGAS1 and HaGAS2, found in capitate trichome gland cells, reverse transcription-PCR experiments have now allowed identification of a third enzyme of this type, HaGAS3. Its cDNA sequence was established and its functional characterization as a germacrene A synthase was achieved through in vitro expression in engineered yeast, and by GC-MS experiments. PCR and RT-PCR experiments with cDNA from different plant organs revealed that the new enzyme is expressed independently from the other two. While these latter two were expressed in plant organs bearing capitate glandular trichomes and in roots, the new enzyme occurred in plant tissues not linked to the presence of specific trichomes (for example, cotyledons), and was absent in roots. The experiments show that independently regulated pathways for the first cyclic sesquiterpene, germacrene A, are present in sunflower.

Download Full-text

Cloning and Expression of ntnD, Encoding a Novel NAD(P)+-Independent 4-Nitrobenzyl Alcohol Dehydrogenase from Pseudomonas sp. Strain TW3

Journal of Bacteriology ◽

10.1128/jb.182.11.3136-3141.2000 ◽

2000 ◽

Vol 182 (11) ◽

pp. 3136-3141 ◽

Cited By ~ 26

Author(s):

Keith D. James ◽

Michelle A. Hughes ◽

Peter A. Williams

Keyword(s):

Amino Acid ◽

Amino Acid Sequence ◽

Alcohol Dehydrogenase ◽

Benzyl Alcohol ◽

Cloning And Expression ◽

Significant Similarity ◽

Reverse Transcription Pcr ◽

Nitrobenzyl Alcohol ◽

Dehydrogenase Gene

ABSTRACT Pseudomonas sp. strain TW3 is able to metabolize 4-nitrotoluene to 4-nitrobenzoate and toluene to benzoate aerobically via a route analogous to the upper pathway of the TOL plasmids. We report the cloning and characterization of a benzyl alcohol dehydrogenase gene (ntnD) which encodes the enzyme for the catabolism of 4-nitrobenzyl alcohol and benzyl alcohol to 4-nitrobenzaldehyde and benzaldehyde, respectively. The gene is located downstream of the previously reported ntn gene cluster. NtnD bears no similarity to the analogous TOL plasmid XylB (benzyl alcohol dehydrogenase) protein either in its biochemistry, being NAD(P)+ independent and requiring assay via dye-linked electron transfer, or in its deduced amino acid sequence. It does, however, have significant similarity in its amino acid sequence to other NAD(P)+-independent alcohol dehydrogenases and contains signature patterns characteristic of type III flavin adenine dinucleotide-dependent alcohol oxidases. Reverse transcription-PCR demonstrated that ntnD is transcribed during growth on 4-nitrotoluene, although apparently not as part of the same transcript as the other ntn genes. The substrate specificity of the enzyme expressed from the cloned and overexpressed gene was similar to the activity expressed from strain TW3 grown on 4-nitrotoluene, providing evidence that ntnD is the previously unidentified gene in the pathway of 4-nitrotoluene catabolism. Examination of the 14.8-kb region around the ntn genes suggests that one or more recombination events have been involved in the formation of their current organization.

Download Full-text

Characterization of a novel recombination event in the Deformed wing bee virus polymerase gene

Journal of the Hellenic Veterinary Medical Society ◽

10.12681/jhvms.16071 ◽

2018 ◽

Vol 68 (4) ◽

pp. 661 ◽

Cited By ~ 1

Author(s):

G GORAS ◽

IGA RUETHER ◽

CH TANANAKI ◽

S GOUNARI ◽

V LIOLIOS ◽

...

Keyword(s):

Recombination Event ◽

Polymerase Gene ◽

Rt Pcr ◽

Rna Dependent Rna Polymerase ◽

Reverse Transcription Pcr ◽

Plot Analysis ◽

Recombination Point ◽

Bee Virus ◽

Similarity Plot

Honeybee populations are known to be infected by numerous viruses. Reverse transcription-PCR (RT-PCR) of regions of the RNA-dependent RNA polymerase is often used to diagnose the presence in apiaries and also to classify the type of virus detected. In this report, through analysis of the RdRp gene, we describe a novel recombination event in the DWV genome. Similarity plot analysis amplified from hundred positive individuals identified a previously undescribed recombination point in the 5’ region of the polymerase gene. To our knowledge this is the first description of recombination in the DWV polymerase gene and highlights the continuous genetic evolution of these viruses.

Download Full-text

Molecular Characterization of hsp20, Encoding a Small Heat Shock Protein of Bifidobacterium breve UCC2003

Applied and Environmental Microbiology ◽

10.1128/aem.02496-06 ◽

2007 ◽

Vol 73 (14) ◽

pp. 4695-4703 ◽

Cited By ~ 32

Author(s):

Marco Ventura ◽

Carlos Canchaya ◽

Ziding Zhang ◽

Gerald F. Fitzgerald ◽

Douwe van Sinderen

Keyword(s):

Heat Shock ◽

Stress Proteins ◽

Osmotic Shock ◽

Small Heat Shock Protein ◽

Bifidobacterium Breve ◽

Class B ◽

Close Relationship ◽

Encoding Gene ◽

Shock Proteins

ABSTRACT Small heat shock proteins (sHSPs) are members of a diverse family of stress proteins that are important in cells to protect proteins under stressful conditions. Genome analysis of Bifidobacterium breve UCC2003 revealed a single sHSP-encoding gene, which was classified as a hsp20 gene by comparative analyses. Genomic surveillance of available genome sequences indicated that hsp20 homologs are not widely distributed in bacteria. In members of the genus Bifidobacterium, this gene appears to be present in only 7 of the 30 currently described species. Moreover, phylogenetic analysis using all available bacterial and eukaryotic sHSP sequences revealed a close relationship between bifidobacterial HSP20 and the class B sHSPs found in members of the division Firmicutes. The results of this comparative analysis and variation in codon usage content suggest that hsp20 was acquired by certain bifidobacteria through horizontal gene transfer. Analysis by slot blot, Northern blot, and primer extension experiments showed that transcription of hsp20 is strongly induced in response to severe heat shock regimens and by osmotic shock.

Download Full-text

Identification of Hotspot Mutations in the N Gene of SARS-CoV-2 in Russian Clinical Samples That May Affect the Detection by Reverse Transcription-PCR

Diagnostics ◽

10.3390/diagnostics12010147 ◽

2022 ◽

Vol 12 (1) ◽

pp. 147

Author(s):

Sergei A. Kiryanov ◽

Tatiana A. Levina ◽

Maria V. Konopleva ◽

Anatoly P. Suslov

Keyword(s):

Genetic Variability ◽

Variable Region ◽

N Gene ◽

Clinical Samples ◽

Rt Pcr ◽

E Gene ◽

Reverse Transcription Pcr ◽

Affect Detection ◽

Common Target

Sensitive and reliable diagnostic test systems based on real-time PCR are of great importance in the fight against the ongoing SARS-CoV-2 pandemic. The genetic variability of the SARS-CoV-2 virus leads to the accumulation of mutations, some of which may affect the sensitivity of modern PCR assays. The aim of this study was to search in Russian clinical samples for new mutations in SARS-CoV-2 gene N that can affect the detection by RT-PCR. In this study, the polymorphisms in the regions of the target gene N causing failed or poor detection of the target N in the RT-PCR assay on 12 selected samples were detected. Sequencing the entire N and E genes in these samples along with other 195 samples that were positive for both target regions was performed. Here, we identified a number of nonsynonymous mutations and one novel deletion in the N gene that affected the ability to detect a target in the N gene as well a few mutations in the E gene of SARS-CoV-2 that did not affect detection. Sequencing revealed that majority of the mutations in the N gene were located in the variable region between positions 193 and 235 aa, inside and nearby the phosphorylated serine-rich region of the protein N. This study highlights the importance of the further characterization of the genetic variability and evolution of gene N, the most common target for detecting SARS-CoV-2. The use of at least two targets for detecting SARS-CoV-2, including one for the E gene, will be necessary for reliable diagnostics.

Download Full-text