scholarly journals Elevated Cyclic AMP Levels in T Lymphocytes Transformed by Human T-Cell Lymphotropic Virus Type 1

2010 ◽  
Vol 84 (17) ◽  
pp. 8732-8742 ◽  
Author(s):  
Andrea K. Kress ◽  
Grit Schneider ◽  
Klemens Pichler ◽  
Martina Kalmer ◽  
Bernhard Fleckenstein ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
Cyclic Amp ◽  
Virus Type ◽  
Ectopic Expression ◽  
Transformed Cells ◽  
Human T Cell ◽  
Transformed Cell Lines ◽  
Camp Levels

ABSTRACT Human T-cell lymphotropic virus type 1 (HTLV-1), the cause of adult T-cell leukemia/lymphoma (ATLL), transforms CD4+ T cells to permanent growth through its transactivator Tax. HTLV-1-transformed cells share phenotypic properties with memory and regulatory T cells (T-reg). Murine T-reg-mediated suppression employs elevated cyclic AMP (cAMP) levels as a key regulator. This led us to determine cAMP levels in HTLV-1-transformed cells. We found elevated cAMP concentrations as a consistent feature of all HTLV-1-transformed cell lines, including in vitro-HTLV-1-transformed, Tax-transformed, and patient-derived cells. In transformed cells with conditional Tax expression, high cAMP levels coincided with the presence of Tax but were lost without it. However, transient ectopic expression of Tax alone was not sufficient to induce cAMP. We found specific downregulation of the cAMP-degrading phosphodiesterase 3B (PDE3B) in HTLV-1-transformed cells, which was independent of Tax in transient expression experiments. This is in line with the notion that PDE3B transcripts and cAMP levels are inversely correlated. Overexpression of PDE3B led to a decrease of cAMP in HTLV-1-transformed cells. Decreased expression of PDE3B was associated with inhibitory histone modifications at the PDE3B promoter and the PDE3B locus. In summary, Tax transformation and its continuous expression contribute to elevated cAMP levels, which may be regulated through PDE3B suppression. This shows that HTLV-1-transformed cells assume biological features of long-lived T-cell populations that potentially contribute to viral persistence.

scholarly journals In Vivo Selection of T-Cell Receptor Junctional Region Sequences by HLA-A2 Human T-Cell Lymphotropic Virus Type 1 Tax11-19 Peptide Complexes

2001 ◽  
Vol 75 (2) ◽  
pp. 1065-1071 ◽  
Author(s):  
Mineki Saito ◽  
Graham P. Taylor ◽  
Akiko Saito ◽  
Yoshitaka Furukawa ◽  
Koichiro Usuku ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
T Cell Receptor ◽  
Virus Type ◽  
Cell Receptor ◽  
Antigen Specificity ◽  
Human T Cell ◽  
Cdr3 Region

ABSTRACT Using HLA-peptide tetrameric complexes, we isolated human T-cell lymphotrophic virus type 1 Tax peptide-specific CD8+ T cells ex vivo. Antigen-specific amino acid motifs were identified in the T-cell receptor Vβ CDR3 region of clonally expanded CD8+ T cells. This result directly confirms the importance of the CDR3 region in determining the antigen specificity in vivo.

AB0268 HUMAN T-CELL LEUKAEMIA VIRUS TYPE 1 MAY INVALIDATE T-SPOT.TB RESULTS AMONG RHEUMATOID ARTHRITIS PATIENTS: A RETROSPECTIVE OBSERVATIONAL STUDY

2020 ◽  
Vol 79 (Suppl 1) ◽  
pp. 1432.1-1433
Author(s):  
K. Umekita ◽  
Y. Hashiba ◽  
R. Kudou ◽  
S. Miyauchi ◽  
M. Kimura ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
Virus Type ◽  
Peripheral Blood ◽  
Medical Records ◽  
Cell Leukaemia ◽  
Leukaemia Virus ◽  
Human T Cell ◽  
Ifn Γ

Background:In clinical rheumatology, interferon-γ release assays (IGRAs) have been reported as a useful diagnostic test for latent tuberculosis infection (LTBI) before beginning the administration of biologics such as anti-TNF therapies (1). CD4-positive T cells are the main target in Human T-cell leukaemia virus type 1 (HTLV-1) infection. Several reports suggest that the reaction of tuberculin skin test (TST) is attenuated in HTLV-1-positive individuals compared with that in HTLV-1-negative individuals (2). However, it remains unclear whether IGRAs are reliable for detecting TB infection among HTLV-1-positive RA patients.Objectives:The present study aimed to investigate the usefulness of the T-SPOT.TBassay in HTLV-1-positive RA patients. In addition, the association between the existence of IFN-γ producing T cells and HTLV-1 proviral loads (PVLs) in HTLV-1-positive RA patients was analysed on the basis of the T-SPOT.TBassay results.Methods:We reviewed the medical records of 75 HTLV-1-negative and 29 HTLV-1-positive RA patients were suspected cases of LTBI and evaluated using the T-SPOT.TBassay as a clinical practice from April 2012 to July 2019. The results of T-SPOT.TBwere collected from medical records, retrospectively. Peripheral blood samples were obtained from HTLV-1-positive RA patients for the analysis of HTLV-1 PVLs values. The study protocol was approved by the research ethics committees of our hospitals.Results:Approximately 55% of the HTLV-1-positive RA patients showed invalid results for the T-SPOT.TBassay (p < 0.0001); the cause of invalid results was a spot-forming count of >10 spots in the negative controls of the T-SPOT.TBassay among HTLV-1-positive RA patients. Among HTLV-1-positive RA patients, HTLV-1 PVL values were significantly higher in 16 patients who showed invalid results than in 13 patients who did not (p = 0.003). There were no between-group differences in female patient ratio, age, RA disease activity and therapeutic regimens. IFN-γ producing cells were detected in the peripheral blood of HTLV-1-positive RA patients without stimulation with TB-specific antigens.Conclusion:The incidence of invalid results for the T-SPOT.TBassay has been reported to be as low as 0.6% (3). The results of this assay for screening of LTBI in HTLV-1-positive RA patients should be interpreted with caution. Furthermore, our results show that an increase in IFN-γ producing T cell numbers due to HTLV-1 infection in RA patients may affect the pathogenesis of RA.References:[1]Iannone, F., et al.J. Rheumatol. Suppl.91, 41-46 (2014).[2]Tachibana, N., et al.Int. J. Cancer42, 829-831 (1988).[3]Rego, K., et al.Tuberculosis (Edinb.)108, 178-185 (2018).Acknowledgments:We would like to thank Dr Yuki Hashikura and Ms Yuki Kaseda of the University of Miyazaki for their technical support in this work. We would also like to acknowledge Ms Yumiko Kai at the Institute of Rheumatology, Zenjinkai Shimin-no-Mori Hospital, for her help in data management.A part this work was supported by a grant from the Practical Research Project for Rare/Intractable Diseases of the Japan Agency for Medical Research and Development (Grant No. JP19ek0109356), a Health and Labor Sciences Research Grant on Rare and Intractable Diseases from the Ministry of Health, Labor and Welfare of Japan (Grant No. 19FC1007), and a Grant-in-Aid for Clinical Research from Miyazaki University Hospital.Disclosure of Interests:Kunihiko Umekita Paid instructor for: Astellas Pharma Inc. Chugai Pharma Inc. Tanabe-Mitsubishi Pharma Inc., Speakers bureau: Bristol-Myers Squibb, Yayoi Hashiba: None declared, Risa Kudou: None declared, Shunichi Miyauchi: None declared, Masatoshi Kimura: None declared, Motohiro Matsuda: None declared, Chihiro Iwao: None declared, Yumi Kariya: None declared, Takeshi Kawaguchi: None declared, Katoko Takajo: None declared, Koushou Iwao: None declared, Yuuki Rikitake: None declared, Ichiro Takajo: None declared, Toshihiko Hidaka Paid instructor for: Astellas Pharma Inc. Chugai Pharma Inc. Tanabe-Mitsubishi Pharma Inc., Speakers bureau: Astellas Pharma Inc. Chugai Pharma Inc. Tanabe-Mitsubishi Pharma Inc., Akihiko Okayama: None declared

scholarly journals Inhibition of p53 Transactivation Function by the Human T-Cell Lymphotropic Virus Type 1 Tax Protein

1998 ◽  
Vol 72 (2) ◽  
pp. 1165-1170 ◽  
Author(s):  
Cynthia A. Pise-Masison ◽  
Kyeong-Sook Choi ◽  
Michael Radonovich ◽  
Jürgen Dittmer ◽  
Seong-Jin Kim ◽  
...  
Keyword(s):  
T Cell ◽  
Cell Lines ◽  
Virus Type ◽  
Primary Role ◽  
Wild Type ◽  
Transformed Cell ◽  
Human T Cell ◽  
Wild Type P53 ◽  
Transformed Cell Lines

ABSTRACT Human T-cell lymphotropic virus type 1 (HTLV-1) is the etiologic agent for adult T-cell leukemia. HTLV-1 transforms lymphocytes, and there is increasing evidence that the virus-encoded protein, Tax, plays a primary role in viral transformation. We have shown that wild-type p53 in HTLV-1-transformed cells is stabilized. This study was initiated to directly analyze whether the p53 in HTLV-1-transformed cell lines was transcriptionally active and to identify the viral gene product responsible for stabilization and inactivation. Transfection experiments using a p53-responsive reporter plasmid and γ-irradiation studies demonstrate that the wild-type p53 in HTLV-1-transformed cell lines is not fully active. Further, we demonstrate that the HTLV-1-transforming protein, Tax, stabilizes and inactivates p53 function. Cotransfection of Tax with p53 results in a greater than 10-fold reduction in p53 transcription activity. Using Gal4-p53 fusion proteins, we demonstrate that Tax inhibition of p53 transactivation function is independent of sequence-specific DNA binding. Moreover, Tax inhibits p53 function by interfering with the activity of the N-terminal activation domain (amino acids 1 to 52). We conclude that Tax is involved in the inactivation of p53 function and stabilization of p53 in HTLV-1-infected cells. The functional interference of p53 function by Tax may be important for transformation and leukemogenesis.

scholarly journals Ras signaling contributes to survival of human T-cell leukemia/lymphoma virus type 1 (HTLV-1) Tax-positive T-cells

APOPTOSIS ◽  
2011 ◽  
Vol 17 (3) ◽  
pp. 219-228 ◽  
Author(s):  
Giovanna Stoppa ◽  
Enrica Rumiato ◽  
Daniela Saggioro
Keyword(s):  
T Cells ◽  
T Cell ◽  
Virus Type ◽  
Ras Signaling ◽  
T Cell Leukemia ◽  
Cell Leukemia ◽  
Human T Cell

scholarly journals Proliferation Response to Interleukin-2 and Jak/Stat Activation of T Cells Immortalized by Human T-Cell Lymphotropic Virus Type 1 Is Independent of Open Reading Frame I Expression

1999 ◽  
Vol 73 (11) ◽  
pp. 9642-9649 ◽  
Author(s):  
Nathaniel D. Collins ◽  
Celine D’Souza ◽  
Björn Albrecht ◽  
Michael D. Robek ◽  
Lee Ratner ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
Cell Lines ◽  
Virus Type ◽  
Interleukin 2 ◽  
Receptor Expression ◽  
Open Reading Frame ◽  
Reading Frame ◽  
Human T Cell

ABSTRACT Human T-cell lymphotropic virus type 1 (HTLV-1), a complex retrovirus, encodes a hydrophobic 12-kD protein from pX open reading frame (ORF) I that localizes to cellular endomembranes and contains four minimal SH3 binding motifs (PXXP). We have demonstrated the importance of ORF I expression in the establishment of infection and hypothesize that p12I has a role in T-cell activation. In this study, we tested interleukin-2 (IL-2) receptor expression, IL-2-mediated proliferation, and Jak/Stat activation in T-cell lines immortalized with either wild-type or ORF I mutant clones of HTLV-1. All cell lines exhibited typical patterns of T-cell markers and maintained mutation fidelity. No significant differences between cell lines were observed in IL-2 receptor chain (α, β, or γc) expression, in IL-2-mediated proliferation, or in IL-2-induced phosphorylated forms of Stat3, Stat5, Jak1, or Jak3. The expression of ORF I is more likely to play a role in early HTLV-1 infection, such as in the activation of quiescent T cells in vivo.

scholarly journals Stimulation of Cyclin-Dependent Kinase Activity and G1- to S-Phase Transition in Human Lymphocytes by the Human T-Cell Leukemia/Lymphotropic Virus Type 1 Tax Protein

1998 ◽  
Vol 72 (1) ◽  
pp. 633-640 ◽  
Author(s):  
Iris Schmitt ◽  
Oliver Rosin ◽  
Peter Rohwer ◽  
Manfred Gossen ◽  
Ralph Grassmann
Keyword(s):  
Phase Transition ◽  
Cell Cycle ◽  
T Cells ◽  
T Cell ◽  
Virus Type ◽  
S Phase ◽  
T Cell Leukemia ◽  
Cell Leukemia ◽  
Human T Cell

ABSTRACT The human T-cell leukemia/lymphotropic virus type 1 (HTLV-1) induces a malignant lymphocytic disease. The HTLV-1 transactivator protein, Tax, is believed to be crucial for the development of the disease since it is transforming in vitro and induces tumors in transgenic animals. Although the transcriptional modulation of viral and cellular gene expression by Tax has been analyzed thoroughly, it has remained unclear how the Tax functions act on the cell cycle of primary T cells. To investigate the mechanism of Tax-mediated T-cell stimulation, we transduced primary human cord blood T cells with a conditional, tetracycline repressor-based tax expression system. Permanent Tax expression results in an abnormal proliferation of T cells which closely resemble HTLV-1-infected lymphocytes. Suppression of Tax synthesis stopped lymphocyte growth and caused cell cycle arrest in the G1 phase. Upon reinduction oftax expression, the arrested cells entered the S phase. This showed that Tax has mitogenic activity, which is required for stimulating the G1- to S-phase transition of immortalized lymphocytes. In mammalian cells, the G1-phase progression is controlled by the serial activation of several cyclin-dependent kinases (Cdks), starting with Cdk4 and Cdk6. In the presence of Tax, both Cdk4 and Cdk6 were activated. The suppression of Tax synthesis, however, resulted in a significant reduction of the Cdk4 and Cdk6 activities but did not influence the expression of Cdk4, Cdk6, or cognate D-type cyclin proteins. These data suggest that Tax induces Cdk4 and Cdk6 activity in primary human T lymphocytes; this Cdk activation is likely to account for the mitogenic Tax effect and for the abnormal T-cell proliferation of HTLV-1-infected lymphocytes.

scholarly journals Inhibition of T-Cell Receptor Signal Transduction and Viral Expression by the Linker for Activation of T Cells-Interacting p12I Protein of Human T-Cell Leukemia/Lymphoma Virus Type 1

2007 ◽  
Vol 81 (17) ◽  
pp. 9088-9099 ◽  
Author(s):  
Risaku Fukumoto ◽  
Miroslav Dundr ◽  
Christophe Nicot ◽  
Anthony Adams ◽  
Valerio W. Valeri ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
T Cell Receptor ◽  
Virus Type ◽  
Calcium Release ◽  
Cell Receptor ◽  
Cell Leukemia ◽  
Viral Expression ◽  
Human T Cell

ABSTRACT The p12I protein of human T-cell leukemia/lymphoma virus type 1 (HTLV-1) is a small oncoprotein that increases calcium release following protein kinase C activation by phorbol myristate acetate, and importantly, this effect is linker for activation of T cells (LAT) independent. Here, we demonstrate that p12I inhibits the phosphorylation of LAT, Vav, and phospholipase C-γ1 and decreases NFAT (nuclear factor of activated T cells) activation upon engagement of the T-cell receptor (TCR) with anti-CD3 antibody. Furthermore, we demonstrate that p12I localizes to membrane lipid rafts and, upon engagement of the TCR, relocalizes to the interface between T cells and antigen-presenting cells, defined as the immunological synapse. A p12I knockout molecular clone of HTLV-1 expresses more virus upon antigen stimulation than the isogenic wild type, suggesting that, by decreasing T-cell responsiveness, p12I curtails viral expression. Thus, p12I has contrasting effects on TCR signaling: it down-regulates TCR in a LAT-dependent manner on one hand, and on the other, it increases calcium release in a LAT-independent manner. The negative regulation of T-cell activation by p12I may have evolved to minimize immune recognition of infected CD4+ T cells, to impair the function of infected cytotoxic CD8+ T cells, and to favor viral persistence in the infected host.

Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element

Blood ◽  
2003 ◽  
Vol 101 (9) ◽  
pp. 3615-3621 ◽  
Author(s):  
Nozomu Hiraiwa ◽  
Tomonori Yabuta ◽  
Keijiro Yoritomi ◽  
Miki Hiraiwa ◽  
Yuetsu Tanaka ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
Virus Type ◽  
Binding Protein ◽  
T Cell Leukemia ◽  
Cell Leukemia ◽  
Jurkat T Cells ◽  
Human T Cell ◽  
Responsive Element

Human T-cell leukemic virus type 1 (HTLV-1)–infected T cells express the fucosyltransferase (Fuc-T) VIIgene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VIItranscription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5′-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)–responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C–rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)–promoter. Furthermore, CREMα, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.

Sign in / Sign up

Export Citation Format

Share Document